Rega Institute for Medical Research,1 University Hospitals St. Rafael, Leuven,2 Department of Molecular Biotechnology, Gent, Belgium,3 Swedish Institute for Infectious Diseases, Göteborg, Sweden4
Received 3 February 2004/ Accepted 10 May 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
(1-3)-linked mannose residues, whereas Hippeastrum sp. hybrid agglutinin (HHA) recognizes both
(1-3)- and
(1-6)-linked mannose residues (41-43). These lectins occur as tetramers with a molecular mass of 50,000 Da. They suppress HIV infection as well as HIV transmission by preventing the entry of HIV into its target cells, and short preexposure of cell-free HIV type 1 (HIV-1) particles or virus-infected cells markedly potentiates the inhibitory activity of the plant lectins (7a; J. Balzarini, S. Hatse, K. Vermeire, K. Princen, E. De Clercq, E. Van Damme, W. Peumans, and D. Schols, Abstr. Hum. Immundefic. Virus DART 2002, abstr. 024, p. 29, 2002). There is strong evidence that plant lectins with anti-HIV activity predominantly target the heavily glycosylated gp120 envelope glycoprotein. Other compounds known to target HIV gp120 are soluble CD4 (2), chicoric acid and its tetraacetyl esters (30), polyanions like dextran sulfate derivatives (15, 34), and the peptidic substance cyanovirin, a lectin isolated from the cyanobacterium Nostoc ellipsosporum (11). In contrast, other known entry inhibitors such as T-20 interact with gp41 (20), whereas the bicyclams AMD3100 (35) and SCH-C (38) and the quaternary ammonium derivative TAK-779 (3) bind to the chemokine receptors (HIV coreceptors) CXCR4 and CCR5, respectively. The natural agonists of these HIV coreceptors are the chemokines SDF-1 (9, 27) for CXCR4 and RANTES and macrophage inflammatory protein 1
(MIP-1
) (especially the isoform LD78ß) and MIP-1ß (12, 14, 24) for CCR5, which were shown to inhibit HIV infection. There is currently increased interest and attention with regard to the development of antiviral (HIV) microbicides, which are agents that may be used topically to prevent the spread of HIV infection by blocking sexual transmission of HIV. We and others have previously shown that a variety of plant lectins exert a pronounced inhibitory activity against HIV replication in cell cultures (4, 5, 18). Recently, researchers focused on the mannose-specific lectins from snowdrop (GNA) and amaryllis (HHA) lectins and found that they may qualify as potential microbicides to prevent HIV spread (7a; Balzarini et al., Abstr. Hum. Immundefic. Virus DART 2002; D. Schols, S. Hatse, K. Vermeire, K. Princen, W. Peumans, E. Van Damme, E. De Clercq, and J. Balzarini, Abstr. 10th Conf. Retrovir. Opportun. Infect., abstr. 104, p. 94, 2003). These lectins not only inhibit infection of human lymphocytic cell cultures with cell-free virus but also prevent virus spread from HIV-infected cells, and their activity is markedly potentiated upon short preincubation of cell-free virus particles or virus-infected cells (7a; Balzarini et al., Abstr. Hum. Immundefic. Virus DART 2002). In sharp contrast with many other lectins, both HHA and GNA proved nonmitogenic to human lymphocytes and they do not agglutinate human red blood cells or show acute toxicity when administered intravenously to mice (7a, 43; Balzarini et al., Abstr. Hum. Immundefic. Virus DART 2002; Schols et al., Abstr. 10th Conf. Retrovir. Opportun. Infect.).
In this study, we selected HIV type 1 (HIV-1) strains with different levels of resistance to two mannose-specific lectins (GNA and HHA) and found that they are endowed with a resistance profile that is strikingly different from that of any other entry inhibitor reported so far. It was shown that glycosylation sites in HIV gp120 were predominantly affected, resulting in different levels of HIV resistance towards plant lectins, depending on the nature and number of glycosylation sites that were affected in the gp120 molecule. These findings also explain the virtual lack of cross-resistance towards other known classes of HIV entry inhibitors.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cells. Human T-lymphocytic CEM and Sup-T1 cells were obtained from the American Type Culture Collection (Rockville, Md.), and persistently infected HUT-78/HIV-1 or CEM/HIV-1 cells were obtained by exposing HUT-78 or CEM cell cultures to wild-type HIV-1(IIIB) or mutant (GNA-resistant) HIV-1/GNA for 3 to 4 weeks. All cell lines mentioned were cultivated in RPMI 1640 medium supplemented with 10% fetal bovine serum (BioWittaker Europe, Verviers, Belgium), 2 mM L-glutamine, and 0.075 M NaHCO3.
Viruses. HIV-1(IIIB) was provided by R. C. Gallo and M. Popovic (at the National Cancer Institute, National Institutes of Health, Bethesda, Md.).
Selection and isolation of GNA- and HHA-resistant HIV-1 strains.
HIV-1(IIIB) was subjected to subcultivations in HIV-1-infected CEM cell cultures (3 x 105 to 4 x 105 cells/ml) in 48-well plates in the presence of 0.5 µg of GNA/ml or 0.25 µg of HHA/ml. The multiplicity of the initial infection was
200 times the cell culture 50% infective dose (CCID50). Passages were performed every 3 to 4 days by the addition of 100 µl of the infected culture supernatant or 100 µl of the infected cell suspension to 900 µl of a suspension containing 3x 105 to 4 x 105 uninfected CEM cells/ml. At each subcultivation, the same concentration of test compound was administered; an increased drug concentration was given when full cytopathicity was obtained in the previous cell cultures. The escalation of drug concentrations as well as the time points and drug concentrations at which the virus isolates were recovered are shown in Fig. 1.
|
Antiretrovirus assays. The methodology of the anti-HIV assays has been described previously (6, 7). Briefly, CEM cells (4.5 x 105 cells per ml) were suspended in fresh culture medium and infected with HIV-1 at 100 times the CCID50 per ml of cell suspension. Next, 100 µl of the infected cell suspension was transferred to microplate wells, mixed with 100 µl of the appropriate dilutions of the test compounds (i.e., final concentrations of 200, 40, 8, 1.6, 0.32, and 0.062 µg/ml), and further incubated at 37°C. After 4 to 5 days, giant cell formation was recorded microscopically in the CEM cell cultures. The 50% effective concentration (EC50) corresponded to the compound concentrations required to prevent syncytium formation by 50% in the virus-infected CEM cell cultures.
Cocultivation assays. Persistently (wild-type- and GNA-resistant) HIV-1-infected HUT-78 or CEM cells (designated HUT-78/HIV-1, HUT-78/HIV-1 GNA, CEM/HIV-1, and CEM/HIV-1 GNA) were washed to remove free virus from the cell culture medium, and 5 x 104 cells (50 µl) were transferred to 96-well microtiter plates (Sterilin). Next, 5 x 104 Sup-T1 cells (50 µl) and an appropriate concentration of test compound (100 µl) were added to each well. The mixed cell cultures were cultured at 37°C in a CO2-controlled atmosphere. The first syncytia arose after about 6 h of cocultivation. After 16 to 20 h, marked syncytium formation was noted, and the number of syncytia was examined and quantified under a microscope.
Examination of coreceptor usage by wild-type and GNA-resistant HIV-1(IIIB). CXCR4- and CCR5-transfected U87.CD4 cells were seeded in 24-well plates at 2 x 104 cells per well and infected with 5,000 pg of p24/well of the wild-type or the GNA-resistant virus. As a positive control, we also included the dual-tropic R5/X4 HIV-1 strain HE, which is able to infect both cell lines. After 5 days, the virus-induced cytopathic effect (syncytium formation) on the different cell cultures was evaluated microscopically, and virus production was measured in the cell culture supernatants by p24 core antigen (Ag) enzyme-linked immunosorbent assay (Perkin-Elmer, Boston, Mass.).
Site-directed mutagenesis and expression of viral clones. A proviral vector, pBRU-2 (obtained from R. Axel though the MRC AIDS Reagent Repository, Potters Bar, United Kingdom), containing the entire genome of HIV-1(BRU) (LAV strain) and some of the pBR322 sequences vector, was used for construction of a mutant HIV-1(BRU) clone containing the N200Q, N204Q, and N211Q mutations in the LA loop of gp120 as described previously (23). The HIV-1(BRU) env gene was subjected to nucleotide-directed mutagenesis by using a USE mutagenesis kit (Pharmacia Upjohn, Stockholm, Sweden) according to the manufacturer's instructions. Briefly, a 2,701-bp BamHI-SalI fragment containing almost the entire envelope gene was excised from the proviral vector pBRU-2 and cloned into the pUC18 plasmid. The resulting plasmid was designated pUCO. The nucleotide changes were introduced into this plasmid by using an oligonucleotide (Scandinavian Gene Synthesis AB, Köping, Sweden), one forming primers containing the desired mutations in C2 (5'GCGATTCTAAAATGTAATCAGAAGACGTTCCAAGGAACAGGACCATGTACACAAGTCAGCACAGTACAA3'; the mutated nucleotides are underlined) and the other forming a selection primer (5'TTCGATAGTGAACAGATCTCCGGGTACCGAG3'), changing the unique restriction enzyme site BamHI to a BglII site. The fragments DraIII-StuI (249 bp) and StuI-NheI (426 bp) containing the introduced mutation were excised from pUCO and cloned back into pBRU-2 via pUCO with the unchanged BamHI site. Correct mutations were verified by sequencing with the Sequenase version 2.0 sequencing kit (U.S. Biochemical, Cleveland, Ohio).
A procedure to obtain the expression of viral clones was performed as described previously (23). Briefly, wild-type and mutated proviral plasmids were transfected into COS-1 (ATCC CRL-1650) cells by using the Fugene reagent (Roche). At 48 h posttransfection, the COS-1 cells were mixed with uninfected H9 cells, and the cells were cocultured for 5 days. The culture supernatant was transferred to fresh H9 cells and cultured for 10 days. Thereafter, the cultures were centrifuged at 11,000 x g for 15 min and the supernatant was aliquoted and stored at 80°C until use.
| RESULTS |
|---|
|
|
|---|
0.3 µg/ml; EC50 of GNA and HHA for syncytium formation in cocultures of persistently HIV-1-infected cells and uninfected cells,
1.2 µg/ml). Virus samples were then stored for further analysis (i.e., sequencing of gp120/gp41 and drug sensitivity testing), while the concentrations of the plant lectins were further increased in a stepwise manner as soon as full cytopathicity was evident, according to the schedule shown in Fig. 1. To obtain virus isolates that could grow in the presence of GNA concentrations that were at least 100-fold higher than the EC50, a minimum of 30 to 40 subcultivations was required. The different time points at which virus samples were taken for sequencing and drug sensitivity testing are shown by the arrows in Fig. 1. Determination of amino acid changes in the gp120 of the virus isolates. The gp120 and gp41 envelope genes have been sequenced from eight virus isolates. A wide variety of amino acid changes were found in gp120 but not gp41 of these virus isolates that were grown in the presence of different concentrations of either GNA or HHA (Table 1 and Fig. 2). At least 20 different amino acid sites were affected. In a number of cases, mixtures of the wild type and the mutated amino acid were noticed. However, there was a trend toward the presence of pure mutations in those virus strains that were selected in the presence of the higher drug concentrations (e.g., mutated amino acids at positions 162 [M], 204 [K], 206 [I], 271 [Y], and 369 [I]) (Table 1). There was also a trend towards a higher number of amino acid changes in the virus isolates that were grown in the presence of the higher drug concentrations (2 amino acid changes in the presence of 0.5 µg of GNA/ml versus 8 or 9 changes in the presence of 100 µg of GNA/ml and 5 to 7 amino acid changes in the presence of 1 to 10 µg of HHA/ml versus 11 changes in the presence of 100 µg of HHA/ml) (Table 1).
|
|
A number of mutations that directly (mutation of N) or indirectly (mutation of T or S in the glycosylation motif) affected glycosylation of the gp120 N glycosylation motifs (e.g., N204K, N271Y, T311I, and N430D) were invariably found in the majority of the virus isolates, whereas the mutations that were not related to the glycosylation of gp120 were often found in only one of the seven virus isolates (e.g., R136K, A144T, N270Y, R305K, G434E, and K470R). In addition, they were never present as pure mutations but were always present as a mixture with the wild type.
The gp120 amino acid sequence of the HIV-1(IIIB) strain used at the start of the selection experiment and the gp120 sequence of the virus that was passaged during 42 subcultivations in the absence of the plant lectins were determined. No mutations at any of the N glycosylation sites in gp120 occurred within this time period, except at amino acid position N259. At passage 42, a mixture of N259 and 259F/S/C was found.
In conclusion, the mutations found in the different virus isolates that appeared under GNA or HHA pressure were predominantly related to nine N glycosylation sites and one potential O glycosylation site in the HIV-1 gp120 envelope glycoprotein.
Sensitivity spectrum of virus isolates recovered in the presence of different GNA and HHA concentrations to plant lectins and other HIV entry inhibitors. The different virus isolates recovered in the presence of different concentrations of GNA and HHA were investigated for their sensitivity-resistance profile against a variety of mannose-specific plant lectins and also against several other types of HIV entry inhibitors (e.g., DS-5000, AMD3100, and T-20) and the reverse transcriptase inhibitors UC-781 and tenofovir that have been previously shown to qualify as potential microbicide drugs. HIV-1/GNA-1.0 and HIV-1/HHA-1.1 that were isolated in the presence of low plant lectin concentrations (0.5 µg of GNA/ml and 1 µg of HHA/ml) showed a relatively low (2.5- to 10-fold) level of resistance to a variety of five different mannose-specific plant lectins, including GNA and HHA. Neither the adsorption inhibitor DS-5000, the gp41 inhibitor T-20, the CXCR4 antagonist AMD3100, nor the reverse transcriptase (RT) inhibitors UC-781 and tenofovir lost any activity against these virus strains (Table 2). The virus isolates that were recovered from cell cultures in the presence of moderately high plant lectin concentrations (10 to 20 µg/ml) (HIV-1/GNA-1.1, HIV-1/HHA-1.3, and HIV-1/HHA-2.1) showed a more pronounced cross-resistance (30- to 50-fold for GNA and 10- to 50-fold for HHA) to the five different mannose-specific plant lectins, whereas again no markedly decreased sensitivity was found for the entry and RT inhibitors (except for AMD3100, which was less active against HIV-1/GNA-1.1 by 10-fold) (Table 2). The highest resistance levels for the plant lectins (70- to >100-fold) were obtained against those virus strains that were isolated in the presence of the highest concentrations of the drugs. LOA was only 20- to 40-fold resistant to HIV-1/GNA-2.1, HIV-1/HHA-1.3, and HIV-1/HHA-2.2. Interestingly, the mannose-specific lectin from the blue-green algae (cyanobacteria) cyanovirin inhibited the highly plant lectin-resistant virus strains HIV-1/GNA-2.1 and HIV-1/HHA-2.2 to an extent similar to that of its inhibition of wild-type virus. In contrast, the neutralizing antibody (NAb) 2G12 directed against HIV-1 gp120 (39) completely lost its inhibitory potential against these virus strains (Table 2). As noted for the other virus mutants selected in the presence of GNA and HHA, the sensitivity of the mutant virus strains to the inhibitory effect of DS-5000, T-20, AMD3100, UC-781, and tenofovir was preserved (Table 2).
|
4- to 5-fold or
15- to 25-higher than those required when wild-type HUT-78/HIV-1 cells or wild-type CEM/HIV-1 cells, respectively, were used in the cocultivation assays. Cyanovirin, which prevented syncytium formation at an EC50 of 0.12 to 0.20 µg/ml, kept full inhibitory potential against syncytium formation between the uninfected Sup-T1 cells and the cells persistently infected with the plant lectin-resistant virus strains (Table 3). In contrast, the other virus entry inhibitors, DS-5000, T-20, and AMD3100, retained their full inhibitory activity against syncytium formation with these viral mutants. As expected, the RT inhibitors were completely inactive in these assays (Table 3).
|
Inhibitory potential of plant lectins against a mutant HIV-1 clone.
An HIV-1 clone has been constructed in which three mutations at the glycosylation sites N200Q, N204Q, and N211Q of the LA loop of the gp120 have been introduced. We have chosen these amino acid mutations since the amino acid sites at the N200 and N204 positions were mutated in many of our HIV-1 strains that were selected for plant lectin resistance (Table 1). Abolishment of the oligosaccharides in the LA loop of gp120 resulted in pronounced HHA and GNA resistance (
20- to 25-fold) but not LOA resistance. The entry inhibitors AMD3100 and DS-5000 showed only four- to fivefold resistance as also observed for cyanovirin (Table 4).
|
| DISCUSSION |
|---|
|
|
|---|
|
The mutational specificity observed for the mannose-specific plant lectins is different from the resistance mutations described and characterized for all other entry inhibitors. Indeed, dextran sulfate as well as chicoric acid and the bicyclam AMD3100 have been shown to target mutations in gp120 that are different from the mannosylated asparagines or the potential O glycosylation site found in the plant lectin-resistant virus strains (13, 15, 30). These findings explain why mannose-specific plant lectins belonging to five different plant species and two different plant families show a highly comparable cross-resistance spectrum among each other, whereas there is a virtual lack of cross-resistance for these mutant virus strains with any other entry inhibitor tested, including the N-acetylglucosamine-specific lectin of Urtica dioica (data not shown). However, given the fact that cyanovirin, another selective entry inhibitor of HIV that was recently shown to prevent rectal transmission of simian-human immunodeficiency virus in macaques as a topical microbicide (40), has been characterized as a mannose-specific lectin derived from a primitive blue-green algae (10, 11, 28), its activity profile against several plant lectin-resistant HIV-1 strains derived in our study was also determined. No cross-resistance was observed for those mutant HIV-1 strains that showed the highest degree of resistance (i.e.,
100-fold) against HHA and GNA. Likewise, it would be of particular interest to uncover the nature of the amino acid mutations emerging during selection of cyanovirin-resistant viruses and to reveal the binding site of cyanovirin to gp120. Moreover, whereas cyanovirin has also been reported to be active against other lentiviruses (simian and feline immunodeficiency viruses), as is also the case for GNA and HHA (Balzarini et al., unpublished data), cyanovirin lacks inhibitory activity against cytomegalovirus (10). This finding is strikingly different from those for GNA and HHA, which were shown to be potent inhibitors of cytomegalovirus (4, 5). Thus, although cyanovirin and the plant lectins described in this study both seem to be endowed with a (mannose) sugar specificity, they must still be different in some aspects of their sugar conformation preference to explain the differences in virus selectivity and resistance-sensitivity profiles against the plant lectin-resistant virus strains. One contributing factor to explain the lack of cross-resistance of cyanovirin to the plant lectin-resistant virus strains may be the different sugar specificity of cyanovirin (specificity for
-1,2-mannose glycans) and the plant lectins (specificity for
-1,3- and/or
-1,6-mannose oligomers). In this respect, it will also be of interest to investigate the activity of the C-type MBL of the innate immune system against the plant lectin-resistant viruses (19). MBL is a serum protein of hepatic origin that binds to carbohydrates of microorganisms and has been shown to bind to gp120 and to recognize high-mannose complexes and/or hybrid N-linked glycans for binding to its target glycoproteins (19).
The gp120 molecule contains five relatively conserved domains interspersed with five hypervariable disulfide-bonded loop structures (22). There are also 24 potential sites for N glycosylation that are all utilized. For the HIV-1/CL44 gp120, 13 sites that contain complex-type oligosaccharides as the predominant structure and 11 sites that contain primarily high-mannose-type and/or hybrid-type oligosaccharide structures were found (25, 26). Of the complex oligosaccharides, 90% were found to be fucosylated and 94% were sialylated. No O-linked oligosaccharides were found. Gp120 of HIV-1(IIIB) even contains approximately 50% of the high-mannose-type oligosaccharides (17). One of the functions of these oligosaccharides is to fend off potential (conserved) epitopes on HIV gp120 for NAbs (1, 29, 31, 45). Interestingly, the binding site of gp120 with the cellular CD4 receptor is devoid of carbohydrates (46). Indeed, the gp120 area of interaction with CD4 consists of one amino acid residue in the V1/V2 stem, the loop LD (positions 249 to 252), the ß15-
3 excursion (positions 335 to 338 and 339 to 442), the ß20-ß21 hairpin (positions 392 to 397 and 400 to 405), the ß23 strand (positions 421 to 427), and the ß24-
5 connection (positions 434 to 440 and 445 to 454) (21, 45) (Fig. 3). None of these residues were mutated in any of the plant lectin-resistant mutant virus strains. Also, the interaction domain(s) of gp120 with the coreceptors CCR5 and CXCR4 have been determined and were found to be predominantly located in the positively charged V3 loop (positions 266 to 300), the basic surface of the bridging sheet containing the ß2 and ß3 and the ß20 and ß21 strands, and the amino acids R389, K391, and Q392 at the end of the ß19 strand (21, 45) (Fig. 3). Again, none of the positively charged amino acids of the V3 loop nor any of the other amino acids of gp120 interacting with the coreceptor were altered in the mutant HIV-1 strains that emerged in the presence of escalating plant lectin concentrations. The N glycosylation site 271 in the V3 loop was abolished only in the higher plant lectin-resistant HIV-1 strains, allowing a more pronounced exposure of the positively charged amino acids of the gp120 V3 loop to the negatively charged coreceptor. Thus, the plant lectins clearly seem not to interfere with coreceptor binding areas on gp120. Indeed, when the N glycosylation sites that were mutated in the gp120 of the plant lectin-resistant mutant virus were located on the ribbon and topology diagrams in Fig. 3, they clearly clustered (except for the V3 mutation) at the top of the inner domain (near the gp41 binding site) and in the upper half of the outer domain but not at the coreceptor binding domains.
Interestingly, Scanlan et al. (33) and Trkola et al. (39) revealed that the broadly neutralizing anti-HIV-1 antibody 2G12 recognizes a cluster of
1
2 mannose residues of oligomannose glycans on the outer face of gp120. Mutations at N265, N302, N309, N356, and N362 resulted in a significant decrease in 2G12 binding affinity to gp120. However, further studies showed that the glycans at N309 and N356 were shown not to be critical for 2G12 binding to gp120. Thus, the most likely epitope for 2G12 is formed from mannose residues contributed by the glycans that are attached to N265, N302, and N362, with the other glycans (N309 and N356) play an indirect role in maintaining the epitope conformation (33). In a number of our plant lectin-resistant HIV-1 strains, the N309 glycosylation site was abolished. Interestingly, the 2G12 antibody fully lost its inhibitory potential to these virus strains as well (Table 2). These findings are in agreement with the indirect role of N309 in maintaining the gp120 2G12 epitope conformation, although it cannot be excluded that any of the other mutated amino acids in these 2G12-resistant mutant virus strains may play a similar role. It has been shown recently (37) that the MBL of the innate immune system can also bind gp120 of HIV-1, thereby preventing DC-SIGN to bind to HIV and thus exerting an antiviral effect. Further studies should reveal whether plant lectin binding to gp120 can also prevent HIV binding to DC-SIGN and, more importantly, whether the plant lectin-resistant virus strains show a lower efficiency of binding to DC-SIGN.
Given the fact that the location of the plant lectin-induced amino acid mutations in gp120 is not involved in the very first steps of virus adsorption and coreceptor binding, it is unclear what the role of the plant lectins is in the inhibition of the HIV entry-fusion process. It is rather unlikely that the oligosaccharides that are abolished in the mutant virus strains play a significant role in the fusion process, since the mutated viruses do not seem to have a compromised efficiency of infectivity in CEM cell cultures. Therefore, it may be more likely that attachment of the plant lectins to these parts of the gp120 molecule may seriously compromise the fusion process after CD4 and/or CXCR4/CCR5 interaction by steric hindrance or conformational restriction. The more glycosylation sites that are abolished, the less the lectins are bound to gp120; thus, it is easier for the fusion process to occur. Since the gp41 attachment to gp120 occurs at the C- and N-terminal amino acid domain of gp120 (Fig. 3) (8), which is rather close to some of the mutations found in the plant lectin-resistant viruses, the presence of the lectins that are tightly bound to gp120 may indeed interfere with the further conformational changes and interactions with gp120 where gp41 is involved. It will be interesting to reveal the localization and the number of the binding sites of gp120 for the mannose-specific plant lectins and to determine their affinity constants for gp120 in comparison with those for the coreceptors to better understand the mechanism of antiviral action of the plant lectins at the molecular level. In this respect, construction of a variety of mutant virus strains that contain one or several of the observed mutations in gp120 may already provide useful information. Therefore, we have deleted the glycosylated amino acid sites in the LA loop of gp120 to reveal the role of these amino acids in the susceptibility of the lectins to such mutant virus. The deglycosylated LA loop resulted in pronounced resistance to GNA and HHA and partial resistance to cyanovirin but no resistance to LOA (Table 4). These observations clearly point to subtle differences in the individual lectin interaction with the sugar part of gp120 and are in agreement with our findings that LOA shows a lesser degree of resistance than the other plant lectins (GNA, HHA, and CA) in several mutant virus strains. These findings also justify a profound exploration of the activity of a wide variety of mannose-specific plant lectins against HIV.
It has been reported previously that glycans shield antibody epitopes (29, 32, 36, 45). Very recently, Wei et al. (45) showed that NAbs directed towards HIV gp160 exert sufficient viral inhibitory activity to force the virus to replace the neutralization-sensitive virus by successive populations of resistant virus. Interestingly, during the progress of virus infection, the envelope gene of HIV-1 mutates rapidly, primarily at glycosylation sites, resulting in a change of the glycan shield on the surface of the virus, thereby creating a physical block to NAb binding. This mechanism of immunological escape contributes to HIV-1 persistence in the face of an evolving antibody repertoire. It will therefore be of particular interest to combine plant lectins with neutralizing antibodies of HIV to investigate whether lectin drug pressure in the presence of NAb compromises the escape of HIV-1 to NAbs and thus keeps NAbs more effective during a longer time period of drug or NAb exposure.
Given that the concomitant presence of multiple amino acid mutations is required to afford a high level of resistance of virus strains to the plant lectins, it is not surprising that significant drug resistance development against plant lectins is a long-term event. Our observations that fixed plant lectin concentrations that are only 5- to 10-fold higher than their EC50 values are able to completely knock out the virus in long-term HIV-1-infected cell cultures (Balzarini et al., unpublished) are in agreement with the mutational findings (the need for multiple mutations in gp120 to afford significant levels of drug resistance) and may represent an additional beneficial property for a drug to qualify as an efficient microbicide. A drug concentration ratio of 5 to 10 is markedly lower than the ratio of the knockout concentration to the EC50 (
100) of several nonnucleoside reverse transcriptase inhibitors and some nucleoside reverse transcriptase inhibitors such as lamivudine (6, 7).
In conclusion, we have observed specific plant lectin-related HIV resistance mutations that are different from the currently approved and investigational anti-HIV drugs and result in a lack of cross-resistance to any other reported viral entry inhibitor that selects for mutations in the same target, viz., the viral envelope glycoprotein gp120.
| ACKNOWLEDGMENTS |
|---|
The research was financially supported by the European Commission (René Descartes Prize2001, Krediet nr. HPAW-2002-90001, and EMPRO no. 503558 of the 6th Frame Work Programme) and the Fonds voor Wetenschappelijk Onderzoek (FWO) Krediet nr. G-0267-04.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
-(1-3)- and
-(1-6)-D-mannose-specific plant lectins are markedly inhibitory to human immunodeficiency virus and cytomegalovirus infections in vitro. Antimicrob. Agents Chemother. 35:410-416.
, and MIP-1ß as the major HIV-suppressive factors produced by CD8+ T cells. Science 270:1811-1815.
is the most potent CCR5 agonist and HIV-1-inhibiting chemokine. J. Clin. Investig. 104:R1-R5.[Medline]
1
2 mannose residues on the outer face of gp120. J. Virol. 76:7306-7321.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||