Previous Article | Next Article 
Journal of Virology, November 2004, p. 12672-12676, Vol. 78, No. 22
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.22.12672-12676.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Immunization with Modified Vaccinia Virus Ankara-Based Recombinant Vaccine against Severe Acute Respiratory Syndrome Is Associated with Enhanced Hepatitis in Ferrets
Hana Weingartl,1,2,
Markus Czub,2,3,
Stefanie Czub,1,2
James Neufeld,1
Peter Marszal,1
Jason Gren,1
Greg Smith,1
Shane Jones,3
Roxanne Proulx,3
Yvonne Deschambault,3
Elsie Grudeski,3
Anton Andonov,2,3
Runtao He,2,3
Yan Li,2,3
John Copps,1
Allen Grolla,3
Daryl Dick,3
Jody Berry,1,2
Shelley Ganske,1
Lisa Manning,1 and
Jingxin Cao2,3*
National Centre for Foreign Animal Diseases,1
National Microbiology Laboratory, Canadian Science Centre for Human and Animal Health, Winnipeg, Manitoba, Canada R3E 3R2,3
Department of Medical Microbiology, University of Manitoba, Winnipeg, Manitoba, Canada R3T 2N22
Received 29 April 2004/
Accepted 29 July 2004

ABSTRACT
Severe acute respiratory syndrome (SARS) caused by a newly identified
coronavirus (SARS-CoV) is a serious emerging human infectious
disease. In this report, we immunized ferrets (
Mustela putorius furo) with recombinant modified vaccinia virus Ankara (rMVA)
expressing the SARS-CoV spike (S) protein. Immunized ferrets
developed a more rapid and vigorous neutralizing antibody response
than control animals after challenge with SARS-CoV; however,
they also exhibited strong inflammatory responses in liver tissue.
Inflammation in control animals exposed to SARS-CoV was relatively
mild. Thus, our data suggest that vaccination with rMVA expressing
SARS-CoV S protein is associated with enhanced hepatitis.

TEXT
Severe acute respiratory syndrome (SARS) is a serious emerging
human infectious disease of the 21st century. The causative
agent was identified and characterized as a new member of the
family
Coronaviridae, SARS-associated coronavirus (SARS-CoV)
(
8,
14). The first SARS outbreak was primarily contained by
the means of quarantine. As evidenced by the recently reported
new cases (
http://www.wpro.who.int/sars/docs/pressreleases/pr_27122003.asp and
http://www.who.int/csr/don/2004_04-23/en/), it is almost
certain that SARS-CoV remains a constant threat to public health.
Efforts to develop SARS vaccine candidates are under way worldwide
(
9). Several recent reports have described studies on evaluation
of SARS vaccine candidates in monkey and mouse models (
1,
7,
15,
19). It has been shown that a recombinant adenovirus-based
SARS vaccine candidate expressing SARS-CoV spike (S) and nucleocapsid
proteins could induce strong neutralizing antibody and T-cell
responses in monkeys (rhesus macaques) (
7). However, the protection
potential was not evaluated by challenge experiment. The neutralizing
antibody response induced by recombinant modified vaccinia virus
Ankara (rMVA) expressing SARS-CoV S protein (rMVA-S) has been
shown to inhibit SARS-CoV replication in a mouse model (
1).
Since replication of SARS-CoV in mice can last only approximately
3 days postinfection, the memory immune response, which is essential
for an effective prophylactic vaccine, is difficult to evaluate
in mice. In this communication, we evaluated the effects of
rMVA-S in ferrets.
Coronavirus S is the major antigenic protein responsible for inducing neutralizing antibody responses (4, 6), while MVA is a widely used recombinant poxvirus vector for development of safe and effective recombinant vaccines (11). We constructed rMVA-S using a standard protocol for construction of recombinant poxviruses with the recombinant vector pJS5, provided by Bernard Moss at the National Institutes of Health (2, 5). The S gene was synthesized based on a SARS-CoV Tor2 isolate (8) by reverse transcription-PCR (RT-PCR) with primer pair AGGCGAATTCATGTTTATTTTCTTATTATTTCTTACTCTCACT (N terminus primer; EcoRI site in italics) and TATACCCGGGTTATGTGTAATGTAATTTGACACCCTTGAGAA (C terminus primer; SmaI site in italics). Expression of the S protein was confirmed with Western blot analysis using a specific monoclonal antibody against the SARS-CoV S protein (Fig. 1).
Since it has been reported that ferrets were susceptible to
SARS-CoV infection (
10), we decided to use ferrets for an immunization-and-challenge
study. Animal housing and manipulations were approved by the
Animal Care Committee of the Canadian Science Centre for Human
and Animal Health and met the Canadian Council on Animal Care
guidelines. Six- to 10-week-old male (castrated) ferrets were
purchased from Marshall Farm Pet Supplies (Wolcott, N.Y.). Enzyme-linked
immunosorbent assay (ELISA) and neutralization tests were performed
to confirm that there was no antibody cross-reactivity against
SARS-CoV in all ferrets before the experiment. Ferrets were
divided into three groups (see Tables
1 and
2; ferrets were
housed individually, i.e., one ferret per cage) and were immunized
with parental MVA (ferrets 1 to 3), rMVA-S (ferrets 7 to 9),
or phosphate-buffered saline (PBS; ferrets 10 to 12) on day
0 with a dose of 10
8 PFU of the corresponding virus per ferret
by intraperitoneal and subcutaneous routes, and a booster immunization
was given on day 14 with the same regimen. Due to the lack of
ferret-specific reagents for analysis of cell-mediated immune
responses, only neutralizing antibody responses were monitored
by microplaque reduction neutralization test. Briefly, a triplicate
of serial dilutions of heat-inactivated ferret sera were incubated
with 100 PFU of the SARS-CoV in a 100-µl volume for 60
min at 37°C. After incubation, the serum-SARS-CoV mixture
was added to monolayers of Vero-V76 cells in a 96-well tissue
culture plate. Infected Vero-V76 cells were incubated at 37°C
in 5% CO
2 for 3 to 4 days with a 2% carboxymethylcellulose overlay
and then fixed with 4% formaldehyde and stained with 0.5% crystal
violet. Neutralization titers were determined as the reciprocal
of the highest serum dilution that neutralized at least 70%
of the formation of plaques on Vero-V76 cells. As shown in Table
1, neutralizing activity was detected in sera collected from
all three ferrets 7 days after booster immunization with rMVA-S
virus, while the titer declined to undetectable level 14 days
after the booster. The serum immunoglobulin G titer determined
by ELISA corresponded with the neutralization results (see online
supplementary data). Moreover, the antibody response specific
for the S protein in rMVA-S-vaccinated ferrets was confirmed
by Western blotting.
Two weeks after the booster immunization, ferrets were challenged
with 10
6 PFU of the SARS-CoV Tor2 isolate by the intranasal
route in our biosafety level 4 facility. Ferrets immunized with
rMVA-S developed a neutralizing antibody response as early as
3 days after SARS-CoV challenge, while neutralizing antibodies
were not detected in most of the control ferrets until 7 days
after SARS-CoV infection (Table
1). This shows that a typical
memory immune response occurred in ferrets immunized with rMVA-S
following SARS-CoV challenge. Furthermore, ferrets immunized
with rMVA-S developed peak neutralizing antibody titer between
7 and 9 days after SARS-CoV challenge. In contrast, other challenged
ferrets developed comparable levels of neutralizing antibodies
13 days later (Table
1). To our knowledge, this is the first
report showing that immunization with a SARS vaccine candidate
induced a rapid memory immune response, which is an essential
feature for an effective prophylactic vaccine, following SARS-CoV
challenge in an animal model.
Although no clinical signs (e.g., elevated temperature and altered behavior including feeding) were observed up to 29 days postchallenge, viral RNA was detected in pharyngeal swabs and blood samples by RT-PCR from all ferrets challenged with SARS-CoV by our previously reported protocols (17). The viral RNA could be detected in pharyngeal swabs starting from 1 day after SARS-CoV infection (Table 2). Ferret 8 (vaccinated with rMVA-S) still shed virus in the pharyngeal excretion up to 22 days postchallenge. Interestingly, viral RNA could be detected in blood specimens only at 8 days postchallenge and lasted up to 22 days postinfection. Moreover, live SARS-CoV could be isolated from pharyngeal swabs early in the infection (up to 5 days postinfection; level ranged from 4 x 103 to 1.4 x 104 PFU per pharyngeal swab, and no significant difference between rMVA-S-immunized and control ferrets was observed), while an attempt to isolate SARS-CoV from sera was not successful (data not shown). We speculate that the failure to isolate live virus from pharyngeal swabs (5 days postinfection) and sera (8 days postinfection) is related to the increased neutralizing antibody response (Table 1). Real-time RT-PCR to quantify the virus loads from the positive blood specimens (as determined by classical RT-PCR; Table 2) was also unsuccessful. The sensitivity of our real-time RT-PCR has been titrated to be 0.1 PFU per ml, while the classical RT-PCR showed sensitivity as low as 104 PFU per ml (A. Andonov and H. Weigartl, unpublished data). Thus, although SARS-CoV could enter into blood after approximately 8 days of challenge, viral load was low (lower than 0.1 PFU per ml). Nonetheless, our data indicate that immunization with rMVA-S had no significant effects on the level of SARS-CoV replication in ferrets, although a rapid, vigorous memory neutralizing antibody response occurred. In contrast, a live SARS-CoV (15), a DNA-based vaccine expressing the S protein (19), and rMVA-S (1) have been reported to induce significant protective immunity in mice following SARS-CoV challenge. The most likely cause for the difference in the protective efficacy in mice and ferrets immunized with rMVA-S is that SARS-CoV exhibits different replication kinetics in these two animal systems. For example, SARS-CoV could replicate to a high titer in the first 3 days after challenge in mice, while the virus titer decreased sharply afterwards (15). Replication of SARS-CoV in ferrets, however, could last up to 22 days after infection (Table 2). Thus, further studies to elucidate the kinetics of SARS-CoV replication in ferrets should aid in understanding the difference between these two animal models for development of SARS vaccines.
Biochemical tests of blood samples and histopathological examination of various tissues were performed to investigate any pathological effects as consequences of rMVA-S vaccination and SARS-CoV challenge. The VetTest dry chemistry analyzer, with the protocol and reagents provided by the manufacturer (IDEXX Laboratories Inc. USA), was used to examine blood samples taken at various time points for the levels of alkaline phosphatase (an indicator of hepatic disease involving the biliary system), alanine aminotransferase (ALT; an indicator of hepatic parenchymal lesions), albumin (an indicator of abnormality of hepatic and renal function), creatinine (an indicator of renal disease), total bilirubin (an indicator of obstructive liver disease), total protein (an indicator of abnormality of hepatic and renal function), and urea (an indicator of renal disease). Surprisingly, ferrets vaccinated with rMVA-S demonstrated a significantly higher level of ALT after challenge with SARS-CoV than the control ferrets (Fig. 2). The elevated level of ALT was evidenced by 4 to 6 days after SARS-CoV infection and lasted until day 22. All the other parameters tested fell into the normal or slightly higher-than-normal (alkaline phosphatase) physiological range compared to the reference value (based on the recommendation from IDEXX Laboratories Inc. USA and data from 60 serum samples from healthy ferrets provided by the ferret supplier, Marshall Farm).
Histopathological examination was performed on liver sections
(fixed with 10% PBS-buffered formalin, embedded in wax, and
stained with hematoxylin and eosin) from ferrets sacrificed
between 27 and 29 days postchallenge. It was found that ferrets
immunized with rMVA-S (particularly ferret 9) developed severe
periportal and panlobular mononuclear hepatitis (Fig.
3). In
contrast, only mild periportal mononuclear hepatitis was observed
in control ferrets receiving parental MVA or PBS. In addition,
the panlobular hepatitis observed in rMVA-S-immunized ferrets
was also accompanied by signs of focal necrosis of liver cells,
including swelling of hepatocytes (hydropic degeneration), increased
acidophilia, and hyperchromatic and fragmented nuclei (karyorrhexis).
Thus, the histopathological finding is in line with the blood
chemistry analysis. A summary of histopathological findings
was included in the online supplementary materials. Note that
the liver tissue specimen for pathological sectioning was collected
postmortem (27 to 29 days after the challenge); by then the
ALT level had already declined to (or slightly below) the normal
range (Fig.
2E) and no viral RNA could be detected (Table
2).
Not surprisingly, no viral antigen was found in the liver tissue
by immunolabeling with the specific anti-S monoclonal antibody
(data not shown). Therefore, it is likely that the liver inflammation
shown in Fig.
3 does not reflect the true severity of the hepatitis
associated with rMVA-S vaccination and SARS-CoV challenge and,
in fact, may represent the recovering stage. Detailed pathological
examination at the time when the ALT level is at the highest
should be performed in future studies. Other organs were only
mildly affected by SARS-CoV infection (data not shown).
It is known that neutralizing antibodies induced by the S protein
of feline infectious peritonitis virus (also a coronavirus)
often lead to accelerated infection by the mechanism of antibody-dependent
enhancement of virus infectivity (
12,
13,
16,
18). SARS-CoV
has been shown to infect hepatocytes and cause hepatitis in
humans (
3). Here, we found that immunization with rMVA-S is
associated with enhanced hepatitis in ferrets after SARS-CoV
challenge. However, our present data cannot conclusively demonstrate
whether or not the enhanced liver inflammation was the consequence
of accelerated virus infection of livers or simply enhanced
immunopathological effects on livers as a combined result from
rMVA-S immunization and SARS-CoV infection. Further investigation,
such as passive transfer of immune sera from vaccinated or SARS-CoV-infected
ferrets to naive ferrets, which then are challenged with SARS-CoV,
should aid in understanding the link between the immune responses
induced by SARS-CoV antigens and enhanced liver inflammation.
In this communication, we demonstrated that vaccination with rMVA-S could induce a rapid and vigorous memory neutralizing antibody response, which is an essential feature for an effective prophylactic vaccine, in ferrets after challenge with SARS-CoV. On the other hand, our data suggest that vaccination with SARS-CoV S may lead to enhanced liver damage following SARS-CoV infection. This information is extremely important for development of safe SARS vaccines. Extra caution should be taken in proposed human trials of SARS vaccines (9) due to the potential liver damage from immunization and virus infection.

ACKNOWLEDGMENTS
This work was supported by Health Canada and Canadian Food Inspection
Agency.
We thank the continuous support from Frank Plummer, Paul Kitching, and Tim Booth. We also thank Mike Carpenter and Steven Jones for their critical reading of the manuscript and Peter Wright and Nicole Beausoleil for their help.

FOOTNOTES
* Corresponding author. Mailing address: National Microbiology Laboratory, Canadian Science Centre for Human and Animal Health, 1015 Arlington St., Winnipeg, MB, Canada R3E 3R2. Phone: (204) 789-6052. Fax: (204) 789-2082. E-mail:
jingxin_cao{at}hc-sc.gc.ca.

H.W. and M.C. contributed equally to this work. 

REFERENCES
1 - Berry, J. D., S. Jones, M. A. Drebot, A. Andonov, M. Sabara, X. Y. Yuan, H. Weingartl, L. Fernando, P. Marszal, J. Gren, B. Nicolas, M. Andonova, F. Ranada, M. J. Gubbins, T. B. Ball, P. Kitching, Y. Li, A. Kabani, and F. Plummer. 2004. Development and characterisation of neutralising monoclonal antibody to the SARS-coronavirus. J. Virol. Methods 120:87-96.[CrossRef][Medline]
1 - Bisht, H., A. Roberts, L. Vogel, A. Bukreyev, P. L. Collins, B. R. Murphy, K. Subbarao, and B. Moss. 2004. Severe acute respiratory syndrome coronavirus spike protein expressed by attenuated vaccinia virus protectively immunizes mice. Proc. Natl. Acad. Sci. USA 101:6641-6646.[Abstract/Free Full Text]
2 - Chakrabarti, S., J. R. Sisler, and B. Moss. 1997. Compact, synthetic, vaccinia virus early/late promoter for protein expression. BioTechniques 23:1094-1097.[Medline]
3 - Chau, T. N., K. C. Lee, H. Yao, T. Y. Tsang, T. C. Chow, Y. C. Yeung, K. W. Choi, Y. K. Tso, T. Lau, S. T. Lai, and C. L. Lai. 2004. SARS-associated viral hepatitis caused by a novel coronavirus: report of three cases. Hepatology 39:302-310.[CrossRef][Medline]
4 - Collins, A. R., R. L. Knobler, H. Powell, and M. J. Buchmeier. 1982. Monoclonal antibodies to murine hepatitis virus-4 (strain JHM) define the viral glycoprotein responsible for attachment and cell-cell fusion. Virology 119:358-371.[CrossRef][Medline]
5 - Falkner, F. G., and B. Moss. 1988. Escherichia coli gpt gene provides dominant selection for vaccinia virus open reading frame expression vectors. J. Virol. 62:1849-1854.[Abstract/Free Full Text]
6 - Fleming, J. O., S. A. Stohlman, R. C. Harmon, M. M. Lai, J. A. Frelinger, and L. P. Weiner. 1983. Antigenic relationships of murine coronaviruses: analysis using monoclonal antibodies to JHM (MHV-4) virus. Virology 131:296-307.[CrossRef][Medline]
7 - Gao, W., A. Tamin, A. Soloff, L. D'Aiuto, E. Nwanegbo, P. D. Robbins, W. J. Bellini, S. Barratt-Boyes, and A. Gambotto. 2003. Effects of a SARS-associated coronavirus vaccine in monkeys. Lancet 362:1895-1896.[CrossRef][Medline]
8 - Marra, M. A., S. J. Jones, C. R. Astell, R. A. Holt, A. Brooks-Wilson, Y. S. Butterfield, J. Khattra, J. K. Asano, S. A. Barber, S. Y. Chan, A. Cloutier, S. M. Coughlin, D. Freeman, N. Girn, O. L. Griffith, S. R. Leach, M. Mayo, H. McDonald, S. B. Montgomery, P. K. Pandoh, A. S. Petrescu, A. G. Robertson, J. E. Schein, A. Siddiqui, D. E. Smailus, J. M. Stott, G. S. Yang, F. Plummer, A. Andonov, H. Artsob, N. Bastien, K. Bernard, T. F. Booth, D. Bowness, M. Czub, M. Drebot, L. Fernando, R. Flick, M. Garbutt, M. Gray, A. Grolla, S. Jones, H. Feldmann, A. Meyers, A. Kabani, Y. Li, S. Normand, U. Stroher, G. A. Tipples, S. Tyler, R. Vogrig, D. Ward, B. Watson, R. C. Brunham, M. Krajden, M. Petric, D. M. Skowronski, C. Upton, and R. L. Roper. 2003. The genome sequence of the SARS-associated coronavirus. Science 300:1399-1404.[Abstract/Free Full Text]
9 - Marshall, E., and M. Enserink. 2004. Medicine. Caution urged on SARS vaccines. Science 303:944-946.[Abstract/Free Full Text]
10 - Martina, B. E., B. L. Haagmans, T. Kuiken, R. A. Fouchier, G. F. Rimmelzwaan, G. Van Amerongen, J. S. Peiris, W. Lim, and A. D. Osterhaus. 2003. Virology: SARS virus infection of cats and ferrets. Nature 425:915.[CrossRef][Medline]
11 - Moss, B. 1996. Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety. Proc. Natl. Acad. Sci. USA 93:11341-11348.[Abstract/Free Full Text]
12 - Olsen, C. W. 1993. A review of feline infectious peritonitis virus: molecular biology, immunopathogenesis, clinical aspects, and vaccination. Vet. Microbiol. 36:1-37.[CrossRef][Medline]
13 - Pedersen, N. C., and J. W. Black. 1983. Attempted immunization of cats against feline infectious peritonitis, using avirulent live virus or sublethal amounts of virulent virus. Am. J. Vet. Res. 44:229-234.[Medline]
14 - Rota, P. A., M. S. Oberste, S. S. Monroe, W. A. Nix, R. Campagnoli, J. P. Icenogle, S. Penaranda, B. Bankamp, K. Maher, M. H. Chen, S. Tong, A. Tamin, L. Lowe, M. Frace, J. L. DeRisi, Q. Chen, D. Wang, D. D. Erdman, T. C. Peret, C. Burns, T. G. Ksiazek, P. E. Rollin, A. Sanchez, S. Liffick, B. Holloway, J. Limor, K. McCaustland, M. Olsen-Rasmussen, R. Fouchier, S. Gunther, A. D. Osterhaus, C. Drosten, M. A. Pallansch, L. J. Anderson, and W. J. Bellini. 2003. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science 300:1394-1399.[Abstract/Free Full Text]
15 - Subbarao, K., J. McAuliffe, L. Vogel, G. Fahle, S. Fischer, K. Tatti, M. Packard, W. J. Shieh, S. Zaki, and B. Murphy. 2004. Prior infection and passive transfer of neutralizing antibody prevent replication of severe acute respiratory syndrome coronavirus in the respiratory tract of mice. J. Virol. 78:3572-3577.[Abstract/Free Full Text]
16 - Vennema, H., R. J. de Groot, D. A. Harbour, M. Dalderup, T. Gruffydd-Jones, M. C. Horzinek, and W. J. Spaan. 1990. Early death after feline infectious peritonitis virus challenge due to recombinant vaccinia virus immunization. J. Virol. 64:1407-1409.[Abstract/Free Full Text]
17 - Weingartl, H. M., J. Copps, M. A. Drebot, P. Marszal, G. Smith, J. Gren, M. Andova, J. Pasick, P. Kitching, and M. Czub. 2004. Susceptibility of pigs and chickens to SARS coronavirus. Emerg. Infect. Dis. 10:179-184.[Medline]
18 - Weiss, R. C., and F. W. Scott. 1981. Antibody-mediated enhancement of disease in feline infectious peritonitis: comparisons with dengue hemorrhagic fever. Comp. Immunol. Microbiol. Infect. Dis. 4:175-189.[CrossRef][Medline]
19 - Yang, Z. Y., W. P. Kong, Y. Huang, A. Roberts, B. R. Murphy, K. Subbarao, and G. J. Nabel. 2004. A DNA vaccine induces SARS coronavirus neutralization and protective immunity in mice. Nature 428:561-564.[CrossRef][Medline]
Journal of Virology, November 2004, p. 12672-12676, Vol. 78, No. 22
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.22.12672-12676.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Yasui, F., Kai, C., Kitabatake, M., Inoue, S., Yoneda, M., Yokochi, S., Kase, R., Sekiguchi, S., Morita, K., Hishima, T., Suzuki, H., Karamatsu, K., Yasutomi, Y., Shida, H., Kidokoro, M., Mizuno, K., Matsushima, K., Kohara, M.
(2008). Prior Immunization with Severe Acute Respiratory Syndrome (SARS)-Associated Coronavirus (SARS-CoV) Nucleocapsid Protein Causes Severe Pneumonia in Mice Infected with SARS-CoV. J. Immunol.
181: 6337-6348
[Abstract]
[Full Text]
-
Li, C. K.-f., Wu, H., Yan, H., Ma, S., Wang, L., Zhang, M., Tang, X., Temperton, N. J., Weiss, R. A., Brenchley, J. M., Douek, D. C., Mongkolsapaya, J., Tran, B.-H., Lin, C.-l. S., Screaton, G. R., Hou, J.-l., McMichael, A. J., Xu, X.-N.
(2008). T Cell Responses to Whole SARS Coronavirus in Humans. J. Immunol.
181: 5490-5500
[Abstract]
[Full Text]
-
See, R. H., Petric, M., Lawrence, D. J., Mok, C. P. Y., Rowe, T., Zitzow, L. A., Karunakaran, K. P., Voss, T. G., Brunham, R. C., Gauldie, J., Finlay, B. B., Roper, R. L.
(2008). Severe acute respiratory syndrome vaccine efficacy in ferrets: whole killed virus and adenovirus-vectored vaccines. J. Gen. Virol.
89: 2136-2146
[Abstract]
[Full Text]
-
Du, L., Zhao, G., Lin, Y., Sui, H., Chan, C., Ma, S., He, Y., Jiang, S., Wu, C., Yuen, K.-Y., Jin, D.-Y., Zhou, Y., Zheng, B.-J.
(2008). Intranasal Vaccination of Recombinant Adeno-Associated Virus Encoding Receptor-Binding Domain of Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Spike Protein Induces Strong Mucosal Immune Responses and Provides Long-Term Protection against SARS-CoV Infection. J. Immunol.
180: 948-956
[Abstract]
[Full Text]
-
Cheng, V. C. C., Lau, S. K. P., Woo, P. C. Y., Yuen, K. Y.
(2007). Severe Acute Respiratory Syndrome Coronavirus as an Agent of Emerging and Reemerging Infection. Clin. Microbiol. Rev.
20: 660-694
[Abstract]
[Full Text]
-
Gillim-Ross, L., Subbarao, K.
(2006). Emerging Respiratory Viruses: Challenges and Vaccine Strategies. Clin. Microbiol. Rev.
19: 614-636
[Abstract]
[Full Text]
-
He, Y., Li, J., Heck, S., Lustigman, S., Jiang, S.
(2006). Antigenic and Immunogenic Characterization of Recombinant Baculovirus-Expressed Severe Acute Respiratory Syndrome Coronavirus Spike Protein: Implication for Vaccine Design.. J. Virol.
80: 5757-5767
[Abstract]
[Full Text]
-
He, Y., Li, J., Li, W., Lustigman, S., Farzan, M., Jiang, S.
(2006). Cross-Neutralization of Human and Palm Civet Severe Acute Respiratory Syndrome Coronaviruses by Antibodies Targeting the Receptor-Binding Domain of Spike Protein. J. Immunol.
176: 6085-6092
[Abstract]
[Full Text]
-
Okeke, M. I., Nilssen, O., Traavik, T.
(2006). Modified vaccinia virus Ankara multiplies in rat IEC-6 cells and limited production of mature virions occurs in other mammalian cell lines. J. Gen. Virol.
87: 21-27
[Abstract]
[Full Text]
-
Sims, A. C., Baric, R. S., Yount, B., Burkett, S. E., Collins, P. L., Pickles, R. J.
(2005). Severe Acute Respiratory Syndrome Coronavirus Infection of Human Ciliated Airway Epithelia: Role of Ciliated Cells in Viral Spread in the Conducting Airways of the Lungs. J. Virol.
79: 15511-15524
[Abstract]
[Full Text]
-
Weiss, S. R., Navas-Martin, S.
(2005). Coronavirus Pathogenesis and the Emerging Pathogen Severe Acute Respiratory Syndrome Coronavirus. Microbiol. Mol. Biol. Rev.
69: 635-664
[Abstract]
[Full Text]
-
Yount, B., Roberts, R. S., Sims, A. C., Deming, D., Frieman, M. B., Sparks, J., Denison, M. R., Davis, N., Baric, R. S.
(2005). Severe Acute Respiratory Syndrome Coronavirus Group-Specific Open Reading Frames Encode Nonessential Functions for Replication in Cell Cultures and Mice. J. Virol.
79: 14909-14922
[Abstract]
[Full Text]
-
Yi, C. E., Ba, L., Zhang, L., Ho, D. D., Chen, Z.
(2005). Single Amino Acid Substitutions in the Severe Acute Respiratory Syndrome Coronavirus Spike Glycoprotein Determine Viral Entry and Immunogenicity of a Major Neutralizing Domain. J. Virol.
79: 11638-11646
[Abstract]
[Full Text]
-
Greenough, T. C., Carville, A., Coderre, J., Somasundaran, M., Sullivan, J. L., Luzuriaga, K., Mansfield, K.
(2005). Pneumonitis and Multi-Organ System Disease in Common Marmosets (Callithrix jacchus) Infected with the Severe Acute Respiratory Syndrome-Associated Coronavirus. Am. J. Pathol.
167: 455-463
[Abstract]
[Full Text]
-
Tang, B. S. F., Chan, K.-h., Cheng, V. C. C., Woo, P. C. Y., Lau, S. K. P., Lam, C. C. K., Chan, T.-l., Wu, A. K. L., Hung, I. F. N., Leung, S.-y., Yuen, K.-y.
(2005). Comparative Host Gene Transcription by Microarray Analysis Early after Infection of the Huh7 Cell Line by Severe Acute Respiratory Syndrome Coronavirus and Human Coronavirus 229E. J. Virol.
79: 6180-6193
[Abstract]
[Full Text]