Previous Article | Next Article ![]()
Journal of Virology, January 2004, p. 768-778, Vol. 78, No. 2
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.2.768-778.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
N. H. Gudgeon, R. J. Phelps, S. P. Lee, N. M. Steven, and A. B. Rickinson*
CRUK Institute for Cancer Studies and MRC Centre for Immune Regulation, University of Birmingham, Birmingham B15 2TT, United Kingdom
Received 4 August 2003/ Accepted 30 September 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
One such tumor, nasopharyngeal carcinoma, is seen worldwide but is particularly common in southeast Asia, where in certain areas the incidence can reach 50 cases per 100,000 population per year (35). Viral antigen expression in nasopharyngeal carcinoma cells (18) is limited to the nuclear antigen EBNA1, a sequence-specific DNA binding protein involved in EBV episomal genome maintenance and gene transactivation (52), and the latent membrane proteins LMP1, a major effector of virus-induced cellular change (30) but only detectable in 30 to 50% of tumors, and LMP2, a protein with signaling properties dependent upon its interaction with cellular tyrosine kinases (25). Of these three viral proteins, EBNA1 cannot be exploited as a target for CD8+ T cells because the endogenously expressed EBNA1 protein is protected from proteasomal degradation by the presence of a large glycine-alanine repeat (GAr) domain (2, 23). Furthermore, LMP1 is poorly immunogenic for the CD8+ system, whereas LMP2 is a source of subdominant epitopes eliciting weak but nevertheless detectable responses restricted through several HLA class I alleles, including some, such as A11.01, A24.02, and B40.01, that are common in the Chinese population (21).
A first attempt at therapeutic vaccination of nasopharyngeal carcinoma patients with CD8 epitope peptides from LMP2 gave encouraging early results, but the epitope-specific responses seen were only maintained for a few months (24). This may reflect a need for accompanying CD4+ T-cell help because CD4+ T cells are increasingly thought to be important in maintaining an effective CD8+-T-cell response (16, 43, 46) and may also be able to act as effector cells in their own right (51). In that context EBNA1 is known to be immunodominant over LMP1 and LMP2 as a target for CD4+-T-cell responses as measured by gamma interferon (IFN-
) release in an Elispot assay (22), and indeed some EBNA1-specific CD4+-T-cell clones appear capable of recognizing HLA class II-positive target cells endogenously expressing the EBNA1 protein (31, 34). Immunotherapeutic targeting of nasopharyngeal carcinoma, a tumor that expresses both HLA class I and class II antigens, would therefore seek to recruit both CD4+ and CD8+ immunity.
The present paper describes work towards that end, focusing on a vaccine-based approach rather than on adoptive T-cell transfer. As a vaccine vector we chose modified vaccinia virus Ankara (MVA), a highly attenuated derivative of vaccinia virus with an excellent safety record (27, 45). When used in recombinant form to express foreign antigens in animal systems, MVA-based vaccines have been effective not just prophylactically against viral (12, 14, 48, 53) and parasitic (33, 41) infections, but also therapeutically against antigen-expressing tumors (3). As a vaccine antigen capable of targeting responses against nasopharyngeal carcinoma, we constructed an EBNA1-LMP2 fusion protein which, for reasons of safety, has been manipulated to destroy the gene-transactivating and signaling abilities of its individual component proteins but retains multiple CD4+ and CD8+ epitopes in its primary sequence.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The full-length LMP2 open reading frame was amplified from a previously cloned LMP2 cDNA (kindly provided by Y. S. Chang, Chang-Gung University, Taiwan), again of type 1 Chinese EBV strain origin, with primers L2For (5'-GAGGAAGGGCAGGAGATGGGGTCCCTAGAAATGG) and L2Rev (5'GAATGCATGCGGCCGCTATACAGTGTTGCGATATGG). The L2For sequence contains at its 5' end 15 nucleotides complementary to nucleotides 4 to 18 of the E1Rev primer. The italicized (non-EBV) sequence within L2Rev includes an additional NotI restriction enzyme site (underlined) overlapping the complementary sequence of the native TAG stop codon of LMP2 (bold).
The PCR amplicons from both separate first-round amplifications were purified, mixed together, and then reamplified with primers E1For and L2Rev, producing a fusion of EBNA1 and LMP2 (henceforth referred to as EL) without the introduction of any additional DNA sequence within the EBNA1-LMP2 coding region. The fusion was cloned into plasmid pUC18 via restriction enzyme sites for KpnI and NotI. Finally, two tyrosine codons within the LMP2 coding region of the EL fusion gene were mutated to phenylalanine codons by two successive rounds of inverse PCR with PFU Turbo polymerase (Stratagene). The first PCR used primers 74For (5'-TTTCAACCACTAGGAACCCAAG) and 74Rev (5'-GTCCGAGTGACGGTCGCCA) to mutate codon 74 (underlined). The second round of PCR used primers 112For (5'-TTTGAAGAAGCGGGCAGAGG) and 112Rev (5'-TATGTGTTGAGATGAGTCATCC) to mutate codon 112 (underlined).
Production of MVA recombinants. For expression from the MVA vector, the sequenced EL fusion gene was subcloned from the pUC18 vector into a modified version of the vaccinia virus shuttle vector pSC11 which contained KpnI and NotI restriction enzyme sites (kindly provided by Vincenzo Cerundolo, Institute of Molecular Medicine, University of Oxford). The MVA-EL recombinant was generated by homologous recombination in primary chicken embryo fibroblast (CEF) cells, first transfected with the EL shuttle vector and then infected with the parental MVA strain. MVA-EL was subsequently isolated by repeated rounds of plaque purification on CEF cells, with selection for ß-galactosidase expression. Plaque-purified virus was amplified in CEF cells and stocks were titered on BHK21 cells.
In parallel, we constructed an MVA recombinant, MVA-E1
GA, expressing a GAr-deleted form of the EBNA1 protein and another recombinant, MVA-LAMP-E1
GA, expressing the above protein targeted to the lysosomal compartment by the addition of an endoplasmic reticulum signal sequence and a lysosome-associated membrane protein (LAMP) target sequence (11). Additional control viruses MVA-pSC11 (empty vector) and MVA-LMP2 were provided by Neil Blake (University of Liverpool).
Protein expression from MVA recombinants. Expression of protein from the recombinant viruses was first confirmed by infecting HeLa cells for 1 h at a multiplicity of infection of 10. The cells were then washed and cultured for a further 18 h before harvesting. Cellular protein extracts were prepared and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with a Novex 4 to 12% Nupage bis-Tris gel (Invitrogen). Polypeptides were transferred to a nitrocellulose membrane and probed for expression with monoclonal antibodies (MAbs) 1H4-1 (10) and OT1x (4) for EBNA1 and MAb 14B7 (9) for LMP2. Blots were developed with enhanced chemiluminescence (Amersham).
For localization of MVA-expressed proteins, A431 cells growing on glass slides or matured dendritic cells (see later) in suspension were infected with MVA viruses for 1 h, then washed and incubated for a further 18 h. Cells were fixed with paraformaldehyde (in the case of dendritic cells after adherence to poly-L-lysine-coated glass coverslips), permeabilized with 0.1% Triton X-100, and stained with the appropriate rat MAbs 1H4-1 and 14B7 (9). Cells were costained with mouse MAbs to HLA-DR (L243, Immunotech), to early endosomal antigen EEA1 (TL-c14, Transduction Laboratories) and CD63 (6H1) (1) as endosomal markers, and to lysosome-associated membrane protein LAMP1 (TL-c25, Transduction Laboratories) as an endosome/lysosome marker. The labeled second step antibodies were anti-rat Alexa 488 and anti-mouse Alexa 594 (both from Molecular Probes).
Analysis of EBNA1/LMP2 function. For functional assays, the EL fusion gene was subcloned with KpnI and NotI restriction enzymes from the pSC11 shuttle vector into the eukaryotic expression plasmid pCDNA3. The plasmid pSG5-EBNA1 expressing wild-type EBNA1 and the pCDNA3 empty vector served as positive and negative controls, respectively, in the EBNA1 functional assays. Transfection efficiencies were normalized by including a control ß-galactosidase-expressing plasmid in all transfections. To measure EBNA1 transactivation activity, HeLa cells were transfected with Fugene (Roche Molecular Biosciences) with 10 µg of test plasmid, 1 µg of the reporter gene plasmid FR-TK-Luc (29), and 1 µg of the ß-galactosidase transfection efficiency control; after 48 h luciferase activity was measured with luciferin (Promega) and normalized to ß-galactosidase expression detected with Galacto-light substrate (Tropix) according to the manufacturer's recommended protocols.
To measure EBNA1 DNA binding activity, DG75 cells were transfected by electroporation with 10 µg of test plasmid, 2 µg of the qp-Luc reporter gene plasmid (40), and 2 µg of the ß-galactosidase transfection efficiency control; after 24 h luciferase and ß-galactosidase were measured as described above.
Functional LMP2 activity was determined by phosphorylation of the Akt cellular protein as a readout (42, 49). HeLa cells were transfected with 1 µg of pKB-HA, expressing a hemagglutinin (HA)-tagged version of the Akt molecule. Cells were also transfected with 1 µg of test plasmid, pCDNA3-EL, or control plasmid pCDNA3 (empty vector), pSG5-LMP2, pSG5-LMP2B, or p110CAAX. Cells were transfected for a total of 48 h and serum starved for the final 24 h of incubation. Cultures were lysed, and 200 µg of cell lysate was immunoprecipitated with anti-HA antibody as described (7). Phosphorylated Akt was detected by SDS-PAGE and immunoblotting with an Akt phosphoserine 473-specific antibody (Cell Signaling Technology).
Blood donors, cell preparations, and cell lines. Blood samples were obtained from healthy EBV-seropositive donors of Caucasian or Chinese origin and of known HLA type. For in vitro reactivation experiments, peripheral blood mononuclear cells (PBMCs) were separated by standard Ficoll-Hypaque centrifugation into standard culture medium RPMI 1640 (Invitrogen) supplemented with 2 mM glutamine, 100 IU of penicillin per ml, 100 µg of streptomycin per ml, and 5% autologous serum. Dendritic cells were prepared as described (22) by 6 days of culture of adherent PBMCs in granulocyte-macrophage colony-stimulating factor- and interleukin-4-supplemented medium, again with 5% autologous serum, and then matured for 24 h in 50 ng of tumor necrosis factor alpha/ml.
EBV (B95.8 strain)-transformed LCLs and EBV-negative B-cell blasts (CD40 ligand and interleukin-4 stimulated) were prepared by standard methods, and the transporter associated with antigen processing (TAP)-negative T2 and T2:B35 cell lines were as described (20). Primary chicken embryo fibroblast cells, produced from eggs obtained from a specific-pathogen-free colony (Institute for Animal Health, Compton, United Kingdom), and cell lines BHK-21, HeLa, and A431, obtained from the European Collection of Animal Cell Cultures, were maintained in Dulbecco's modified Eagle's medium supplemented with 2 mM glutamine, 100 IU of penicillin per ml, 100 µg of streptomycin per ml, and 10% fetal calf serum.
In vitro reactivation and cloning.
Matured dendritic cell preparations were infected with MVA EL virus for 1 h at a multiplicity of infection of 2. The following day, autologous PBMCs were mixed with dendritic cells at a 40:1 ratio and cocultured in a 2-ml well with medium containing 5% autologous serum. As a control, PBMCs were stimulated in parallel with
-irradiated (4,000 rads) autologous LCL cells at the same responder-stimulator cell ratio. Cells were restimulated on day 11 by addition of freshly prepared virus-infected dendritic cells or irradiated LCL as applicable.
In some experiments, cultures were harvested before restimulation on day 11 and immediately cloned by limiting dilution at 3 cells per well on
-irradiated autologous LCL (104 cells/well) and
-irradiated phytohemagglutinin (PHA) treated allogeneic PBMCs (105 cells/well) in interleukin-2-supplemented medium with fetal calf serum as described (21). Growing microcultures were transferred to 2-ml wells and further expanded by stimulation with
-irradiated autologous LCL and
-irradiated allogeneic PBMCs in interleukin-2-supplemented medium as before.
T-cell recognition assays. CD8+-T-cell recognition of MVA-expressed antigen was measured in standard 5-h chromium release assays with, as effector cells, epitope-specific CD8+-T-cell clones prepared by conventional LCL stimulation and selection as described (2, 21) and, as target cells, LCLs either infected overnight with MVA viruses at a multiplicity of infection of 10 or preexposed for 1 h to 5 µM epitope peptide or an equivalent concentration of dimethyl sulfoxide solvent as a control. CD8+-T-cell clones were against the following epitopes (identified by the first three letters of the peptide sequence): HLA A2-restricted epitopes LLW (LMP2 amino acids 329 to 337) and FLY (LMP2 amino acids 356 to 364), the HLA A11-restricted epitope SSC (LMP2 amino acids 340 to 350), the HLA A24-restricted epitope TYG (LMP2 amino acids 419 to 427), and the HLA B35.01-restricted epitope HPV (EBNA1 amino acids 407 to 417).
CD4+-T-cell recognition of MVA-expressed protein was measured by IFN-
enzyme-linked immunosorbent assay (Endogen) following the manufacturer's recommended protocol, with CD4+-T-cell clones prepared as described (22) or generated in the present work. Epitope peptides were synthesized with 9-fluorenylmethoxycarbonyl chemistry (Alta Bioscience, University of Birmingham), dissolved in dimethyl sulfoxide, and their concentrations were determined by biuret assay.
The induction both of CD4+ and CD8+ epitope-specific responses in in vitro reactivation experiments was detected by Elispot assay of IFN-
-producing cells with irradiated (4,000 rads) autologous PBMCs or autologous B-cell blasts pulsed with 5 µM peptide or dimethyl sulfoxide solvent as presenting cells. Different numbers of the polyclonal T-cell cultures were added and incubated overnight before development of the assay as described previously (22).
| RESULTS |
|---|
|
|
|---|
|
GA, expressing a GAr-deleted form of the EBNA1 protein, and MVA-LMP2, expressing full-length LMP2. For the EBNA1 blot, an equivalent loading of protein from an EBV (B95.8 strain)-transformed LCL is shown in the right-hand lane for comparison, whereas for the LMP2 blot, 10-fold more LCL cell protein was loaded to allow detection of the naturally expressed antigen. In MVA-EL-infected cells, a protein running at
90 kDa was detected both by the 1H4-1 MAb, specific for an epitope now localized to residues 439 to 442 in the EBNA1 C-terminal domain (F. Grasser, personal communication), and by the 14B7 MAb, specific for an epitope between residues 37 and 64 in the LMP2 N-terminal domain (9). This EL fusion protein is clearly larger than wild-type EBNA1 (running at 85 kDa), GAr-deleted EBNA1 (running at 52 kDa) and wild-type LMP2 (running at 54 kDa). Note also that the two MAbs each detected different smaller species in the MVA-EL track. Since PCR analysis of the MVA-EL virus stock never gave evidence of a truncated fusion gene (data not shown), these smaller species appear to be breakdown products of the EL fusion protein. There appears to be one major breakdown product containing the 1H4-1 MAb epitope whose size is consistent with a fragment containing most of the EBNA1 sequences from EL, while the 14B7 MAb detected a series of truncated proteins all larger than wild-type LMP2 but either lacking the 1H4-1 epitope or with the epitope occluded.
Functional inactivity of the EL fusion protein. We next performed a number of assays to see whether the EL fusion protein, in this case expressed by transient transfection from a plasmid vector, had retained the transactivating ability of wild-type EBNA1 or the signaling ability of wild-type LMP2. Figure 2A (left) shows the results of a cotransfection assay in HeLa cells with a reporter construct carrying multiple copies of an EBNA1 binding site (the family of repeats [FR] native to the EBV origin of plasmid replication, oriP) upstream of a luciferase gene (19). Cotransfection of this reporter with a wild-type EBNA1-expressing plasmid led to strong luciferase expression, whereas cotransfection with the EL-expressing plasmid gave no transactivation. Interestingly, however, a second type of cotransfection assay suggested that the EL fusion protein retained the capacity to bind DNA specifically. This assay utilizes a luciferase reporter downstream of the BamHI-Q promoter from the EBV genome, a promoter which wild-type EBNA1 normally represses by binding to the adjacent low-affinity consensus sites downstream of the transcription start (40). As shown in Fig. 2A (right), EL was almost as efficient as wild-type EBNA1 in repressing Qp-driven luciferase expression.
|
Presentation of MVA-expressed EL by the HLA class I pathway. We then examined the capacity of EL protein to be processed via the HLA class I pathway when expressed endogenously within target cells from the MVA vector. Figure 3 shows the results of cytotoxicity assays in which MVA-EL-infected LCL cells of the appropriate HLA class I type were used as targets for recognition by CD8+-T-cell clones specific for epitope sequences within the EL protein. Four representative CD8 epitopes were tested within the LMP2 sequence: the A2-restricted epitopes LLW (LMP2 amino acids 329 to 337) and FLY (LMP2 amino acids 356 to 364), the A11-restricted epitope SSC (amino acids 340 to 350), and the A24-restricted epitope TYG (LMP2 amino acids 419 to 427). Note that these epitopes are antigenically conserved between Caucasian EBV and Chinese EBV LMP2 genes (21), and so it was possible to assay their presentation with CD8+ T-cell clones from Caucasian donors.
|
GA were not recognized. Note that the EL protein also contains a CD8 epitope within the EBNA1 fragment, the B35.01-restricted epitope HPV (EBNA1 amino acids 407 to 417); although T-cell clones specific for this epitope do not recognize endogenously expressed wild-type EBNA1 because of its protection by the GAr domain, they are known to recognize cells expressing the GAr-deleted form of the protein (2). Here we found that B35.01-positive LCL targets infected with MVA-EL were also recognized by HPV-specific CD8+ T cells at least as efficiently or, in the particular assay shown in Fig. 3, more efficiently than MVA-E1
GA-infected targets.
For all epitopes tested, therefore, fusion of EBNA1 to LMP2 has not abrogated processing and presentation of the endogenously expressed fusion protein via the HLA class I pathway. Even certain unusual aspects of epitope processing from the wild-type LMP2 protein were maintained. Thus, some of the LMP2 epitopes, for example LLW/A2, are presented via a novel TAP-independent route when processed from their native antigen (20), whereas the HPV/B35 epitope is classically TAP-dependent when processed from EBNA1-
GA (2). Assays similar to those shown in Fig. 3 were therefore carried out with the TAP-deficient T2:B35 line as a target. In accord with the idea that TAP dependence or independence is an essential feature of the epitope sequence rather than of the source antigen (20), LLW/A2 was presented from MVA-expressed EL in these TAP-deficient cells, whereas HPV/B35 was not (data not shown).
Subsequent experiments asked whether epitope-specific CD8+ memory T cells in the PBMC pool of EBV-immune donors could be reactivated and expanded in vitro by exposure to MVA-EL-infected stimulators. As a source of stimulator cells we used autologous dendritic cell preparations, derived from monocytes by 6 days of culture in granulocyte-macrophage colony-stimulating factor and interleukin-4 and, in view of vaccinia virus' ability to block the dendritic cell maturation response (8), matured in tumor necrosis factor alpha prior to MVA-EL infection. In each case these were compared with unmanipulated autologous LCL cells that are known to be efficient in vitro stimulators of CD8+-T-cell memory for EBV latent cycle antigens (37). In vitro responses were measured with the Elispot assay of epitope peptide-induced IFN-
release because this is more sensitive than cytotoxicity and accurately quantitates the frequency of reactive cells within the culture (50).
Figure 4 shows representative results (expressed as the number of epitope-specific spot-forming cells per 106 total cells in the culture) from assays on day 11 and/or day 17 poststimulation. Donor 1 (HLA-A2 positive, Caucasian) clearly showed more efficient expansion of FLY/A2- and LLW/A2-specific memory cells following stimulation with MVA-EL than with LCL stimulation. Likewise, MVA-EL-infected dendritic cells expanded CD8+ memory T cells specific for the SSC/A11 epitope more efficiently than did LCL stimulators in two HLA-A11 individuals, donors 2 and 3 (Caucasian and Chinese, respectively). Such results, seen in several assays of this kind, are particularly significant because these LMP2 epitope reactivities are always subdominant components of EBV-specific memory, with initial levels of reactive cells (25 to 100 spot-forming cells per 106 PBMCs) being much lower than levels typically seen against immunodominant epitopes from the EBNA 3A, 3B, and 3C proteins (50).
|
Presentation of MVA-expressed EL by the HLA class II pathway. Since previous work has shown EBNA1 to be an important source of CD4+-T-cell epitopes in both Caucasian and Chinese individuals (21; X. R. Lin et al., unpublished data), we carried out a parallel series of experiments comparing the ability of MVA-EL-infected dendritic cells and the unmanipulated autologous LCLs to stimulate and expand EBNA1 epitope-specific CD4+ T cells from immune donors. The experimental design was essentially similar to that described for the previous set of experiments. Representative results for three EBNA1 CD4 epitopes, all lying within the EL fusion protein sequence, are shown in Fig. 5.
|
The efficiency of CD4+-T-cell reactivations by MVA-EL-infected stimulators led us to investigate the possibility that endogenously expressed EL protein was directly accessing the HLA class II presentation pathway. For this purpose, we established a number of EBNA1 epitope-specific CD4+-T-cell clones by limiting dilutions of responder cell populations from the above MVA-EL stimulation experiments. Figure 6A shows an example of one such clone, PQC c1, specific for the PQC epitope and derived from donor 4. This clone, which fluorescence-activated cell sorting staining confirmed as CD4+ CD8-, recognized the PQC peptide at concentrations down to 10-8 M in enzyme-linked immunosorbent assays quantitating IFN-
release. The clone was confirmed to be antigen specific since it also recognized LCL cells preexposed to an exogenous source of EBNA1 protein (in this case GAr deleted) but not to a control protein.
|
GA, and with MVA-LAMP-E1
GA, a virus expressing a form of E1
GA that has been targeted to the MHC class II pathway by fusion with a LAMP sequence. Importantly, all four EBNA1-specific clones showed significant recognition of MVA-EL-infected targets at levels ranging from 20 to 80% of those seen against target cells expressing the MHC class II pathway-directed LAMP-E1
GA protein. Moreover, as illustrated by the data from NPK c78, prior UV inactivation of the virus abolished this recognition of MVA-EL-infected targets, indicating that it was the endogenously expressed EL protein that was being processed for HLA class II presentation and not exogenous protein that could theoretically have been present in the input virus preparation. In the same assays, targets infected with the MVA-E1
GA virus were never recognized, despite the fact that levels of antigen expression were as high as for the MVA-EL virus (see, for example, Fig. 1B).
Intracellular localization of MVA-expressed EL.
These findings suggest that fusion to LMP2 had provided the EBNA1 sequence within EL with a direct route into the HLA class II processing pathway, a route which was apparently not accessible to the EBNA1 protein itself. In a final series of experiments we examined the intracellular localization of EL and, for comparison, of E1
GA, LAMP-E1
GA, and LMP2 expressed from MVA vectors in matured dendritic cells and visualized by MAb staining. As illustrated in Fig. 7A, EBNA1-specific MAb staining indicated that EL was concentrated in dense cytoplasmic patches on a background of weak general cytoplasmic fluorescence. This was quite distinct from the exclusively nuclear staining of E1
GA shown by the same MAb and from the weak nuclear plus fine punctate cytoplasmic staining of LAMP-E1
GA. Staining of EL-expressing cells by the LMP2-specific MAb again was concentrated in dense cytoplasmic patches; this was also distinct from the punctate, largely perinuclear staining of wild-type LMP2.
|
| DISCUSSION |
|---|
|
|
|---|
At the outset we were concerned to minimize the possibility that EL would retain any of the biological functions of its component proteins. The DNA replication, genome segregation, and transcriptional activation functions of EBNA1 require the essential DNA-binding and dimerization domain residues 451 to 641 but are also dependent upon the presence of a Gly-Arg-rich region, residues 325 to 376 and (to differing extents) on the N-terminal residues 8 to 67 (52). We indeed confirmed that EL, which lacks most of the Gly-Arg-rich region and all of the N-terminal domain, had lost transcriptional activating function although, like other C-terminal domain constructs designed as dominant-negative inhibitors of EBNA1 (19), it appears to retain sequence-specific DNA binding activity, here reflected in suppression of an EBV BamHI-Q reporter construct (Fig. 2A). This residual activity is very unlikely to have biologic effects within cells, especially since even wild-type EBNA1 appears not to act directly upon cellular gene transcription (17) and indeed is dispensable for EBV-induced B-cell growth and transformation if its genome maintenance function is rendered redundant by integration of the viral genome into cellular DNA (15). The LMP2 protein also is not required for B-cell transformation (44) but nevertheless does have important signaling functions that are mediated via tyrosine residues 74 and 112 acting as recruitment sites for the Syk and Lyn tyrosine kinases, respectively (25). We confirmed that mutation of both these residues in the EL construct indeed abrogated the signaling capacity of the fusion protein.
The selection of MVA as a vector for EL expression reflects the proven safety and efficacy both of the MVA strain itself as a smallpox vaccine in humans and of MVA recombinants when tested in animal models as prophylactic vaccines for viral and parasitic infections (12, 14, 48, 53) and even as therapeutic vaccines against tumors expressing strong indicator target antigens (3). The present work has focused on in vitro studies with the MVA-EL construct because our priority was to examine the ability of the EL fusion protein to be processed and its constituent epitopes presented to T cells.
We first examined processing via the HLA class I pathway and showed that target cells endogenously expressing EL from the MVA vector were efficiently recognized and killed by CD8+-T-cell clones whether specific for the HPV/B35 epitope within the EBNA1 fragment of the fusion protein or specific for any of four LMP2 epitopes tested (Fig. 3). Importantly those included the SSC/A11 and TYG/A24 epitopes that are of particular relevance for a nasopharyngeal carcinoma vaccine because of the high frequency of the HLA-A11 and A24 alleles in the Chinese population (21). Subsequent experiments showed that endogenously expressed EL was also capable of reactivating LMP2 epitope-specific CD8+ T-cell memory responses in vitro, in this case with autologous dendritic cells as the MVA-EL-infected stimulator population and comparing this with the unmanipulated LCL. Just as in earlier work with dendritic cells loaded with LMP2 epitope peptides as stimulators (36), dendritic cells expressing EL were more efficient than LCL cells at reactivating the low numbers of LMP2 epitope-specific memory T cells typically found in the blood of healthy virus carriers (Fig. 4). Furthermore, these reactivated effectors were functionally equivalent to LMP2 epitope-specific CD8+ T cells isolated by cloning from LCL-stimulated polyclonal populations (21).
Parallel in vitro stimulation experiments designed to study EL presentation via the HLA class II pathway were particularly interesting. They showed that MVA-EL-infected dendritic cells induced very efficient reactivation of CD4+ memory T cells for all five EBNA1 epitopes tested, whereas there was little or no evidence of such reactivation induced by the LCL within the same time scale (Fig. 5). It is worth noting that, although these five epitopes were originally identified from work on Caucasian donors, three of them (PQC, TSL and NPK) are also among the range of EBNA1 epitopes commonly seen by the CD4+ T-cell response in Chinese individuals (X. R. Lin et al., unpublished data). Subsequent experiments strongly suggested that the endogenously expressed EL protein was directly accessing the HLA class II pathway. Thus, EBNA1 epitope-specific CD4+ T-cell clones showed significant recognition of MVA-EL-infected targets within 12 h of infection, and this clearly was dependent upon de novo EL expression (Fig. 6).
It is formally possible that, even within this short time, recognition stems from the release of EL protein from infected cells and its uptake and reprocessing as exogenous antigen by neighboring cells. However this seems very unlikely given the fact that cells infected in parallel with MVA expressing equivalent levels of a GAr-deleted EBNA1 protein (which would be similarly available for release and reprocessing) were never recognized. Note that the antigen-presenting cells in this experiment were the autologous EBV-transformed LCLs, and these were also not detectably recognized by the CD4+-T-cell clones despite endogenous expression of native EBNA1 from the resident EBV genome. While particular high-affinity CD4+-T-cell clones against EBNA1 epitopes have been reported to show LCL recognition (31, 34), this is not true of most EBNA1-specific clones in our experience. In any case, the present data clearly show that incorporation into the EL fusion protein has given EBNA1 epitopes much improved access to the HLA class II presentation pathway, mediating levels of CD4+-T-cell recognition that were 20 to 80% of that seen when the GAr-deleted EBNA1 protein was deliberately targeted to the class II pathway by fusion with a LAMP sequence.
Interestingly, fluorescence studies showed that fusion to LMP2 had dramatically altered the location of EBNA1 staining from exclusively nuclear to dense cytoplasmic patches on a background of weak cytoplasmic fluorescence. However, this did not simply reproduce the pattern of wild-type LMP2 staining, which, as others have reported (6, 26), is found in abundant intracellular vesicles at least partly colocalized with cellular endosomal proteins such as EEA1 and CD63. Nor did it follow the pattern of LAMP-targeted EBNA1, which showed more discrete cytoplasmic vesicular staining consistent with endosome/lysosome targeting. The precise nature of the dense patches of EL staining, apparent after MVA-EL infection of both dendritic cells (Fig. 7) and A431 epithelial cells (data not shown) remains to be determined.
It is nevertheless clear that the fusion protein can access both the HLA class I and class II processing pathways in antigen-presenting cells and that MVA-EL-infected dendritic cells can efficiently reactivate CD4+ memory T cells specific for EBNA1 epitopes and CD8+ memory T cells specific for LMP2 epitopes. Such a virus has potential as a therapeutic vaccine against the EBV-associated tumor nasopharyngeal carcinoma, either to boost the relevant components of immune T-cell memory in nasopharyngeal carcinoma patients or, perhaps as part of a heterologous prime-boost strategy (28, 41), to elicit and sustain new responses capable of targeting tumor cells.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
T.A.H. and N.H.G. contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||