Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Kumar, A. S. M. Articles by Lipton, H. L. Search for Related Content PubMed PubMed Citation Articles by Kumar, A. S. M. Articles by Lipton, H. L.

 Previous Article  |  Next Article 

Journal of Virology, August 2004, p. 8860-8867, Vol. 78, No. 16
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.16.8860-8867.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Virus Persistence in an Animal Model of Multiple Sclerosis Requires Virion Attachment to Sialic Acid Coreceptors

A. S. Manoj Kumar,^1,2 Honey V. Reddi,^1,2 Aisha Y. Kung,¹ Mauro Dal Canto,³ and Howard L. Lipton^1,2,4*

Departments of Neurology,¹ Biochemistry, Molecular Biology and Cell Biology,² Microbiology-Immunology,⁴ Pathology, Northwestern University, and Evanston Hospital, Evanston, Illinois³

Received 2 January 2004/ Accepted 27 April 2004

Top Abstract Introduction Materials and Methods Results Discussion References

 
Persistent Theiler's virus infection in the central nervous system (CNS) of mice provides a highly relevant animal model for multiple sclerosis. The low-neurovirulence DA strain uses sialic acid as a coreceptor for cell binding before establishing infection. During adaptation of DA virus to growth in sialic acid-deficient cells, three amino acid substitutions (G1100D, T1081I, and T3182A) in the capsid arose, and the virus no longer used sialic acid as a coreceptor. The adapted virus retained acute CNS virulence, but its persistence in the CNS, white matter inflammation, and demyelination were largely abrogated. Infection of murine macrophage but not oligodendrocyte cultures with the adapted virus was also significantly reduced. Substitution of G1100D in an infectious DA virus cDNA clone demonstrated a major role for this mutation in loss of sialic acid binding and CNS persistence. These data indicate a direct role for sialic acid binding in Theiler's murine encephalomyelitis virus persistence and chronic demyelinating disease.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Virus infection in individuals genetically predisposed to multiple sclerosis (MS) is believed to trigger autoimmune myelin damage (32, 46). It is not known whether an acute "hit-and-run" infection suffices or whether infection must be chronic. Theiler's murine encephalomyelitis virus (TMEV) infection of mice, in which persistent central nervous system (CNS) infection induces Th1 CD4 T-cell responses to both virus and myelin proteins, provides a relevant experimental animal model for MS (8, 15, 37). Cytolytic picornaviruses such as TMEV require continuous virus replication and cell-to-cell spread for persistence; however, virus factors influencing persistence of TMEV or of other RNA viruses remain poorly understood (1, 29).

Assembly of recombinant TMEV from sequences of high-neurovirulence (nonpersisting) and low-neurovirulence (persisting) strains have mapped a persistence determinant(s) to the capsid, implicating a virus-receptor interaction in CNS persistence (7, 19, 35). While a protein entry receptor for TMEV has not yet been identified, members of the two neurovirulence groups use different carbohydrate coreceptors: for high-neurovirulence strains, the proteoglycan heparan sulfate, and for the low-neurovirulence strains, 2,3-linked sialic acid on an N-linked glycoprotein (14, 40, 44). Resolution of the structure of low-neurovirulence DA virus cocrystallized with the sialic acid mimic sialyllactose (SLL) demonstrated that sialic acid makes contact with four tightly clustered DA virus capsid amino acids: three on VP2 puff B and the fourth in the VP3/VP1 cleavage dipeptide at the VP3 C terminus (50). These four residues are conserved in all TMEV strains (36), suggesting that sialic acid binding is conformation dependent. Together, these data point to a crucial role for sialic acid coreceptor use by the low-neurovirulence TMEV in CNS persistence.

Analysis of DA virus adapted to growth in Lec-2 cells, which lack the CMP-sialic acid transporter (11), revealed three acquired mutations in the capsid (G1100D, T1081I, and T3182A) and independence from sialic acid as a coreceptor. The adapted virus retained acute CNS virulence in mice, but viral copy numbers, white matter inflammation, and demyelination in spinal cords were all significantly reduced during the persistent phase of infection. Loss of viral CNS persistence in mice also correlated with a significant reduction in infection of murine macrophages but not of oligodendrocytes in vitro. Analysis of a DA infectious cDNA clone with the VP1 loop II residue G1100D demonstrated a major role for this mutation in sialic acid binding and CNS persistence.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Viruses and cells. A DA virus mouse brain stock originally obtained from the Massachusetts State Department of Health was prepared as a 10% clarified homogenate after three additional brain-to-brain passages in suckling mice (28). Baby hamster kidney (BHK-21) cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 2 mM L-glutamine, 100 mg of streptomycin, 100 U of penicillin, and 6.5 mg of tryptose phosphate per ml plus 7.5% fetal bovine serum (FBS) at 37°C in a 5% CO₂ atmosphere. Lec-2 cells were grown in minimal essential medium (-MEM) supplemented with 2 mM L-glutamine, 100 mg of streptomycin, 100 U of penicillin per ml, and 10% FBS. M1D cells, derived from an immature myelomonocytic cell line, were maintained in RPMI 1640 as described (20). EOC20 murine microglial cells (ATCC no. CRL-2467) were grown in DMEM supplemented with 2 mM L-glutamine, 100 mg of streptomycin, 100 U of penicillin, 10% FBS, and 20-µg/ml MCSF-1. Murine N20 cells, a mature oligodendrocyte line (provided by Anthony T. Campagnoni, University of California—Los Angeles) (13), were maintained in DMEM-F-12 medium supplemented with 2 mM L-glutamine, 100 mg of streptomycin, 100 U of penicillin per ml, and 10% FBS. Cells of the murine astrocyte cell line C8-D1A (obtained from the American Type Culture Collection, Manassas, Va.) were maintained in DMEM supplemented with 2 mM L-glutamine, 100 mg of streptomycin, 100 U of penicillin per ml, and 10% FBS. N20 cells stained with H8H9, a monoclonal antibody to galactocerebroside, and C8-D1A cells with polyclonal antiserum to glial acidic fibrillary protein.

Animals, animal inoculations, and histology. Six-week-old, outbred male CD-1 mice (Charles Rivers Laboratories, Portage, Mich.) were used in all pathogenesis experiments. Mice anesthetized intraperitoneally with a 2:1 ratio of ketamine (31 mg/ml; Abbott, North Chicago, Ill.) to xylazine (6 mg/ml; Lloyd Laboratories, Shenandoah, Iowa) were inoculated in the right cerebral hemisphere with 0.03 ml of virus. Anesthetized mice were perfused either with phosphate-buffered saline (PBS), pH 7.4, and 10% buffered formalin for paraffin embedding and hematoxylin-and-eosin (H&E) staining or with 3% glutaraldehyde in phosphate buffer, pH 7.4, for Epon embedding and toluidine blue staining. Sections from at least three transverse levels of brain and four transverse levels of spinal cord were examined. Spinal cord sections were given a score (0 to 4) for inflammation depending upon the number of quadrants involved as originally described by Rodriguez et al. (42).

Fluorescent antibody staining. Spinal cord segments (DA brain-derived virus on day 7 postinfection [p.i.], n = 4; DA-adapted virus on day 8 p.i., n = 4) were placed in Tissue-Tek cryomold containing OCT compound (Miles) before quick-freezing, cut into 6-µm sections with a cryostat, air dried, and fixed in acetone for 10 min at 24°C. Sections were stained with rabbit anti-BeAn virus serum at 1:20,000/goat anti-rabbit immunoglobulin G (IgG) conjugated with rhodamine at 1:200, mouse MAb to CD11b (Mac-1) conjugated with fluorescein isothiocyanate (FITC) (eBioscience, San Diego, Calif.) at 1:100, and 0.5-µg/ml DAPI (4',6'-diamidino-2-phenylindole) and viewed with a Zeiss Axioscope with epifluorescence light excitation and digital deconvolution software.

Quantitation of virus infection. Since neither the DA parent (brain stock) nor adapted viruses formed plaques, virus titrations were determined with 10-fold dilutions of virus in quadruplicate in cell monolayers in 96-well plates fixed in methanol and stained with crystal violet at 7 days p.i. End points per milliliter were calculated by the method of Reed and Muench (41) and expressed as median 50% tissue culture infectious doses (TCID₅₀). Cytopathic effect (CPE) was quantitated based on cell viability, determined by the conversion of 3-(4,5-dimethyl-thiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) to blue formazan crystals as determined by MTT assay, and calculated as a percentage of uninfected cell controls at 24 h (10). Timing of the MTT assay in the different cell lines was determined from preliminary experiments. The median 50% lethal dose of virus was determined by the intracerebral (i.c.) inoculation of adult CD-1 mice (4 mice per 10-fold dilution), and end points were calculated as described previously.

Dideoxynucleotide sequencing. Total RNA isolated from infected mouse brains or cell cultures using Trizol reagent (Gibco) was reverse transcribed (5 µg of RNA in a 20-µl reaction mixture), using Thermoscript reverse transcriptase (Gibco) in the presence of specific primers (10 µM). Two microliters of each cDNA sample was PCR amplified in a 25-µl reaction mixture by using specific forward and reverse DA primers to obtain the nucleotide sequence of the entire open reading frame (nucleotides 1064 to 7976) (Table 1). Gel-purified PCR products were sequenced with the ABI Prism 310 genetic analyzer (Applied Biosystems, Shelton, Conn.).

View this table: [in this window] [in a new window]

TABLE 1. DA virus primers used in RT-PCRs

Site-directed mutagenesis. A sequence containing the VP1 region from a full-length DA plasmid, pTMDA (34), was ligated into M13mp19 (Bio-Rad, Hercules, Calif.), and mutagenesis was performed with a mutagenic oligonucleotide (5' GGAAAATTGGTGGTATCGCCGGAGCGG 3') according to Kunkel et al. (26). Escherichia coli CJ236 cells (Bio-Rad) were used in preparing uracil-rich single-stranded M13 templates, and E. coli MV1190 (Bio-Rad) cells were used for propagation of M13. After mutagenesis, the sequence was ligated back into a full-length DA plasmid. Sequencing reactions of single-stranded M13 DNA and plasmid DNA carried out with an ABI Prism Big dye terminator cycle sequencing kit were analyzed on an ABI Prism 310 genetic analyzer (Applied Biosystems).

Quantitation of CNS virus RNA copy numbers. CNS virus copy numbers were determined by a quantitative fluorogenic probe-based reverse transcription-PCR (RT-PCR) assay system (Applied Biosystems) as described previously (47). Forward (5' GATTTGTCTGCCAGCGGTG 3') and reverse (5' GCCCAAGATGTTCGACAATTG 3') primers and an oligonucleotide probe [5'(6-FAM)ATGCTGGCGACGCCCCCC (TAMRA)3'] that anneals to an internal region of PCR amplicons were specific to the DA 1A (VP4) genomic region.

Binding assay. Cells were detached from monolayers with PBS without divalent cations, washed, resuspended to a concentration of 10⁶ cells/ml in DMEM containing 20 mM HEPES and 1% bovine serum albumin, and incubated on ice for 1 h before addition of [³⁵S]methionine-labeled virus (20,000 particles/cell). At indicated times, an aliquot of virus-cell suspension was removed and diluted in DMEM before centrifugation at 12,000 x g for 30 s. Supernatant radioactivity and cell-associated radioactivity were determined for triplicate samples in a Beckman LS5000TD scintillation counter and plotted as the natural logarithm (ln) of the ratio of virus particles added (V₀) to the unattached virus at indicated times (V_t).

Statistics. Comparisons of values between two groups were analyzed by the paired t test.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Adaptation of DA virus to sialic acid-deficient cells results in specific capsid mutations. To generate infectious DA virus independent of sialic acid binding, a brain-derived DA virus was passed in Lec-2 cells, which lack the CMP sialic acid transporter and cell-surface sialic acid (11). Sialic acid dependence for infection was indicated by development of small foci of CPE only after day 7 p.i., minimal progression over the next 7 days (passage 1 [P1]), and complete CPE only after two additional passages (P3) (Fig. 1A). Virus from the last passage (P3) had a single mutation, G1100D, on VP1 loop II, while the P5-adapted virus used in the following studies had two additional amino acid substitutions: T1081I on VP1 loop I and T3182A in the VP3 GH loop (Fig. 1B). The VP1 mutations were in surface loops that interact through noncovalent bonds with VP2 puff B, the site of sialic acid binding (17, 31), while the VP3 mutation was in a flexible loop adjacent to the pit, termed the "receptor binding loop," in the related mengovirus (23). Adaptation of another TMEV closely related to DA virus, Vie415HTR, to Lec-2 cells also resulted in the G1100D substitution as the first of three capsid mutations (not shown).

View larger version (51K): [in this window] [in a new window]

FIG. 1. (A) Passage history of low-neurovirulence brain-derived DA virus adapted to grow in Lec-2 cells lacking sialic acid. The number of days of each passage, relative extent of CPE, and mutations in the L-P1 genomic regions are shown. (B) Image of the DA virus asymmetric icosahedral unit (protomer) generated by the RasMol program: blue, VP1; green, VP2; red, VP3; yellow, sialic acid binding residues; and white, DA virus adaptation mutations. An inset (upper left) shows a pentamer. The same mutations designated by number in panel A are shown in panel B.

DA adapted virus no longer uses sialic acid. Binding of brain-derived DA parental and adapted viruses to cells expressing cell surface sialic acid (BHK-21 cells) showed similar kinetics (Fig. 2A), but only the adapted virus bound Lec-2 cells (Fig. 2B). A mutated DA virus constructed by site-specific introduction of G1100D into an infectious DA virus clone, pTMDA (34), showed weaker binding to BHK-21 cells and partial binding to Lec-2 cells (Fig. 2B). GDVII virus, which does not use sialic acid as a coreceptor, bound both cell lines efficiently (not shown). When viruses were incubated with the sialic acid mimic SLL before infection of BHK-21 cells, brain-derived DA parental virus-induced CPE was completely inhibited, with 95% cell survival at 24 h p.i., while the adapted virus was not inhibited (<10% cell survival) and the G1100D mutant was partially inhibited (40% cell survival) (Fig. 2C). Both brain-derived parental and adapted viruses grew to high titer (TCID₅₀ of >10⁷) in BHK-21 cells; however, only the adapted virus infected Lec-2 cells (TCID₅₀ = 10⁵) (Fig. 2D), consistent with the binding results. Analysis of hemagglutination (HA) induced by binding of low-neurovirulence TMEV to sialic acid on human type O erythrocytes revealed high HA titers for DA brain-derived parental and adapted viruses (1:4,096) and for the G1100D mutant virus (1:2,048); however, only HA of the parental virus was inhibited by neuraminidase treatment of erythrocytes (Fig. 2E). Thus, the adapted virus no longer used sialic acid for HA and the G1100D mutation abrogated sialic acid binding needed for HA.

View larger version (36K): [in this window] [in a new window]

FIG. 2. (A and B) Saturation binding analysis of [35S]methionine-labeled brain-derived DA parental (•), adapted () and G1100D mutant () viruses to BHK-21 cells (A) and Lec-2 cells (B) plotted as the natural logarithm of virus particles added (V0)/unattached virus at the indicated times (Vt). (C) Inhibition of infection by preincubation of viruses with the sialic acid mimic SLL () or PBS (). Percent cell death at 24 h p.i. was determined by MTT assay. (D) TCID50 of DA brain-derived parental and adapted viruses compared to that of high-neurovirulence GDVII in both BHK-21 () and Lec-2 () cell monolayers in 96-well microtiter plates. (E) HA titers determined for brain-derived DA parental, adapted, and G1100D mutant viruses as well as GDVII virus using human type O erythrocytes preincubated with Clostridium perfringens neuraminidase (NA) or not preincubated.

DA adapted virus has increased acute CNS virulence. Low-neurovirulence TMEV induces a biphasic CNS disease in mice after i.c. inoculation, with acute virus growth principally in spinal cord anterior horn cells (poliomyelitis), followed by CNS persistence and demyelinating disease (28, 43, 45). Determination of the 50% lethal dose (LD₅₀) in adult CD-1 mice revealed that adapted DA virus was one-half log₁₀ more virulent than the brain-derived parental virus, but both viruses were substantially less virulent than GDVII virus (Fig. 3A). DA adapted virus-infected mice had an earlier onset of paralysis and higher mortality (not shown), and at the peak of CNS virus growth on days 7 to 9 p.i., viral RNA copy numbers were significantly higher in spinal cords (P = 0.0159) but not brains (P = 0.3429) of mice infected with the adapted virus (Fig. 3B). At this time there were greater numbers of virus antigen-containing anterior horn cells in spinal cord sections from DA adapted than DA parental virus-infected mice (Fig. 3C and D). Microglial nodules were readily found in the anterior horns of H&E-stained sections of mice infected with both viruses on days 7 and 8 p.i. (not shown), and virus antigen colocalized with CD11b staining in these cell clusters (Fig. 3E). This result indicated that both viruses infected microglia that surrounded and presumably were engulfing infected and dying anterior horn cells. In contrast, isolated CD11b⁺ cells that were numerous in gray (separate from infected neurons) and white matter did not show colocalization with TMEV antigen(s) and thus were not infected.

View larger version (51K): [in this window] [in a new window]

FIG. 3. Effect of sialic acid-independent DA virus infection on acute CNS virulence. (A) LD50 in adult CD-1 mice, showing that virulence of adapted DA and G1100D viruses was comparable to that of their respective parental viruses; G1100D was more virulent. The LD50 of high-neurovirulence GDVII virus is shown for comparison. (B) Virus genome copy numbers determined by real-time RT-PCR at day 7 p.i. in brains and spinal cords of DA adapted virus-infected () and DA parental virus-infected () mice did not differ significantly (n = 5 and P > 0.05 for each virus). (C and D) Sections of infected spinal cords stained with rabbit anti-TMEV antiserum and goat anti-rabbit IgG-FITC and Evans blue dye. Infected anterior horn cells were less numerous in DA parental (C) than in DA adapted (D) virus-infected mice (days 8 and 7 p.i., respectively). Unstained microglia near anterior horn cells cannot be seen in sections at this magnification. Evans blue counterstain delineated the gray matter (darker area with infected cells) from the adjacent white matter. (E) Double-immunofluorescent-stained section of an anterior horn from DA adapted virus-infected mouse (day 7) showing 12 Mac-1+ cells (red membrane staining) with colocalized virus antigen (greenish yellow) representing a microglial nodule. (F) Virus genome copy numbers determined by real-time RT-PCR at day 7 p.i. in brains and spinal cords of the G1100D mutant () and DA parental (transcript derived; ) virus-infected mice did not differ significantly (n = 5 and P > 0.05 for each virus).

The LD₅₀ of the G1100D mutant was 100-fold more than that of the DA transcript-derived parental virus (pTMDA) cloned from an attenuated DA variant after BHK-21 cell passage (Fig. 3A), accounting for a lower LD₅₀ (34). No significant difference was observed in brain and spinal cord viral RNA copy numbers for the DA transcript-derived parent virus- and G1100D virus-infected mice (Fig. 3F). These results indicate that neither the adapted virus nor the G1100D mutant was attenuated in acute CNS virulence.

Virus persistence and inflammatory demyelination are dramatically reduced in DA adapted virus-infected mice. Since neither the adapted nor mutant virus was attenuated, additional CD-1 mice were inoculated with virus (dose normalized to 50 LD₅₀s) and survivors were sacrificed on day 55 p.i. to quantitate viral genome load in the spinal cord and inflammatory white matter changes in paraffin-embedded, H&E-stained sections (Fig. 4). The spinal cord genome load was significantly reduced in mice infected with DA adapted virus compared to those infected with brain-derived parent virus (P < 0.0001) (Fig. 4A). White matter pathology was assessed as percent spinal cord quadrants showing inflammation, and there was significantly less pathology in adapted virus-infected mice at day 55 (P = 0.018; 7.16 ± 7.88 versus 38.95 ± 15.71 [mean ± standard deviation] assessed in 4 and 14 mice, respectively). The extent of inflammation was also substantially less in all sections of the adapted virus-infected mice (Fig. 4B and C). Since demyelinating lesions in myelin-basic protein-stained sections at day 55 were small, assessment of Epon-embedded spinal cord sections from additional mice at day 90 revealed no demyelination in two adapted virus-infected mice but large demyelinating lesions in most sections from three brain-derived parental virus-infected mice (Fig. 4D and E).

View larger version (75K): [in this window] [in a new window]

FIG. 4. Effect of sialic acid-independent DA virus infection on CNS persistence and chronic white matter pathology. (A) Spinal cord genome copy numbers determined by real-time RT-PCR at day 55 p.i. were significantly reduced in adapted virus-infected mice compared to brain-derived parental virus-infected mice () (n = 14 in each group; P < 0.0001), as well as in G1100D mutant virus infected compared to transcript-derived parent virus-infected mice () (n = 4 in each group, P = 0.0286). (B and C) Paraffin-embedded, H&E-stained sections from spinal cords of DA brain-derived parental (B) and adapted (C) virus-infected mice at day 55 showing that lymphocytic infiltration and macrophage infiltration (seen as vacuolation) were greater in parental virus-infected mice. Magnification, x200. (D and E). One-micrometer-thick, Epon-embedded sections from DA brain-derived parental (D) and adapted (E) virus-infected mice at day 90 showing meningeal and parenchymal inflammatory infiltrates together with active demyelinating activity in parental virus-infected mice but no demyelination in adapted virus-infected mice. Magnification, x200.

Capsid mutation G1100D plays an important role in CNS persistence. The viral genome load in the spinal cord was also significantly reduced in G1100D mutant virus-infected mice compared to that of DA transcript-derived parent virus-infected mice (Fig. 4A; P = 0.0286, n = 4 in each group). In another experiment, few animals survived and were available for histology; however, the two G1100D mutant virus-infected mice examined had far fewer spinal cord quadrants positive for white matter inflammation (7.16 and 7.88%) compared to two DA transcript-derived parent virus-infected mice (66.6 and 93.33%). These results indicate that sialic acid binding is required for CNS persistence leading to inflammatory demyelinating lesions.

Abrogation of CNS persistence and demyelinating disease correlates with significantly reduced infection of murine macrophage but not microglial and oligodendrocyte cultures. Since TMEV persists in CNS macrophages and glial cells (5, 6, 30, 43, 45) and the adapted virus showed a dramatically reduced ability to persist, we analyzed infection of the following relevant murine cells: M1-D macrophages, N20 oligodendrocytes, primary peritoneal macrophages, EOC20 microglia, and murine C8-D1A astrocytes. DA parental virus infected both M1-D and peritoneal macrophages and the oligodendrocyte cell line efficiently, but there was a significant reduction in CPE (P < 0.001) and in numbers of virus antigen-containing cells (P < 0.002) in macrophages but not in oligodendrocytes infected with the adapted virus (Fig. 5). There was infection of all EOC20 microglial cells by both viruses; however, the DA parental virus produced significantly more CPE than the adapted virus (P < 0.05). In contrast, murine astrocyte C8-D1A cells were relatively resistant to infection by both viruses (not shown). Thus, infection of macrophages but not microglia and oligodendroglia by DA virus also depends on use of the sialic acid coreceptor.

View larger version (17K): [in this window] [in a new window]

FIG. 5. Cell death (CPE) and virus antigen in murine M1-D macrophages (24 h p.i.), peritoneal macrophages (48 h p.i.), EOC20 microglia (72 h p.i.), and N20 oligodendrocytes (24 h p.i.). A significant reduction in CPE (P < 0.001) and numbers of virus antigen-containing cells (P < 0.002) was observed in M1-D and primary peritoneal macrophages but not oligodendrocytes infected with adapted virus () compared to parent virus (). Although all EOC20 microglial cells contained virus antigen after infection with both viruses, there was significantly more CPE after parental virus infection (P < 0.05).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Low-neurovirulence TMEV strains absolutely require the use of the sialic acid coreceptor to infect mammalian cells (Fig. 1). The crystal structure of DA virus in complex with the sialic acid mimic SLL demonstrated that four capsid residues contact sialic acid through noncovalent hydrogen bonds; three of the residues are on VP2 puff B (50). Site-specific mutation of the sialic acid-binding residues Q2161 and G2174 on VP2 puff B of an infectious clone of another low-neurovirulence TMEV, BeAn virus, resulted in only one round of virus replication after electroporation, indicating that these mutations were lethal due to the loss of virus binding and infection (25). In the present study, a sialic acid-independent variant was generated by adapting DA virus to sialic acid-deficient Lec-2 cells (Fig. 2). The first of three mutations, G1100D, in the adapted virus capsid was on VP1 loop II, which interacts with VP2 puff B through shared noncovalent hydrogen bonds (17, 31). It seems likely that the G1100D mutation altered the conformation of the sialic acid binding site on VP2 puff B and may have had a more global impact on virion structure, such as providing greater accessibility to the protein entry receptor to the pit. Since the adapted virus no longer used sialic acid, it used another coreceptor or bound directly to a still-undefined protein entry receptor.

Fujinami and coworkers (49, 51) reported that mutation of VP1 loop II residue T1101 attenuated persistence and demyelinating disease in mice. Although infected mice had reduced CNS virus titers during the persistent stage of infection (>3 weeks p.i.), one of the mutants (T1101A) had reduced acute CNS virus titers. Acute virus titers at only one time point in mice infected with the other mutant virus (T1101I) were similar to those of wild-type virus-infected mice, and sialic acid binding of these mutant viruses was not determined. Jnaoui et al. (22) reported partial loss of sialic acid binding by DA virus adapted to CHO cells and decreased CNS persistence of a recombinant DA virus constructed with a 2.3-kb segment containing two VP1 loop II mutations (G1099S and G1100D) from the adapted virus, but neither acute virulence nor the sialic acid binding phenotype of this recombinant was reported (22). Note that it is important to exclude a virion mutation or mutations that attenuate acute CNS virulence, since this would clearly diminish subsequent CNS persistence. Our studies (Fig. 3) revealed no reduction in acute CNS virulence. In fact, the G1100D mutant virus was more encephalitic than its parent. Thus, loss of sialic acid binding potentiated acute CNS infection by the G1100D mutant, yet the viral genome load during persistence in mice was dramatically reduced (Fig. 4). Sialic acid binding has been described as an acute virulence factor for several enteric viruses; however, the effect on virulence has varied. Transmissible gastroenteritis virus and reovirus type 3, which bind to sialic acid, have increased enteropathogenicity and more rapid spread from intestine to distant organ systems, respectively, than nonbinding variants (2, 24). Binding to sialic acid-rich mucins in the intestine was postulated to stabilize and/or protect transmissible gastroenteritis virus (24). In contrast, mouse polyomavirus that binds to branched-chain as well as straight-chain sites on N-acetylneuraminic acid was less potent in inducing tumors in suckling mice than polyomavirus that binds only the straight-chain site (3, 4). Bauer et al. (4) postulated that binding to the branched-chain site may be equivalent to binding to psuedoreceptors, attenuating tumorigenesis (4). There are no reports on the effect of loss or alteration of sialic acid binding on viral persistence.

At the peak of the acute infection, virus antigen in DA adapted and parental virus-infected mice colocalized with CD11b⁺ cells in microglial nodules in the anterior gray matter (Fig. 3E). Presumably, these cells were infected (see below); however, phagocytosis of viral debris from lysed neurons is also a possibility. In human poliomyelitis, these cells represent microglia attracted to the site of infected anterior horn neurons. This also appears to be the case in the acute phase of low-neurovirulence TMEV infection in mice (mouse poliomyelitis). The fact that the DA adapted virus appears to infect microglia early may not be inconsistent with a role for sialic acid binding in TMEV persistence for the following reasons. (i) Infected microglia were not observed in the white matter. (ii) Unique functions have been attributed to macrophages derived from microglia versus those originating from infiltrating monocytes, indicating that these cells are different (18). (iii) The majority of macrophages in chronic CNS inflammation emanate from infiltrating monocytes rather than microglia (27). (iv) The origin of infected macrophages in TMEV-induced demyelinating lesions remains to be determined. It is possible, based on the present findings, that TMEV persists only in macrophages that are infiltrating and not resident derived.

Several possible mechanisms might explain TMEV persistence after sialic acid-dependent infection: (i) sialic acid allows TMEV binding and infection of macrophages, which is required for persistence; (ii) access of TMEV-specific antibodies and T cells to TMEV bound to the sialic acid layer on the surface of most cells is sterically hindered; and (iii) sialic acid binding enables axonal transport of TMEV from anterior horn cells in gray matter to white matter, the site of myelinated axons (12). Low-neurovirulence TMEV strains preferentially replicate in CNS macrophages/microglia during persistence, although oligodendrocytes and astrocytes are also infected (9, 30, 39). Experiments in which peripheral macrophages were depleted with mannosylated liposomes revealed a loss of DA virus persistence in 70% of mice (39), directly implicating a role for macrophages in TMEV persistence, suggesting a model of TMEV persistence involving macrophage-to-macrophage spread of virus with restriction of virus replication in macrophages that undergo apoptosis (21). Host antiviral immune responses also restrict persistence by limiting dissemination of TMEV to other cells, including oligodendrocytes, where the infection is highly cytolytic and productive. Note that our DA adapted virus was inefficient in infecting murine macrophages but not oligodendrocytes in culture (Fig. 5) .

Persistence of lytic RNA viruses requires active cell-to-cell spread in the presence of host immunity to perpetuate infection (29). Most studies of persistent viruses have focused on mechanisms by which they evade host defenses, whereas virus factors involved in persistence have been less well studied. Interestingly, recent in vitro studies point to the importance of receptor usage in virus persistence. For example, the mechanism of persistence of poliovirus 1 infection in human neuroblastoma IMR-32 cells involves selection of mutant poliovirus receptors and conformational modifications of the capsid following virus adsorption and penetration (16, 38). Vlaycheva and Chambers (48) found that persistence of yellow fever virus in NB41A3 cells was associated with a mutation (D360G) in the receptor binding domain of the E protein that impaired virus entry into cells. For influenza C virus infection in MDCK cells, a role for cell receptor concentration in regulation of long-term persistence was reported (33). In these cases, virus attenuation along with selection of more resistant cell variants was believed to underlie virus persistence. In light of the potential role of virus-receptor interactions in viral persistence and relevance of TMEV persistence in mice as an animal model for MS, it will be important to define precisely how TMEV-sialic acid binding leads to persistent infection.

 
We thank Pat Kallio and Brian Schlitt for technical assistance and Mary Lou Jelachich for helpful discussions.

This work was supported by NIH grant NS21913.

 
* Corresponding author. Mailing address: Department of Neurology, Evanston Hospital, 2650 Ridge Ave., Evanston, IL 60201. Phone: (847) 570-2168. Fax: (847) 570-1568. E-mail: hllipton{at}merle.acns.nwu.edu.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Ahmed, R., L. A. Morrison, and D. M. Knipe. 1996. Persistence of viruses, p. 219-250. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott-Raven, Philadelphia, Pa.
2
2. Barton, E. S., D. H. Ebert, J. C. Forrest, J. L. Connolly, T. Valyi-Nagy, J. D. Wetzel, and T. S. Dermody. 2003. Utilization of sialic acid as a co-receptor is required for reovirus-induced biliary disease. J. Clin. Investig. 111:1823-1833.[CrossRef][Medline]
3
3. Bauer, P. H., R. T. Bronson, S. C. Fung, R. Freund, T. Stehle, S. C. Harrison, and T. L. Benjamin. 1995. Genetic and structural analysis of a virulence determinant in polyomavirus VP1. J. Virol. 69:7925-7931.[Abstract]
4
4. Bauer, P. H., C. Cui, T. Stehle, S. C. Harrison, J. A. DeCaprio, and T. L. Benjamin. 1999. Discrimination between sialic acid-containing receptors and pseudoreceptors regulates polyomavirus spread in the mouse. J. Virol. 73:5826-5832.[Abstract/Free Full Text]
5
5. Blakemore, W. F., C. J. Welsh, P. Tonks, and A. A. Nash. 1988. Observations on demyelinating lesions induced by Theiler's virus in CBA mice. Acta Neuropathol. 76:581-589.[CrossRef][Medline]
6
6. Brahic, M., A. T. Haase, and E. Cash. 1984. Simultaneous in situ detection of viral RNA and antigens. Proc. Natl. Acad. Sci. USA 81:5445-5448.[Abstract/Free Full Text]
7
7. Calenoff, M. A., K. S. Faaberg, and H. L. Lipton. 1990. Genomic regions of neurovirulence and attenuation in Theiler's murine encephalomyelitis. Proc. Natl. Acad. Sci. USA 87:978-982.[Abstract/Free Full Text]
8
8. Clatch, R. J., H. L. Lipton, and S. D. Miller. 1986. Characterization of Theiler's murine encephalomyelitis virus (TMEV)-specific delayed-type hypersensitivity responses in TMEV-induced demyelinating disease: correlation with clinical signs. J. Immunol. 136:920-926.[Abstract]
9
9. Clatch, R. J., S. D. Miller, R. Metzner, M. C. Dal Canto, and H. L. Lipton. 1990. Monocytes/macrophages isolated from the mouse central nervous system contain infectious Theiler's murine encephalomyelitis virus (TMEV). Virology 176:244-254.[CrossRef][Medline]
10
10. Denizot, F., and R. Lang. 1986. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J. Immunol. Methods 89:271-277.[CrossRef][Medline]
11
11. Deutscher, S. L., N. Nuwayhid, P. Stanley, and E. B. Briles. 1984. Translocation across Golgi vesicle membranes: a CHO glycosylation mutant deficient in CMP-sialic acid transport. Cell. 39:295-299.[CrossRef][Medline]
12
12. Fabian, R. H., and J. D. Coulter. 1985. Transneuronal transport of lectins. Brain Res. 344:41-48.[CrossRef][Medline]
13
13. Foster, L. M., T. Phan, A. N. Verity, D. Bredesen, and A. T. Campagnoni. 1993. Generation and analysis of normal and shiverer temperature-sensitive immortalized cell lines exhibiting phenotypic characteristics of oligodendrocytes at several stages of differentiation. Dev. Neurosci. 15:100-119.[Medline]
14
14. Fotiadis, C., D. R. Kilpatrick, and H. L. Lipton. 1991. Comparison of the binding characteristics to BHK-21 cells of viruses representing the two Theiler's virus neurovirulence groups. Virology 182:365-370.[CrossRef][Medline]
15
15. Gerety, S. J., K. M. Rundell, M. C. Dal Canto, and S. D. Miller. 1994. Class II-restricted T cell responses in Theiler's murine encephalomyelitis virus-induced demyelinating disease. VI. Potentiation of demyelination with and characterization of an immunopathologic CD4⁺ T cell line specific for an immunodominant VP2 epitope. J. Immunol. 152:919-929.[Abstract]
16
16. Gosselin, A.-S., Y. Simonin, F. Guivel-Benhassine, V. Rincheval, J.-L. Vayssière, B. Mignotte, F. Colbère-Garapin, T. Couderc, and B. Blondel. 2003. Poliovirus-induced apoptosis is reduced in cells expressing a mutant CD155 selected during persistent poliovirus infection in neuroblastoma cells. J. Virol. 77:790-798.
17
17. Grant, R. A., D. J. Filman, R. S. Fujinami, J. P. Icenogle, and J. M. Hogle. 1992. Three-dimensional structure of Theiler's virus. Proc. Natl. Acad. Sci. USA 89:2061-2065.[Abstract/Free Full Text]
18
18. Hickey, W. F. 2001. Basic principles of immunological surveillance of the normal central nervous system. Glia 36:118-124.[CrossRef][Medline]
19
19. Jarousse, N., R. A. Grant, J. M. Hogle, L. Zhang, A. Senkowski, R. P. Roos, T. Michiels, M. Brahic, and A. McAllister. 1994. A single amino acid change determines persistence of a chimeric Theiler's virus. J. Virol. 68:3364-3368.[Abstract/Free Full Text]
20
20. Jelachich, M. L., C. Bramlage, and H. L. Lipton. 1999. Differentiation of M1 myeloid precursor cells into macrophages results in binding and infection by Theiler's murine encephalomyelitis virus and apoptosis. J. Virol. 73:3227-3235.[Abstract/Free Full Text]
21
21. Jelachich, M. L., and H. L. Lipton. 2001. Theiler's murine encephalomyelitis virus induces apoptosis in gamma interferon activated M1 differentiated myelomonocytic cells through a mechanism involving tumor necrosis factor alpha (TNF-) and TNF--related apoptosis-inducing ligand. J. Virol. 75:5930-5938.[Abstract/Free Full Text]
22
22. Jnaoui, K., M. Minet, and T. Michiels. 2002. Mutations that affect the tropism of DA and GDVII strains of Theiler's virus in vitro influence sialic acid binding and pathogenesis. J. Virol. 76:8138-8147.[Abstract/Free Full Text]
23
23. Kim, S., U. Boege, S. Krishnaswamy, I. Minor, T. J. Smith, M. Luo, D. G. Scraba, and M. G. Rossmann. 1990. Conformational variability of a picornavirus capsid: pH-dependent structural changes of Mengo virus related to its host receptor attachment site and disassembly. Virology 175:176-190.[CrossRef][Medline]
24
24. Krempl, C., M.-L. Ballesteros, G. Zimmer, L. Enjuanes, H.-D. Klenk, and G. Herrler. 2000. Characterization of the sialic acid binding activity of transmissible gastroenteritis coronavirus by analysis of haemagglutination-deficient mutants. J. Gen. Virol. 81:489-496.[Abstract/Free Full Text]
25
25. Kumar, A. S. M., P. Kallio, M. Luo, and H. L. Lipton. 2003. Amino acid substitutions in VP2 residues contacting sialic acid in low-neurovirulence BeAn virus dramatically reduce viral binding and spread of infection. J. Virol. 77:2709-2716.[Abstract/Free Full Text]
26
26. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382.[Medline]
27
27. Lassmann, H., M. Schmied, K. Vass, and W. F. Hickey. 1993. Bone marrow derived elements and resident microglia in brain inflammation. Glia 7:19-24.[CrossRef][Medline]
28
28. Lipton, H. L. 1975. Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect. Immun. 11:1147-1155.[Abstract/Free Full Text]
29
29. Lipton, H. L., and D. H. Gilden. 1996. Viral diseases of the central nervous system: persistent infections, p. 853-867. In N. Nathanson (ed.), Viral pathogenesis. Lippincott-Raven, Philadelphia, Pa.
30
30. Lipton, H. L., G. Twaddle, and M. L. Jelachich. 1995. The predominant virus antigen burden is present in macrophages in Theiler's murine encephalomyelitis virus-induced demyelinating disease. J. Virol. 69:2525-2533.[Abstract]
31
31. Luo, M., C. He, K. S. Toth, C. X. Zhang, and H. L. Lipton. 1992. Three-dimensional structure of Theiler's murine encephalomyelitis virus (BeAn strain). Proc. Natl. Acad. Sci. USA 89:2409-2413.[Abstract/Free Full Text]
32
32. Markovic-Plese, S., and H. F. McFarland. 2001. Immunopathogenesis of the multiple sclerosis lesion. Curr. Neurol. Neurosci. Rep. 1:257-262.[Medline]
33
33. Marschall, M., H. Meier-Ewert, G. Herrler, G. Zimmer, and H. F. Maassab. 1997. The cell receptor level is reduced during persistent infection with influenza C virus. Arch. Virol. 142:1155-1164.[CrossRef][Medline]
34
34. McAllister, A., F. Tangy, C. Aubert, and M. Brahic. 1989. Molecular cloning of the complete genome of Theiler's virus, strain DA, and production of infectious transcripts. Microb. Pathog. 7:381-388.[CrossRef][Medline]
35
35. McAllister, A., F. Tangy, C. Aubert, and M. Brahic. 1990. Genetic mapping of the ability of Theiler's virus to persist and demyelinate. J. Virol. 64:4252-4257. (Erratum, 67:2427, 1993.)
36
36. Michiels, T., N. Jarousse, and M. Brahic. 1995. Analysis of the leader and capsid coding regions of persistent and neurovirulent strains of Theiler's virus. Virology 214:550-558.[CrossRef][Medline]
37
37. Miller, S. D., C. VanderLugt, W. S. Begolka, W. Pao, R. L. Yauch, K. L. Neville, Y. Katz-Levy, A. Carrizosa, and B. S. Kim. 1997. Persistent infection with Theiler's virus leads to CNS autoimmunity via epitope spreading. Nat. Med. 3:1113-1136.
38
38. Pavio, N., T. Couderc, S. Girard, J.-Y. Sgro, B. Blondel, and F. Colbere-Garapin. 2000. Expression of mutated poliovirus receptors in human neuroblastoma cells persistently infected with poliovirus. Virology 274:331-342.[CrossRef][Medline]
39
39. Pena-Rossi, C., M. Delcroix, I. Huitinga, A. McAllister, N. van Rooijen, E. Claassen, and M. Brahic. 1997. Role of macrophages during Theiler's virus infection. J. Virol. 71:3336-3340.[Abstract]
40
40. Reddi, H. V., and H. L. Lipton. 2002. Heparan sulfate mediates infection of high-neurovirulence Theiler's viruses. J. Virol. 76:8400-8407.[Abstract/Free Full Text]
41
41. Reed, L. J., and H. A. Muench. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27:493-497.
42
42. Rodriguez, M., W. P. Lafuse, J. Leibowitz, and C. S. David. 1986. Partial suppression of Theiler's virus-induced demyelination in vivo by administration of monoclonal antibodies to immune-response gene products (Ia antigens). Neurology 36:964-970.[Abstract/Free Full Text]
43
43. Rodriguez, M., J. L. Leibowitz, and P. W. Lampert. 1983. Persistent infection of oligodendrocytes in Theiler's virus-induced encephalomyelitis. Ann. Neurol. 13:426-433.[CrossRef][Medline]
44
44. Shah, A. H., and H. L. Lipton. 2002. Low-neurovirulence Theiler's viruses use sialic acid moieties on N-linked oligosaccharide structures for attachment. Virology 304:443-450.[CrossRef][Medline]
45
45. Simas, J. P., and J. K. Fazakerley. 1996. The course of disease and persistence of virus in the central nervous system varies between individual CBA mice infected with the BeAn strain of Theiler's murine encephalomyelitis virus. J. Gen. Virol. 77:2701-2711.[Abstract/Free Full Text]
46
46. Steinman, L., R. Martin, C. Bernard, P. Conlon, and J. R. Oksenberg. 2002. Multiple sclerosis: deeper understanding of its pathogenesis reveals new targets for therapy. Annu. Rev. Neurosci. 25:491-505.[CrossRef][Medline]
47
47. Trottier, M., B. P. Schlitt, and H. L. Lipton. 2002. Enhanced detection of Theiler's virus RNA copy equivalents in the mouse central nervous system by real-time RT-PCR. J. Virol. Methods 103:89-99.[CrossRef][Medline]
48
48. Vlaycheva, L. A., and T. J. Chambers. 2002. Neuroblastoma cell-adapted yellow fever 17D virus: characterization of a viral variant associated with persistent infection and decreased virus spread. J. Virol. 76:6172-6184.[Abstract/Free Full Text]
49
49. Wada, Y., M. L. Pierce, and R. S. Fujinami. 1994. Importance of amino acid 101 within capsid protein VP1 for modulation of Theiler's virus-induced disease. J. Virol. 68:1219-1223.[Abstract/Free Full Text]
50
50. Zhou, L., Y. Luo, Y. Wu, J. Tsao, and M. Luo. 2000. Sialylation of the host receptor may modulate entry of demyelinating persistent Theiler's virus. J. Virol. 74:1477-1485.[Abstract/Free Full Text]
51
51. Zurbriggen, A., C. Thomas, M. Yamada, R. P. Roos, and R. S. Fujinami. 1991. Direct evidence of a role for amino acid 101 of VP-1 in central nervous system disease in Theiler's murine encephalomyelitis virus infection. J. Virol. 65:1929-1937.[Abstract/Free Full Text]

---

Journal of Virology, August 2004, p. 8860-8867, Vol. 78, No. 16
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.16.8860-8867.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Kumar, A. S. M. Articles by Lipton, H. L. Search for Related Content PubMed PubMed Citation Articles by Kumar, A. S. M. Articles by Lipton, H. L.