Previous Article | Next Article 
Journal of Virology, November 2004, p. 11778-11785, Vol. 78, No. 21
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.21.11778-11785.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
The C-Mer Gene Is Induced by Epstein-Barr Virus Immediate-Early Protein BRLF1
Yuling Li,1
Nupam P. Mahajan,1
Jennifer Webster-Cyriaque,1,2,3
Prasanna Bhende,1
Gregory K. Hong,1,3
H. Shelton Earp,1,4,5 and
Shannon Kenney1,3,4*
UNC Lineberger Comprehensive Cancer Center,1
Dental School,2
Department of Microbiology and Immunology,3
Department of Medicine,4
Department of Pharmacology, University of North Carolina at Chapel Hill, North Carolina5
Received 23 February 2004/
Accepted 8 June 2004

ABSTRACT
BRLF1 (R) is one of two Epstein-Barr virus (EBV) immediate-early
proteins that mediate the switch from the latent to the lytic
form of viral replication. In this report, we show that R induces
expression of the cellular C-mer gene in a variety of cell lines.
C-mer expression was detected in lymphoblastoid cells immortalized
with wild-type EBV but not in lymphoblastoid cells immortalized
with an EBV that had BRLF1 deleted. Oral hairy leukoplakia tongue
tissue, which contains the lytic form of EBV replication, also
has enhanced C-mer expression. C-mer is a receptor tyrosine
kinase activated by the ligand Gas6. C-mer is required for phagocytosis
of apoptotic debris by monocytes/macrophages and retinal pigment
epithelial cells and is capable of producing an antiapoptotic
signal. Modulation of the C-mer signal transduction cascade
by a variety of different approaches did not alter the ability
of R to induce lytic EBV gene transcription. Therefore, C-mer
activation may be important for some other aspect of lytic EBV
infection.

INTRODUCTION
The Epstein-Barr virus (EBV) is a human gammaherpesvirus that
causes infectious mononucleosis and is associated with a variety
of different B-cell and epithelial cell tumors. EBV can infect
cells in either a latent or a lytic form (
28,
39). While EBV
infection in B cells is usually latent, viral infection of normal
epithelial cells in vivo results in lytic infection (
28,
39)
and asymptomatic shedding of infectious virus in the saliva
of immunocompetent hosts. In some immunosuppressed patients,
lytic infection results in an epithelial lesion on the lateral
border of the tongue, oral hairy leukoplakia (OHL), which contains
lytically replicating EBV (
20,
28,
39).
The two EBV immediate-early proteins, BRLF1 (R) and BZLF1 (Z), are transcription factors that mediate the switch from latent to lytic infection (8, 13, 24, 25, 27, 30, 47). Expression of either Z or R is sufficient to initiate EBV lytic viral gene expression in latently infected cells (5, 7, 14, 38, 40, 46, 51, 54). R activates certain early viral promoters (such as the SM and BHRF1 promoters) through a direct DNA binding mechanism (21, 37) but stimulates the immediate-early Z promoter by an indirect mechanism involving phosphatidylinositol 3-kinase and stress mitogen-activated protein kinase pathway activation (1, 9). The effect of R on cellular gene expression has not been as well studied. However, we recently found that R activates expression of the cellular fatty acid synthase (FAS) gene and that FAS activity is important for R-mediated induction of lytic viral gene expression (29).
C-mer is a transmembrane protein belonging to the Mer/Axl/Tyro3 receptor tyrosine kinase family. Signal transduction by all members is initialized by a ligand, Gas6 (4, 18, 19, 22, 31, 36). C-mer is primarily expressed in monocytes/macrophages and certain epithelial cell types, with the highest C-mer mRNA levels detected in kidney, testis, ovary, prostate, lung, and peripheral blood monocytes (18, 19). Although C-mer is not expressed in normal B cells and T cells, C-mer expression is also detected in certain neoplastic T-cell and B-cell lines (18) and is ectopically expressed in the majority of childhood acute lymphocytic leukemias (D. K. Graham et al., unpublished data).
C-mer mutations are found in three kindreds with familial retinitis pigmentosa, a disease leading to blindness in which specialized phagocytic retinal pigment epithelial cells are unable to ingest the shed apoptotic tips of photoreceptor cells (10, 16, 48). The C-mer-knockout mouse also develops a lupus-like autoimmune disorder due to the inability of monocytes to clear apoptotic cellular debris, resulting in the development of autoantibodies (6). The C-mer ligand, Gas6, the gene for which was originally identified as a cellular gene induced by growth arrest, is expressed constitutively by a variety of cell types (4, 12, 32, 36). Activation of C-mer results in increased phosphatidylinositol-3 kinase, extracellular signal-related kinase, and p38 kinase activity, and in some conditions it enhances NF-
B activity (17, 22). C-mer may also coordinate cytoskeletal changes through its effects on Vav1, Rac1, Cd42, and RhoA (31). Furthermore, activation of the C-mer pathway is sufficient to rescue certain interleukin-3 (IL-3)-dependent cell lines from the apoptosis normally induced by IL-3 withdrawal (17, 22).
Here we report that R activates expression of the cellular C-mer gene in a variety of cell lines in vitro. Furthermore, whereas C-mer expression was detected in lymphoblastoid cells immortalized with wild-type EBV, no C-mer expression was detected in lymphoblastoid cells immortalized with a virus having BRLF1 deleted. C-mer was also overexpressed in OHL lesions. Thus, R activates C-mer expression in host cells during the lytic form of EBV infection. However, modulation of the C-mer signal transduction cascade by a variety of different approaches did not alter the ability of R to induce lytic EBV gene transcription. Therefore, the functional significance of C-mer activation during the lytic form of EBV infection remains unknown, but it could possibly enhance the ability of infected cells to digest apoptotic debris or resist apoptosis.

MATERIALS AND METHODS
Cell lines and viruses.
HeLa is a cervical carcinoma cell line. Telomerase-immortalized
human keratinocytes (TIK) were a gift from A. J. Klingelhutz
at the University of Iowa and originally derived from human
neonatal foreskin as previously described (
35). TIK were maintained
in keratinocyte-SFM medium (Gibco-BRL) with epidermal growth
factor (EGF) and bovine pituitary extract added. RPE is a retinal
pigment epithelial cell line. D98/HE-R-1 is an epithelial cell
line formed by fusion of a HeLa cell subclone (D98) with the
EBV-positive Burkitt lymphoma cell line P3HR/1. Akata (EBV positive
or EBV negative) is a Burkitt lymphoma cell line (a gift from
K. Takada). 293 is a human embryonic epithelial kidney cell
line. EBV-positive versions of 293 cells, containing either
wild-type virus or virus with BRLF1 deleted (R-KO) virus, were
made as previously described (
11,
14) and were a gift from H.
J. Delecluse. Lymphoblastoid cell lines (LCLs) were derived
from the same donor by using wild-type EBV (LCL-WT) or EBV having
BRLF1 deleted (LCL-R-KO). For the production of stocks of virus
with BRLF1 deleted, 5
x 10
6 293 R-KO cells were plated in 10
ml of RPMI 1640-10% fetal bovine serum-penicillin-streptomycin
in a 100-mm-diameter dish on the day prior to transfection.
The cells were transfected with expression vectors for the lytic
EBV gene products BRLF1, BZLF1, BRRF1, and BALF4 with Lipofectamine
2000 according to the manufacturer's instructions. At 72 h posttransfection,
supernatants were filtered through 0.45-µm-pore-size filters
and viral stocks were stored at 4°C. For the generation
of LCL R-KO cells, 3
x 10
6 peripheral blood mononuclear cells
(provided by the laboratory of Susan Fiscus, University of North
Carolina at Chapel Hill) were resuspended in 3 ml of R-KO virus
and incubated overnight at 37°C. Seven milliliters of RPMI
1640-20% fetal bovine serum-penicillin-streptomycin was then
added, and cyclosporine (Sigma) was added to achieve a final
concentration of 500 ng/ml. Fifty percent of the medium was
changed every 7 days until transformation into LCLs was apparent
(at

3 to 4 weeks postinfection). All lymphoid cell lines were
maintained in RPMI 1640 medium supplemented with 10% fetal calf
serum. Epithelial cell lines were maintained in Dulbecco's modified
Eagle's medium supplemented with 10% fetal calf serum. All cell
lines were cultured at 37°C in a 5% CO
2 incubator.
Adenovirus vector construction and infection.
The EBV immediate-early gene BRLF1 or the control lacZ gene was inserted via cre-loxP-mediated recombination into an adenovirus type 5 derivative (under control of the immediate-early cytomegalovirus promoter) lacking the E1 and E3 genes to create adenovirus-BRLF1 (AdR) and adenovirus-LacZ (AdLacZ), as previously described (51). Virus stocks were grown in 293 cells and purified by double cesium chloride gradient followed by dialysis. TIK or HeLa, RPE, or 293 cells were plated in 150-mm-diameter plates 24 h prior to infection. Cells were infected with no adenovirus (mock infection), AdLacZ, or AdR at a multiplicity of infection (MOI) of 20. Cells were harvested 24 h postinfection for RNA preparation or whole-cell protein preparation. Some cells were treated with human recombinant Gas6 (150 nM; a gift from Brian Varnum, Amgen Corp.) for 10 min before harvest.
Plasmids.
The BRLF1 expression vector (SG5-R) contains the BRLF1 genomic sequence inserted in the pSG5 expression vector (Stratagene) under the control of the simian virus 40 promoter (a gift from Diane Hayward) (41). The EGFR/Mer chimera (C-mer) was constructed by combining the extracellular and transmembrane regions of the EGF receptor (EGFR) with the intracellular domain of C-mer inserted into the pLXSN vector (34) as previously described (22). Kinase-inactive C-mer (Mer-KD) was made by site-directed mutation of lysine 619 of the C-mer kinase domain to methionine (22).
Transfection.
HeLa and 293 cells were transfected with 10 µg of SG5-R or control SG5 plasmid DNA with the use of Lipofectamine 2000 (Invitrogen) according to the manufacturer's specifications. RNA was prepared 24 h posttransfection. Some 293 cells were treated with Gas6 24 h posttransfection, and whole-cell extracts were prepared 48 h posttransfection. EBV-positive D98/HE-R-1 cells were transfected with SG5 or SG5-R, in combination with C-mer or Mer-KD plasmid, by electroporation with 1,500 V from a Zapper electroporation unit (Medical Electronics Shop, University of Wisconsin). EGF (100 ng/ml) was added 24 h posttransfection, and whole-cell extracts were prepared 48 h posttransfection.
Northern blot analysis.
Ten micrograms of total RNA, purified using the Trizol reagent (Invitrogen) as specified by the manufacturer, was separated on a 1% agarose-formaldehyde gel and transferred to nylon membranes (Schleicher and Schuell). Membranes were prehybridized for 25 min at 68°C in QuikHyb hybridization buffer (Stratagene) and then hybridized with 32P-randomly radiolabeled C-mer probes for 1 h at 68°C. After hybridization, membranes were washed twice in 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate at room temperature, and a final wash was carried out in 0.2x SSC-0.1% sodium dodecyl sulfate for 5 to 10 min at 60°C. The C-mer probes were generated by reverse transcriptase-PCR (RT-PCR) of 1 µg of total cellular RNA with the primers C-mer sense (5'-TCCGTAACAGCACTGCACAC-3') and C-mer antisense (5'-GTGACGGCTGCAATCCTCAC-3') followed by random labeling of the PCR product. A randomly labeled (Oligolabeling kit; Amersham) mouse glyceraldehyde phosphate dehydrogenase (GAPDH) probe (Ambion) was used as a control.
RT-PCR.
Total RNA was isolated from LCL (WT or R-KO) or Akata cells (EBV negative or EBV positive) treated with or without anti-human immunoglobulin G (IgG; Sigma; 0.1 mg/ml) for 24 h. RT-PCR was performed using a kit according to the instructions of the manufacturer (Promega). The same C-mer primers used to generate probes for Northern analysis above were used to synthesize the PCR products. PCR was run for 35 to 40 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s. Primers for ß2-microglobin were 5' TTCTGGCCTGGAGGGCATCC (forward) and 5' ATCTTCAAACCTCCATGATG (reverse).
Immunoblot analysis.
Immunoblot analysis of total cell extracts was performed as previously described (29) with the following antibodies: anti-EBV BRLF1 (Argene; 1:100) and anti-EBV-BMRF1 (Capricorn Products, Inc.; 1:100). For C-mer detection, whole-cell extracts were precipitated either with 1 µg of anti-C-mer polyclonal antibodies (31) or with wheat germ agglutinin-Sepharose (WGA-Sepharose; Sigma) beads overnight. The proteins were dissolved from beads, and an immunoblot analysis was performed to detect total C-mer (anti-C-mer antibody; 1:1,000) or phosphorylated C-mer (antiphosphotyrosine antibody; 1:400; BD Transduction Laboratories) expression.
Patients and tissues.
Biopsy specimens of OHL were obtained from human immunodeficiency virus-seropositive patients identified at the University of North Carolina Hospitals. Biopsy specimens of tissue from the lateral tongue border of human immunodeficiency virus-negative healthy subjects without leukoplakia were used as controls. Specimens were immediately frozen and stored at 80°C. A portion of each biopsy specimen was fixed in formalin and sent to UNC Hospitals Department of Pathology for histopathologic diagnosis. The presence of EBV within the OHL biopsy specimens was confirmed by detection of the terminal restriction enzyme fragments on Southern blots (49).
Immunofluorescence.
Frozen tissue sections were cut to 5-µm thickness and placed on poly-L-lysine-coated slides. Tissue sections and cell lines were fixed in a chilled 1:1 mixture of methanol and acetone; blocked with 20% normal goat serum; stained with a primary antibody for FAS (BD Biosciences; 1:20), Z (Argene; 1:40), or R (Argene; 1:20) or with an isotype control antibody; and then stained with fluorescein isothiocyanate-conjugated goat anti-mouse IgG (50). Slides were mounted with coverslips by using Vectashield (Vector Laboratories) and then subjected to confocal microscopy.
Affymetrix GeneChip analysis.
Telomerase-immortalized human keratinocytes were plated at a cell density of 2 x 107 cells per 150-mm-diameter dish and then either mock infected or infected with adenovirus expressing LacZ or R at an MOI of 17. The cells were harvested 48 h later, and total RNA was obtained using the RNeasy kit (Qiagen). Microarray analysis was performed with Affymetrix GeneChip as previously described (29).

RESULTS
R activates C-mer expression.
In preliminary experiments, human TIK were mock infected or
infected with adenovirus vectors expressing R (AdR) or LacZ
(AdLacZ) constructed as previously described (
51). RNA was harvested
24 h after infection and analyzed by microarray analysis as
previously described (
29). The results indicated that cells
infected with the AdR vector had sevenfold-higher expression
of C-mer than did cells which were mock infected or infected
with the AdLacZ vector (data not shown). To confirm that R induces
C-mer expression, Northern blot analysis was performed to quantitate
the level of C-mer message in a series of cell lines (HeLa cells,
TIK, RPE cells, and 293 cells) that were infected with the control
AdLacZ vector or the AdR vector (MOI of 20). RNA was isolated
24 h postinfection and analyzed by Northern blotting with probes
specific for c-Mer or the housekeeping gene GAPDH. Compared
to AdLacZ-infected cells, cells infected with AdR had significantly
more C-mer mRNA in all cell lines tested (Fig.
1). These results
indicate that infection of cells with the AdR vector results
in enhanced C-mer mRNA expression.
To determine if R activates C-mer expression in the absence
of any adenovirus gene products, HeLa and 293 cells were transfected
with an R expression vector (SG5-R) or the SG5 control vector
(Stratagene). RNA was harvested 24 h after transfection, and
Northern blot assays were performed. In both HeLa and 293 cells,
the transfected R vector increased the level of C-mer RNA compared
to the control vector (Fig.
2). Thus, R activates C-mer expression
in the absence of adenovirus help.
C-mer mRNA is activated by lytic EBV infection in Burkitt lymphoma cells and LCLs.
To determine if lytic EBV infection results in increased C-mer
expression in B cells, EBV-positive Burkitt lymphoma cells (Akata)
were switched from the latent to lytic form of infection by
cross-linking the B-cell surface receptor with anti-IgG (0.1
mg/ml; Sigma) as previously described (
45). Total RNA was isolated
24 h postinduction, and RT-PCR was performed to detect C-mer
or ß
2-microglobin gene expression. As shown in Fig.
3, in the absence of B-cell receptor activation, no C-mer expression
was detected in Akata cells. Following anti-IgG treatment, C-mer
RNA expression was dramatically increased, while that of a housekeeping
gene, ß
2-microglobin, was not affected. Anti-IgG treatment
did not induce C-mer expression in EBV-negative Akata cells.
The level of C-mer expression was also compared in LCLs (from
the same donor) derived with wild-type virus and virus having
BRLF1 deleted (R-KO; a gift from H.-J. Delecluse) (
14). C-mer
expression was detected in LCLs derived with wild-type EBV but
not in the LCLs derived from the virus having BRLF1 deleted
(Fig.
3). These results suggest that lytic EBV infection enhances
C-mer expression in at least some EBV-infected B-cell lines.
R activates C-mer protein expression.
To determine if R also activates C-mer protein expression, HeLa
cells were infected with the AdLacZ or AdR vectors (MOI of 20),
and whole-cell extracts were immunoprecipitated 24 h postinfection
with a C-mer polyclonal antibody (
31), followed by immunoblot
analysis with the same antibody. C-mer protein expression was
detected in HeLa cells infected with the AdR vector but not
the AdLacZ vector (Fig.
4, middle panel). A similar experiment
was performed in 293 cells. In this experiment, extracts were
incubated overnight in WGA-Sepharose (Sigma) beads to enrich
for the heavily glycosylated C-mer protein as previously described
(
15), glycoproteins were then dissociated from the beads, and
an immunoblot analysis was performed to detect C-mer. C-mer
protein expression was enhanced in 293 cells infected with the
AdR vector over that in cells infected with the control vector
(Fig.
4, right panel). Most importantly, C-mer protein expression
was observed in LCLs obtained with the wild-type virus but not
in LCLs obtained with the virus having BRLF1 deleted (Fig.
4,
left panel).
Gas6 phosphorylates the C-mer induced by R in HeLa cells.
To determine if the C-mer protein induced by R expression in
HeLa cells can be efficiently phosphorylated in the presence
of Gas6, HeLa cells were infected with the AdLacZ or AdR vector
(MOI of 20). Twenty-four hours postinfection, cells were treated
with 150 nM human recombinant Gas6 for various lengths of time
(0, 10, 30, 60, and 90 min) at 37°C. Cell extracts were
then immunoprecipitated with the C-mer polyclonal antibody,
followed by immunoblotting with antiphosphotyrosine antibody
to detect phosphorylated C-mer or with the C-mer antibody to
detect total C-mer. HeLa cell extracts infected with the AdLacZ
vector had no detectable C-mer protein and no detectable C-mer
phosphorylation in the presence of the Gas6 ligand (data not
shown). In contrast, Gas6 treatment of HeLa cells infected with
the AdR vector resulted in tyrosine phosphorylation of C-mer,
which peaked at 10 min and then decreased gradually over time
(Fig.
5). These results indicate that the C-mer protein induced
by R is capable of responding to the Gas6 ligand.
C-mer is overexpressed in epithelial cells of OHL lesions.
To determine the effect of lytic EBV infection in humans, C-mer
expression was examined in tongue tissue derived from patients
with OHL versus lateral tongue tissue derived from healthy individuals.
OHL is a lesion along the lateral aspect of the tongue that
contains lytic EBV infection (
20,
53). BZLF1 expression was
observed by immunohistochemistry in the condensed nuclei of
koilocyte cells in the middle to upper strata in biopsy specimens
of OHL lesions (data not shown), confirming that these cells
contained the lytic form of EBV infection. Punctate cytoplasmic
staining for C-mer was observed by immunofluorescence in the
OHL tissue in the middle to upper strata within the stratum
spinosum and stratum granulosum layer but was present at a much
lower level in the control tongue tissue (Fig.
6). No C-mer
expression was detected in OHL or healthy tongue stained with
the secondary antibody only. These results indicate that C-mer
expression is induced during lytic EBV infection in tongue epithelial
cells.
Modulation of C-mer activity does not affect R-mediated lytic EBV induction.
To determine whether C-mer activation plays a role in R-mediated
lytic EBV gene expression, latently infected, EBV-positive D98/HE-R-1
cells were transfected with the control vector (SG5) or the
R-expression vector (SG5-R), in the presence or absence of vectors
encoding chimeric C-mer receptors, with either wild-type (C-mer)
or kinase-dead (Mer-KD) C-mer (
22). Both vectors contain the
extracellular and transmembrane domains of the EGFR linked to
the C-mer cytoplasmic domain: while one vector has an active
C-mer tyrosine kinase, in the other vector lysine 619 of the
kinase domain is mutated to methionine. The latter does not
send a signal in the presence of the EGF ligand (
22,
31). Transfected
cells were treated with or without EGF (100 ng/ml) 24 h posttransfection.
Cells were harvested 48 h posttransfection, and immunoblot analysis
was performed to detect expression of the R protein, as well
as the early lytic EBV protein BMRF1. As shown in Fig.
7, cells
transfected with the R expression vector alone expressed the
early protein BMRF1, as expected. Neither the wild-type nor
the kinase-dead C-mer-EGFR chimera altered BMRF1 expression
in the presence or absence of the EGF ligand (Fig.
7).
Recombinant Gas6 does not enhance R-mediated viral gene expression.
To further confirm that C-mer activation is not directly involved
in the transcriptional effects of R, EBV-positive 293 cells
were transfected with the control vector (SG5) or the R expression
vector (SG5-R) in the presence or absence of recombinant Gas6
ligand (150 nM, added 24 h posttransfection). Cells were harvested
48 h posttransfection, and an immunoblot analysis was performed
to detect R and BMRF1 expression (Fig.
8). The presence of the
C-mer ligand, Gas6, did not significantly affect the ability
of transfected R to induce early lytic EBV gene expression.

DISCUSSION
In this report, we demonstrate that the EBV immediate-early
protein BRLF1 activates C-mer expression in a variety of cell
lines in vitro. In addition, we show that C-mer expression is
increased by induction of lytic EBV infection in the Burkitt
lymphoma line Akata and that C-mer is expressed in lymphoblastoid
cells obtained with wild-type EBV but not in lymphoblastoid
cells obtained with the virus in which BRLF1 was deleted. C-mer
is also expressed at a high level in OHL lesions. Thus, C-mer
activation may be a common phenomenon during the lytic form
of EBV replication. At this point, however, whether this C-mer
activation plays an important role in EBV pathogenesis remains
unknown.
C-mer is a member of the Mer/Axl/Tyro3 receptor tyrosine kinase family. C-mer is normally expressed in monocytes and certain types of epithelial cells (18) and plays a role in phagocytosis of apoptotic debris (23, 43). Loss of C-mer function in humans results in a form of progressive blindness, retinitis pigmentosa, due to the failure of retinal pigment epithelial cells to ingest the shed apoptotic outer segments of photoreceptor cells, and in the rat and mouse, absence of C-mer leads to retinal degeneration (10, 16, 48). In addition, C-mer functions include the regulation of cytoskeletal elements and the sending of an antiapoptotic signal not accompanied by cellular proliferation (6, 43).
Our results suggest that lytic EBV infection increases the level of C-mer in host cells that do not otherwise express significant amounts of C-mer. While we did not detect significant C-mer expression in uninfected lateral tongue epithelial cells, C-mer was highly expressed in OHL lesions that are lytically infected with EBV. An LCL immortalized with wild-type EBV had C-mer expression, whereas an LCL derived with the virus in which BRLF1 was deleted (from the same host) did not express detectable C-mer. In addition, whereas latently infected EBV-positive Akata Burkitt lymphoma cells did not express detectable C-mer, when these cells were switched to the lytic form of EBV infection, C-mer expression was detected. Furthermore, R expression in HeLa cells (which do not express C-mer in the absence of R) resulted in C-mer tyrosine phosphorylation in the presence of the C-mer ligand Gas6.
Together, these results indicate that host cells containing the lytic form of EBV infection may have a greatly enhanced response to the Gas6 ligand. The Gas6 ligand, although originally described as a growth arrest gene, is expressed constitutively by a number of cell types (4, 12, 32, 36). However, exactly how this induction of the C-mer pathway during lytic EBV infection contributes to viral pathogenesis remains unknown. We explored the hypothesis that the C-mer signal transduction pathway contributes to R transcriptional effects but were unable to show by a variety of different approaches that this pathway alters R-mediated lytic EBV gene transcription.
Another potential role of C-mer activation during lytic EBV infection would be inhibition of cellular apoptosis. Activation of the C-mer pathway has been shown to inhibit cellular apoptosis mediated by withdrawal of IL-3 (17, 22), and thus C-mer activation could potentially inhibit apoptosis in response to viral infection, as well. Many viruses encode proteins that inhibit cellular apoptosis, thereby allowing the virus time to replicate its genome prior to the death of the host cell. EBV encodes an early gene product, BHRF1, which is a homologue of Bcl-2 and inhibits apoptosis (2, 26). The combination of C-mer activation and BHRF1 expression may be more efficient than either effect alone in protecting the virus from apoptosis during lytic EBV replication.
Finally, it is also possible that C-mer activation by R allows the virally infected cell to ingest apoptotic debris. Ingestion of apoptotic cellular debris might enhance the availability of limiting substrates required for efficient lytic viral replication. Whether C-mer activation could enhance the phagocytosis capacity of the primary target cells for EBV, B cells, and epithelial cells is not clear. However, there is increasing evidence that EBV also lytically infects monocytes and macrophages (42), in which C-mer activation could potentially dysregulate phagocytosis and possibly contribute to the EBV-associated hemophagocytic clinical syndrome (44).
In addition to the other phenotypic effects, C-mer-knockout mice produce much more tumor necrosis factor alpha (TNF-
) in response to lipopolysaccharide challenge than do wild-type mice (3), suggesting that C-mer has a role in down-regulating production of TNF-
. As TNF-
is a potent antiviral cytokine, as well as an activator of the host immune response (33, 52), inhibition of TNF-
production during lytic EBV infection would be expected to benefit the virus. The other EBV immediate-early gene protein, BZLF1, was recently shown by our laboratory to down-regulate expression of the major tumor necrosis factor receptor in host cells (35). Activation of C-mer by R, in combination with the Z effect, could allow EBV to evade TNF-
during lytic reactivation or primary infection.

ACKNOWLEDGMENTS
This work was supported by grants 2-R01-CA58853 and P01-CA19014
from the National Institutes of Health.
We thank S. Diane Hayward for plasmids, Brian Varnum for Gas6, H.-J. Delecluse for the EBV with BRLF1 deleted, and the UNC Gene Therapy Core for preparing the adenovirus vectors.

FOOTNOTES
* Corresponding author. Mailing address: UNC Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, CB# 7295, NC 27599-7295. Phone: (919) 966-1248. Fax: (919) 966-8212. E-mail:
shann{at}med.unc.edu.


REFERENCES
1 - Adamson, A. L., D. Darr, E. Holley-Guthrie, R. A. Johnson, A. Mauser, J. Swenson, and S. Kenney. 2000. Epstein-Barr virus immediate-early proteins BZLF1 and BRLF1 activate the ATF2 transcription factor by increasing the levels of phosphorylated p38 and c-Jun N-terminal kinases. J. Virol. 74:1224-1233.[Abstract/Free Full Text]
2 - Bellows, D. S., B. N. Chau, P. Lee, Y. Lazebnik, W. H. Burns, and J. M. Hardwick. 2000. Antiapoptotic herpesvirus Bcl-2 homologs escape caspase-mediated conversion to proapoptotic proteins. J. Virol. 74:5024-5031.[Abstract/Free Full Text]
3 - Camenisch, T. D., B. H. Koller, H. S. Earp, and G. K. Matsushima. 1999. A novel receptor tyrosine kinase, Mer, inhibits TNF-alpha production and lipopolysaccharide-induced endotoxic shock. J. Immunol. 162:3498-3503.[Abstract/Free Full Text]
4 - Chen, J., K. Carey, and P. J. Godowski. 1997. Identification of Gas6 as a ligand for Mer, a neural cell adhesion molecule related receptor tyrosine kinase implicated in cellular transformation. Oncogene. 14:2033-2039.[CrossRef][Medline]
5 - Chevallier-Greco, A., E. Manet, P. Chavrier, C. Mosnier, J. Daillie, and A. Sergeant. 1986. Both Epstein-Barr virus (EBV)-encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO J. 5:3243-3249.[Medline]
6 - Cohen, P. L., R. Caricchio, V. Abraham, T. D. Camenisch, J. C. Jennette, R. A. Roubey, H. S. Earp, G. Matsushima, and E. A. Reap. 2002. Delayed apoptotic cell clearance and lupus-like autoimmunity in mice lacking the c-mer membrane tyrosine kinase. J. Exp. Med. 196:135-140.[Abstract/Free Full Text]
7 - Countryman, J., and G. Miller. 1985. Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proc. Natl. Acad. Sci. USA 82:4085-4089.[Abstract/Free Full Text]
8 - Cox, M. A., J. Leahy, and J. M. Hardwick. 1990. An enhancer within the divergent promoter of Epstein-Barr virus responds synergistically to the R and Z transactivators. J. Virol. 64:313-321.[Abstract/Free Full Text]
9 - Darr, C. D., A. Mauser, and S. Kenney. 2001. Epstein-Barr virus immediate-early protein BRLF1 induces the lytic form of viral replication through a mechanism involving phosphatidylinositol-3 kinase activation. J. Virol. 75:6135-6142.[Abstract/Free Full Text]
10 - D'Cruz, P. M., D. Yasumura, J. Weir, M. T. Matthes, H. Abderrahim, M. M. LaVail, and D. Vollrath. 2000. Mutation of the receptor tyrosine kinase gene Mertk in the retinal dystrophic RCS rat. Hum. Mol. Genet. 9:645-651.[Abstract/Free Full Text]
11 - Delecluse, H. J., T. Hilsendegen, D. Pich, R. Zeidler, and W. Hammerschmidt. 1998. Propagation and recovery of intact, infectious Epstein-Barr virus from prokaryotic to human cells. Proc. Natl. Acad. Sci. USA 95:8245-8250.[Abstract/Free Full Text]
12 - Dirks, W., D. Rome, F. Ringel, K. Jager, R. A. MacLeod, and H. G. Drexler. 1999. Expression of the growth arrest-specific gene 6 (GAS6) in leukemia and lymphoma cell lines. Leuk. Res. 23:643-651.[CrossRef][Medline]
13 - Farrell, P. J., D. T. Rowe, C. M. Rooney, and T. Kouzarides. 1989. Epstein-Barr virus BZLF1 trans-activator specifically binds to a consensus AP-1 site and is related to c-fos. EMBO J. 8:127-132.[Medline]
14 - Feederle, R., M. Kost, M. Baumann, A. Janz, E. Drouet, W. Hammerschmidt, and H. J. Delecluse. 2000. The Epstein-Barr virus lytic program is controlled by the co-operative functions of two transactivators. EMBO J. 19:3080-3089.[CrossRef][Medline]
15 - Feng, W., D. Yasumura, M. T. Matthes, M. M. LaVail, and D. Vollrath. 2002. Mertk triggers uptake of photoreceptor outer segments during phagocytosis by cultured retinal pigment epithelial cells. J. Biol. Chem. 277:17016-17022.[Abstract/Free Full Text]
16 - Gal, A., Y. Li, D. A. Thompson, J. Weir, U. Orth, S. G. Jacobson, E. Apfelstedt-Sylla, and D. Vollrath. 2000. Mutations in MERTK, the human orthologue of the RCS rat retinal dystrophy gene, cause retinitis pigmentosa. Nat. Genet. 26:270-271.[CrossRef][Medline]
17 - Georgescu, M. M., K. H. Kirsch, T. Shishido, C. Zong, and H. Hanafusa. 1999. Biological effects of c-Mer receptor tyrosine kinase in hematopoietic cells depend on the Grb2 binding site in the receptor and activation of NF-
B. Mol. Cell. Biol. 19:1171-1181.[Abstract/Free Full Text]
18 - Graham, D. K., G. W. Bowman, T. L. Dawson, W. L. Stanford, H. S. Earp, and H. R. Snodgrass. 1994. Cloning and mRNA expression analysis of a novel human protooncogene, c-mer. Cell Growth Differ. 5:647-657.[Abstract]
19 - Graham, D. K., T. L. Dawson, D. L. Mullaney, H. R. Snodgrass, and H. S. Earp. 1995. Cloning and developmental expression analysis of the murine c-mer tyrosine kinase. Oncogene 10:2349-2359.[Medline]
20 - Greenspan, J. S., D. Greenspan, E. T. Lennette, D. I. Abrams, M. A. Conant, V. Petersen, and U. K. Freese. 1985. Replication of Epstein-Barr virus within the epithelial cells of oral "hairy" leukoplakia, an AIDS-associated lesion. N. Engl. J. Med. 313:1564-1571.[Abstract]
21 - Gruffat, H., E. Manet, A. Rigolet, and A. Sergeant. 1990. The enhancer factor R of Epstein-Barr virus (EBV) is a sequence-specific DNA binding protein. Nucleic Acids Res.18:6835-6843.[Abstract/Free Full Text]
22 - Guttridge, K. L., J. C. Luft, T. L. Dawson, E. Kozlowska, N. P. Mahajan, B. Varnum, and H. S. Earp. 2002. Mer receptor tyrosine kinase signaling: prevention of apoptosis and alteration of cytoskeletal architecture without stimulation or proliferation. J. Biol. Chem. 277:24057-24066.[Abstract/Free Full Text]
23 - Hall, M. O., A. L. Prieto, M. S. Obin, T. A. Abrams, B. L. Burgess, M. J. Heeb, and B. J. Agnew. 2001. Outer segment phagocytosis by cultured retinal pigment epithelial cells requires Gas6. Exp. Eye Res. 73:509-520.[CrossRef][Medline]
24 - Hardwick, J. M., P. M. Lieberman, and S. D. Hayward. 1988. A new Epstein-Barr virus transactivator, R, induces expression of a cytoplasmic early antigen. J. Virol. 62:2274-2284.[Abstract/Free Full Text]
25 - Hardwick, J. M., L. Tse, N. Applegren, J. Nicholas, and M. A. Veliuona. 1992. The Epstein-Barr virus R transactivator (Rta) contains a complex, potent activation domain with properties different from those of VP16. J. Virol. 66:5500-5508.[Abstract/Free Full Text]
26 - Henderson, S., D. Huen, M. Rowe, C. Dawson, G. Johnson, and A. Rickinson. 1993. Epstein-Barr virus-coded BHRF1 protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death. Proc. Natl. Acad. Sci. USA 90:8479-8483.[Abstract/Free Full Text]
27 - Kenney, S., E. Holley-Guthrie, E. C. Mar, and M. Smith. 1989. The Epstein-Barr virus BMLF1 promoter contains an enhancer element that is responsive to the BZLF1 and BRLF1 transactivators. J. Virol. 63:3878-3883.[Abstract/Free Full Text]
28 - Kieff, E., and A. B. Rickinson. 2001. Epstein-Barr virus and its replication, p. 2511-2573. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa.
29 - Li, Y., J. Webster-Cyriaque, C. C. Tomlinson, M. Yohe, and S. Kenney. 2004. Fatty acid synthase expression is induced by the Epstein-Barr virus immediate-early protein, BRLF1, and is required for lytic viral gene expression. J. Virol. 78:4197-4206.[Abstract/Free Full Text]
30 - Lieberman, P. M., J. M. Hardwick, and S. D. Hayward. 1989. Responsiveness of the Epstein-Barr virus NotI repeat promoter to the Z transactivator is mediated in a cell-type-specific manner by two independent signal regions. J. Virol. 63:3040-3050.[Abstract/Free Full Text]
31 - Mahajan, N. P., and H. S. Earp. 2003. An SH2 domain-dependent, phosphotyrosine-independent interaction between Vav1 and the Mer receptor tyrosine kinase: a mechanism for localizing guanine nucleotide-exchange factor action. J. Biol. Chem. 278:42596-42603.[Abstract/Free Full Text]
32 - Manfioletti, G., C. Brancolini, G. Avanzi, and C. Schneider. 1993. The protein encoded by a growth arrest-specific gene (gas6) is a new member of the vitamin K-dependent proteins related to protein S, a negative coregulator in the blood coagulation cascade. Mol. Cell. Biol. 13:4976-4985.[Abstract/Free Full Text]
33 - Mestan, J., W. Digel, S. Mittnacht, H. Hillen, D. Blohm, A. Moller, H. Jacobsen, and H. Kirchner. 1986. Antiviral effects of recombinant tumor necrosis factor in vitro. Nature 323:816-819.[CrossRef][Medline]
34 - Miller, A. D., and G. J. Rosman. 1989. Improved retroviral vectors for gene transfer and expression. BioTechniques 7:980-982.[Medline]
35 - Morrison, T. E., A. Mauser, A. Klingelhutz, and S. C. Kenney. 2004. Epstein-Barr virus immediate-early protein BZLF1 inhibits tumor necrosis factor alpha-induced signaling and apoptosis by downregulating tumor necrosis factor receptor 1. J. Virol. 78:544-549.[Abstract/Free Full Text]
36 - Nagata, K., K. Ohashi, T. Nakano, H. Arita, C. Zong, H. Hanafusa, and K. Mizuno. 1996. Identification of the product of growth arrest-specific gene 6 as a common ligand for Axl, Sky, and Mer receptor tyrosine kinases. J. Biol. Chem. 271:30022-30027.[Abstract/Free Full Text]
37 - Quinlivan, E. B., E. Holley-Guthrie, M. Norris, D. Gutsch, S. L. Bachenheimer, and S. C. Kenney. 1993. Direct BRLF1 binding is required for cooperative BZLF1/BRLF1 activation of the Epstein-Barr virus early promoter, BMRF1. Nucleic Acids Res. 21:1999-2007.
38 - Ragoczy, T., L. Heston, and G. Miller. 1998. The Epstein-Barr virus Rta protein activates lytic cycle genes and can disrupt latency in B lymphocytes. J. Virol. 72:7978-7984.[Abstract/Free Full Text]
39 - Rickinson, A. B., and E. Kieff. 2001. Epstein-Barr virus, p. 2575-2627. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa.
40 - Rooney, C., N. Taylor, J. Countryman, H. Jenson, J. Kolman, and G. Miller. 1988. Genome rearrangements activate the Epstein-Barr virus gene whose product disrupts latency. Proc. Natl. Acad. Sci. USA 85:9801-9805.[Abstract/Free Full Text]
41 - Sarisky, R. T., Z. Gao, P. M. Lieberman, E. D. Fixman, G. S. Hayward, and S. D. Hayward. 1996. A replication function associated with the activation domain of the Epstein-Barr virus Zta transactivator. J. Virol. 70:8340-8347.[Abstract]
42 - Savard, M., C. Belanger, M. Tardif, P. Gourde, L. Flamand, and J. Gosselin. 2000. Infection of primary human monocytes by Epstein-Barr virus. J. Virol. 74:2612-2619.[Abstract/Free Full Text]
43 - Scott, R. S., E. J. McMahon, S. M. Pop, E. A. Reap, R. Caricchio, P. L. Cohen, H. S. Earp, and G. K. Matsushima. 2001. Phagocytosis and clearance of apoptotic cells is mediated by MER. Nature 411:207-211.[CrossRef][Medline]
44 - Su, I. J., C. H. Wang, A. L. Cheng, and R. L. Chen. 1995. Hemophagocytic syndrome in Epstein-Barr virus-associated T-lymphoproliferative disorders: disease spectrum, pathogenesis, and management. Leuk. Lymphoma 19:401-406.[Medline]
45 - Takada, K. 1984. Cross-linking of cell surface immunoglobulins induces Epstein-Barr virus in Burkitt lymphoma lines. Int. J. Cancer 33:27-32.[Medline]
46 - Takada, K., N. Shimizu, S. Sakuma, and Y. Ono. 1986. trans activation of the latent Epstein-Barr virus (EBV) genome after transfection of the EBV DNA fragment. J. Virol. 57:1016-1022.[Abstract/Free Full Text]
47 - Urier, G., M. Buisson, P. Chambard, and A. Sergeant. 1989. The Epstein-Barr virus early protein EB1 activates transcription from different responsive elements including AP-1 binding sites. EMBO J. 8:1447-1453.[Medline]
48 - Vollrath, D., W. Feng, J. L. Duncan, D. Yasumura, P. M. D'Cruz, A. Chappelow, M. T. Matthes, M. A. Kay, and M. M. LaVail. 2001. Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk. Proc. Natl. Acad. Sci. USA 98:12584-12589.[Abstract/Free Full Text]
49 - Webster-Cyriaque, J., and N. Raab-Traub. 1998. Transcription of Epstein-Barr virus latent cycle genes in oral hairy leukoplakia. Virology 248:53-65.[CrossRef][Medline]
50 - Webster-Cyriaque, J., J. Middeldorp, and N. Raab-Traub. 2000. Hairy leukoplakia: an unusual combination of transforming and permissive Epstein-Barr virus infections. J. Virol. 74:7610-7618.[Abstract/Free Full Text]
51 - Westphal, E. M., A. Mauser, J. Swenson, M. G. Davis, C. L. Talarico, and S. C. Kenney. 1999. Induction of lytic Epstein-Barr virus (EBV) infection in EBV-associated malignancies using adenovirus vectors in vitro and in vivo. Cancer Res. 59:1485-1491.[Abstract/Free Full Text]
52 - Wong, G. H. W., and D. V. Goeddel. 1986. Tumor necrosis factors alpha and beta inhibit virus replication and synergize with interferons. Nature 323:819-822.[CrossRef][Medline]
53 - Young, L. S., R. Lau, M. Rowe, G. Niedobitek, G. Packham, F. Shanahan, D. T. Rowe, D. Greenspan, J. S. Greenspan, and A. B. Rickinson. 1991. Differentiation-associated expression of the Epstein-Barr virus BZLF1 transactivator protein in oral hairy leukoplakia. J. Virol. 65:2868-2874.[Abstract/Free Full Text]
54 - Zalani, S., E. Holley-Guthrie, and S. Kenney. 1996. Epstein-Barr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism. Proc. Natl. Acad. Sci. USA 93:9194-9199.[Abstract/Free Full Text]
Journal of Virology, November 2004, p. 11778-11785, Vol. 78, No. 21
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.21.11778-11785.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Lin, J.-H., Tsai, C.-H., Chu, J.-S., Chen, J.-Y., Takada, K., Shew, J.-Y.
(2007). Dysregulation of HER2/HER3 Signaling Axis in Epstein-Barr Virus-Infected Breast Carcinoma Cells. J. Virol.
81: 5705-5713
[Abstract]
[Full Text]
-
Hong, G. K., Kumar, P., Wang, L., Damania, B., Gulley, M. L., Delecluse, H.-J., Polverini, P. J., Kenney, S. C.
(2005). Epstein-Barr Virus Lytic Infection Is Required for Efficient Production of the Angiogenesis Factor Vascular Endothelial Growth Factor in Lymphoblastoid Cell Lines. J. Virol.
79: 13984-13992
[Abstract]
[Full Text]
-
Hong, G. K., Gulley, M. L., Feng, W.-H., Delecluse, H.-J., Holley-Guthrie, E., Kenney, S. C.
(2005). Epstein-Barr Virus Lytic Infection Contributes to Lymphoproliferative Disease in a SCID Mouse Model. J. Virol.
79: 13993-14003
[Abstract]
[Full Text]