Internalization of Pseudorabies Virus Glycoprotein B Is Mediated by an Interaction between the YQRL Motif in Its Cytoplasmic Domain and the Clathrin-Associated AP-2 Adaptor Complex

The cytoplasmic domain of pseudorabies virus (PRV) glycoproteinB (gB) contains three putative internalization motifs. Previously,we demonstrated that the tyrosine-based YQRL motif at positions902 to 905, but not the YMSI motif at positions 864 to 867 orthe LL doublet at positions 887 and 888, is required for correctfunctioning of gB during antibody-mediated internalization ofPRV cell surface-bound glycoproteins. In the present study,we demonstrate that the YQRL motif is also crucial to allowspontaneous internalization of PRV gB, and thus, that spontaneousand antibody-mediated internalizations of PRV gB occur throughclosely related mechanisms. Furthermore, we found that PRV gBcolocalizes with the cellular clathrin-associated AP-2 adaptorcomplex and that this colocalization depends on the YQRL motif.In addition, by coimmunoprecipitation assays, we found thatduring both spontaneous and antibody-dependent internalization,PRV gB physically interacts with AP-2, and that efficient interactionbetween gB and AP-2 required an intact YQRL motif. Collectively,these findings demonstrate for the first time that during internalizationof an alphaherpesvirus envelope protein, i.e., PRV gB, a specificamino acid sequence in the cytoplasmic tail of the protein interactswith AP-2 and may constitute a common AP-2-mediated mechanismof internalization of alphaherpesvirus envelope proteins.

INTRODUCTION

Top

Introduction

Pseudorabies virus (PRV), a swine alphaherpesvirus closely relatedto the human pathogens herpes simplex virus (HSV) and varicella-zostervirus (VZV), is the causative agent of Aujeszky's disease (4,24). Its genome encodes at least 11 glycoproteins, which havehomologs in other herpesviruses (24). In PRV-infected cells,newly synthesized glycoproteins travel from the endoplasmicreticulum via the Golgi to the plasma membrane (25). These glycoproteinsplay important roles in the viral life cycle, as well as inthe pathogenesis of PRV infections (9, 29).

Interestingly, several alphaherpesvirus-encoded cell surface-associatedenvelope glycoproteins have been reported to be internalized,either spontaneously or upon binding of antigen-specific antibodies(12, 13, 17, 32, 35, 36, 44). The biological function of spontaneousinternalization in the virus life cycle is not yet fully understood,although some hypothetical roles have been proposed (reviewedin reference 9), such as the possible involvement of internalizationin delivering the viral cell surface proteins to a specificcompartment, where viral envelopment takes place; in redirectingviral proteins to specific membrane surfaces (such as the apical,lateral, or basal surfaces of polarized cells); or in immuneevasion. Antibody-dependent internalization of viral cell surfaceproteins may also be implicated in immune evasion, since ithas been shown to decrease the efficiency of antibody-dependentlysis of PRV-infected cells (49).

Recently, several groups reported on the amino acid sequencemotifs involved in the internalization of different alphaherpesvirusenvelope glycoproteins. Two types of motifs, located in thecytoplasmic tails of these viral proteins, have been shown tobe of predominant importance: tyrosine-based YXX ${phi}$ -type motifs(where Y stands for tyrosine, X stands for any amino acid, and ${phi}$ stands for any bulky hydrophobic amino acid) and LL (dileucine)motifs. Spontaneous internalization of PRV glycoprotein E (gE)requires an intact YTSL motif (where T stands for threonineand S stands for serine) in its cytoplasmic tail (45), and internalizationof PRV gB requires the C-terminal 29 amino acids of the gB cytoplasmicdomain, which contain an LL motif and a YQRL motif (where Qstands for glutamine and R stands for arginine) (32). In a previousstudy, it was shown that the gB membrane-distal YQRL motif atpositions 902 to 905, but not the membrane-proximal YMSI motifat positions 864 to 867 (where M stands for methionine and Istands for isoleucine) or the LL doublet at positions 887 and888, is critical for efficient antibody-mediated internalizationof PRV cell surface proteins (13). In agreement with these findings,mutation of the HSV gB membrane-distal YSPL motif (where P standsfor proline), but not mutation of the membrane-proximal YMALmotif (where A stands for alanine) or the LL motif, was foundto abrogate internalization of HSV gB (11). The internalizationof some VZV-encoded glycoproteins has also been shown to dependon either a YXX ${phi}$ motif or an LL motif. Indeed, internalizationof VZV gB, gE, and gH requires, respectively, a YSRV (whereV stands for valine), a YAGL (where G stands for glycine), ora YNKI (where N stands for asparagine and K stands for lysine)motif located in the respective cytoplasmic domains, while internalizationof VZV gI is dependent on an LL motif (3, 17, 35, 36, 37). Thus,the internalization of many alphaherpesvirus envelope proteinsis mediated by related tyrosine-based YXX ${phi}$ -type motifs or LLmotifs within their cytoplasmic tails. Similar YXX ${phi}$ and LL signals,together with acidic amino acid clusters, are known to be mediatorsof clathrin-mediated endocytosis of cellular receptors (7, 22,46, 47, 50). Clathrin-mediated endocytosis of cellular receptorsis initiated by invagination of certain regions of the plasmamembrane, so-called clathrin-coated pits, which are subsequentlypinched off from the plasma membrane to form clathrin-coatedvesicles (16, 20, 40). Crucial roles in these initial stepsof the endocytosis process are attributed to clathrin triskelionsand the clathrin-associated AP-2 adaptor complex, which is composedof two 100- to 110-kDa large chains ( ${alpha}$ and ß2), a 50-kDamedium chain (µ2), and a 17-kDa small chain ( ${sigma}$ 2) (2, 18,38, 41). Several studies have shown that the AP-2 adaptor complexrecognizes and binds (via its medium µ subunit) tyrosine-basedor dileucine-type internalization sequences in the cellularreceptor on the one hand and to clathrin triskelions on theother hand, forming a physical link between the cellular receptorand clathrin triskelions as a first step in the formation ofreceptor-containing clathrin-coated endocytosis vesicles (8,10, 22, 23, 40, 43).

It has been demonstrated that during the early steps of someinternalization processes, alphaherpesvirus glycoproteins colocalizewith clathrin triskelions (17, 35, 48). Because of their dependenceon clathrin- and tyrosine-based motifs or dileucine motifs,alphaherpesviruses seem to initiate the internalization of envelopeproteins via a mechanism similar to that of clathrin-mediatedendocytosis of cellular receptors. However, no information isavailable on whether, as in clathrin-mediated endocytosis ofcellular receptors, internalization of alphaherpesvirus envelopeproteins relies on an interaction with the cellular clathrin-associatedAP-2 adaptor complex.

Therefore, in the present study, we wanted to investigate (i)whether PRV gB colocalizes and interacts with the clathrin-associatedAP-2 adaptor complex during spontaneous and antibody-mediatedinternalization processes and, if so, (ii) whether the YQRLmotif is required for interaction of PRV gB with AP-2.

MATERIALS AND METHODS

Top

Materials and Methods

Virus strains. The wild-type PRV Becker strain and isogenic PRV Becker gB mutants,carrying tyrosine (Y)-to-alanine (A) substitutions in the cytoplasmictyrosine-based motifs and leucine (L)-to-arginine (R) substitutionsin the LL motif in gB (PRV Be, PRV Y864A, PRV Y902A, PRV LL887RR,PRV Y864A/Y902A, and PRV Y864A/Y902A/LL887RR), were describedearlier (13).

Cell culture and infection. Porcine kidney PK15 cells were cultivated in Eagle's minimalessential medium (MEM) supplemented with 5% fetal calf serum,glutamine (0.3 mg/ml), and antibiotics (100 U of penicillin/ml,0.1 mg of streptomycin/ml, and 0.1 mg of kanamycin/ml). Forinfection experiments, monolayers of PK15 cells grown on glasscoverslips were inoculated with the appropriate PRV strainsat a multiplicity of infection (MOI) of 10.

Construction of mammalian expression vectors and transfection assay. Plasmids pHF3, pHF16, and pHF17, encoding wild-type Be gB andpoint-mutated Y864A and Y902A gB, respectively, were previouslydescribed (13). To construct plasmid pHF50, encoding a gB mutantthat lacks a cytoplasmic domain, a 750-bp SalI-SphI fragmentof pHF3 was cloned in pALTER-1 (Promega, Madison, Wis.), creatingpHF39. Subsequently, oligonucleotide mutagenesis was performedon pHF39 to replace serine 882 (S882) by a stop codon. The oligonucleotideused (5' CCTACCGGCACATCTAGCGCTTGCGCCGCAACCCC 3') introducedan additional Eco47III site, which facilitated screening ofthe resulting plasmid, pHF47. The mutated 750-bp DNA fragmentof SalI-SphI-digested pHF47 was then subcloned in SalI-SphI-digestedpHF3, creating pHF50. To construct mammalian expression vectors,BamHI-EcoRV restriction fragments of pHF3, pHF16, pHF17, andpHF50 were subcloned into the cytomegalovirus promoter-basedeucaryotic expression vector pcDNA3.1D/V5-His-TOPO (Invitrogen,Groningen, The Netherlands). The resulting expression vectors,pGVM3, pGVM16, pGVM17, and pGVM50, encode wild-type gB, Y864AgB, Y902A gB, and gB truncated, respectively. For transfectionexperiments, 80 to 90% confluent PK15 cells grown on glass coverslipswere transiently transfected with pGVM3, pGVM16, pGVM17, orpGVM 50 by use of Lipofectamine 2000 reagent (Invitrogen) accordingto the manufacturer's instructions.

Antibodies and reagents. Fluorescein isothiocyanate (FITC)-conjugated mouse monoclonalimmunoglobulin G2a (IgG2a) antibodies directed against PRV gB(1C11) were produced at our laboratory, as previously described(28). Monoclonal anti- ${alpha}$ -adaptin antibodies (recognizing the ${alpha}$ subunit of AP-2), clone AP6 (IgG1), and clone AC1-M11 (IgG2a)were purchased from 10P's (Zandhoven, Belgium). Biotinylatedrabbit anti-mouse IgG1-specific antibodies were from Zymed LaboratoriesInc. (San Francisco, Calif.). Streptavidin-Texas Red was obtainedfrom Molecular Probes (Eugene, Oreg.). Biotinylated sheep anti-mouseIgG antibodies and streptavidin-biotin-horseradish peroxidasecomplex and polyvinylidene difluoride membranes were purchasedfrom Amersham Pharmacia Biotech (Uppsala, Sweden). Goat anti-mouseagarose beads were from Sigma (St. Louis, Mo.).

Antibody-independent internalization assay. The amounts of PRV gB on the surfaces of PRV-infected PK15 cells,determined by immunofluorescent staining, were used as a measurefor spontaneous internalization of gB: low levels correspondto efficient internalization, and high levels correspond toinefficient internalization, essentially as previously described(32). Briefly, at the appropriate time points, paraformaldehyde-fixed,nonpermeabilized cells were stained for cell surface-localized(noninternalized) gB by use of the FITC-labeled primary antibody1C11. The stained cells were mounted on microscope slides usingglycerin-DABCO and were analyzed by confocal microscopy (TCSSP2 laser scanning spectral confocal system; Leica MicrosystemsGmbH, Heidelberg, Germany).

Antibody-dependent internalization assay. The antibody-dependent internalization assay was essentiallydone as described previously with some modifications (13, 48).At the appropriate time points postinoculation (p.i.) with theappropriate PRV strains or 24 h posttransfection with the appropriategB expression vectors, PK15 cells were cooled on ice for 15min, rinsed two times with ice-cold phosphate-buffered saline(PBS), and incubated on ice for 1 h with the FITC-labeled anti-gBmonoclonal antibody 1C11. After two washings with ice-cold PBS,the cells were shifted for 0 or 90 min (infected cells) or 60min (transfected cells), respectively, to 37°C by the additionof prewarmed MEM and placed in a 37°C incubator. Afterwards,the cells were paraformaldehyde fixed. The stained cells weremounted, and subcellular localization of gB was analyzed byconfocal microscopy as described above.

Double immunofluorescence stainings of PRV gB and ${alpha}$ -adaptin. After an antibody-dependent internalization assay was performedas described above, infected or transfected PK15 cells wereparaformaldehyde fixed, Triton X-100 permeabilized, and costainedfor ${alpha}$ -adaptin. To stain ${alpha}$ -adaptin, cells were incubated (1 h at37°C) with anti- ${alpha}$ -adaptin IgG1 antibodies (clone AP-6) diluted1/200 in PBS plus 0.3% gelatin. Afterwards, the cells were washedtwice in Tris-buffered saline (20 mM Tris-HCl and 150 mM NaCl)-4.5%(wt/vol) sucrose-2% heat-inactivated goat serum (TBS-SG). Thecells were then incubated with biotinylated rabbit anti-mouseIgG1-specific antibodies diluted 1/100 in PBS-0.3% gelatin (1h at 37°C) and washed twice in TBS-SG. Finally, the cellswere incubated (1 h at 37°C) with streptavidin-Texas Reddiluted 1/50 in PBS-0.3% gelatin, washed twice in TBS-SG, mounted,and analyzed by confocal microscopy.

Coimmunoprecipitation experiments. At 6 h (spontaneous internalization) and 10 h (antibody-dependentinternalization) p.i., monolayers of PRV-infected PK15 cellswere washed twice in MEM (37°C), incubated for 15 min at37°C with monoclonal anti-gB antibodies diluted in MEM (onlyfor antibody-dependent internalization), rinsed twice in ice-coldPBS, scraped, and lysed for 1 h at 4°C in 750 µl oflysis buffer (1% Triton X-100, 50 mM HEPES, pH 7.4, 150 mM NaCl,10% glycerol, 1 mM EDTA, 1 mM Na₃VO₄, 10 mM NaF, and a mixtureof protease inhibitors). The lysates were precleared by centrifugationat 13,000 x g in a cooled centrifuge and incubated for 90 minat 4°C with monoclonal anti-gB antibodies or with monoclonalanti- ${alpha}$ -adaptin antibodies. Subsequently, gB or ${alpha}$ -adaptin was precipitatedovernight at 4°C using goat anti-mouse agarose beads, washedthree times in PBS, and resuspended in 50 µl of sodiumdodecyl sulfate-polyacrylamide gel electrophoresis loading buffer.Equal amounts of all samples were subjected to sodium dodecylsulfate-polyacrylamide gel electrophoresis and Western blotting.The blotting membranes were then incubated for 1 h with eithermonoclonal anti- ${alpha}$ -adaptin antibodies (clone AC1-M11) or anti-gBmonoclonal antibodies (1C11), washed three times in PBS-0.1%Tween 20, incubated for 1 h with biotinylated sheep anti-mouseIgG, washed again three times in PBS-0.1% Tween 20, and finallyincubated with a streptavidin-biotin-horseradish peroxidasecomplex. Immunoreactive bands, corresponding to gB or ${alpha}$ -adaptin,were revealed with an ECL Western blot detection kit from AmershamPharmacia Biotech according to the manufacturer's instructions.

RESULTS

Top

Results

Efficient spontaneous and antibody-mediated internalizations of PRV gB both depend on an intact YQRL motif in the cytoplasmic tail of gB. PRV gB has been reported to undergo spontaneous antibody-independentinternalization during the early phases of a PRV infection (<6h p.i.) in PK 15 cells and in rabbit kidney RK13 cells transfectedwith PRV gB (32, 44), which is mediated by a region of the gBcytoplasmic tail that contains two potential internalizationmotifs: an LL doublet and a YQRL motif (32). In addition, PRVgB has been shown to be implicated in antibody-mediated internalizationof cell surface-bound glycoproteins in PRV-infected monocytes(12), requiring the YQRL motif (13).

First, we examined whether the mechanisms of spontaneous andantibody-mediated internalization of PRV gB are related by investigatingwhether they both occur efficiently in PRV-infected PK15 cellsand, if so, whether they both rely on the YQRL motif. To thisend, PK15 cells were infected at an MOI of 10 either with wild-typePRV (PRV Be) or with an isogenic PRV strain in which the tyrosine(Y) residue of the YQRL motif was replaced by an alanine (A)residue (PRV Y902A). The efficiency of spontaneous internalizationof PRV gB was investigated, essentially as described before(32), by determining the amount of gB at the cell surface. Lowlevels of gB at the cell surface correlate with efficient retrievalof gB from the cell surface. The upper images in Fig. 1A showthat in PRV Be-infected PK15 cells, very few gB molecules weredetected at the cell surface at 6 h p.i., whereas at 10 h p.i.,large amounts of gB were present at the cell surface. In PRVY902A-infected PK15 cells, high levels of gB Y902A were presentat the cell surface at both time points examined. These observationsindicate (i) that wild-type Be gB is efficiently internalizedin an antibody-independent manner during the early stages ofa PRV infection but not at late stages of infection, in agreementwith earlier findings (44), and (ii) that replacement of tyrosine902 by an alanine residue abrogates spontaneous internalizationof PRV gB.

View larger version (59K):
[in this window]
[in a new window]
FIG. 1. Spontaneous (A) and antibody-dependent (B) internalization of PRV gB are both dependent on an intact YQRL motif. Confluent monolayers of PK15 cells were infected at an MOI of 10 with either PRV Be or PRV Y902A. At 6 (left column) and 10 (right column) h p.i., the efficiency of spontaneous internalization was studied by determining the levels of gB remaining at the cell surface (A), whereas antibody-dependent internalization was studied using an internalization assay based on FITC-labeled anti-gB antibodies, as described in Materials and Methods (B). The cells were analyzed by confocal microscopy. Bar, 10 µm.

To determine the efficiency of antibody-mediated internalizationof PRV gB in PK15 cells at 6- and 10 h p.i. with PRV Be or PRVY902A, cells were incubated on ice with the FITC-labeled gB-specificmonoclonal antibody 1C11, washed, shifted for 90 min to 37°Cto allow internalization, and paraformaldehyde fixed. Analysisof the stained cells by confocal microscopy allowed discriminationbetween cell surface-residing and internalized gB. In Fig. 1B,it can be seen that in PRV Be-infected PK15 cells, gB undergoeshighly efficient antibody-mediated internalization at 6 h p.i.and moderately efficient internalization at 10 h p.i. On theother hand, in PRV Y902A-infected cells, no or very little antibody-mediatedinternalization of Y902A gB could be observed at either timepoint. Thus, the tyrosine residue in the YQRL motif is criticalfor antibody-mediated internalization of PRV gB.

Hence, although spontaneous internalization seems to occur onlyduring the early phases of PRV infection, the two PRV gB internalizationprocesses are closely related, since (i) they both occur inPRV-infected PK15 cells and (ii) they both depend on the YQRLmotif in the cytoplasmic tail of gB.

Subcellular localization of ${alpha}$ -adaptin during internalization of PRV gB in infected PK15 cells. The YQRL motif, which is involved in both spontaneous and antibody-dependentinternalization of PRV gB, is highly similar to the tyrosine-basedinternalization motifs involved in clathrin-mediated endocytosisof cellular receptors. To investigate whether the gB cytoplasmicYQRL motif, like its cellular counterparts, initiates internalizationby interacting with the clathrin-associated AP-2 adaptor complex,we determined the subcellular localizations of PRV gB and the ${alpha}$ subunit of the AP-2 adaptor complex ( ${alpha}$ -adaptin) before and afterantibody-mediated induction of gB internalization in PRV Be-and PRV Y902A-infected PK15 cells. As an extra control, we determinedthe subcellular localization of gB in cells infected with aPRV strain (PRV Y864A) that carries a mutation in the tyrosineresidue in the YMSI motif in the cytoplasmic domain of PRV gBthat has been shown not to be involved in internalization (13).Figure 2 shows that after the induction of internalization inPRV-infected cells, many of the wild-type and Y864A gB moleculesare internalized and that the majority of wild-type and Y864AgB molecules, both in internalized vesicles and on the plasmamembrane, colocalize with ${alpha}$ -adaptin (Fig. 2). Furthermore, wefound that Y902A gB is not internalized but that a minorityof the internalization-deficient Y902A gB molecules show colocalizationwith membrane-associated ${alpha}$ -adaptin (Fig. 2). Thus, in PRV-infectedcells, the AP-2 adaptor complex seems to mediate the internalizationof wild-type and Y864A gB but is unable to drive the internalizationof Y902A gB, although somewhat surprisingly, a minority of theinternalization-deficient Y902A gB molecules colocalize with ${alpha}$ -adaptin at the cell surface.

View larger version (63K):
[in this window]
[in a new window]
FIG. 2. Colocalization between gB and ${alpha}$ -adaptin in PRV-infected cells. PK15 cells were infected at an MOI of 10 with either PRV Be, PRV Y864A, or PRV Y902A. All infected cells were processed for an antibody-dependent internalization assay and stained for gB (left column) as described in Materials and Methods. Internalization was allowed to proceed for 0 or 90 min at 37°C. Thereafter, the cells were costained for ${alpha}$ -adaptin (middle column). To this end, the cells were incubated with monoclonal anti- ${alpha}$ -adaptin IgG1 antibodies (clone AP-6), biotinylated rabbit anti-mouse IgG1-specific antibodies, and streptavidin-Texas Red. Merged images (right column), obtained by superposition of the green (gB) and red ( ${alpha}$ -adaptin) stainings, indicate areas of colocalization (yellow) between PRV gB and ${alpha}$ -adaptin. The arrows indicate colocalization between wild-type or Y864A gB and ${alpha}$ -adaptin in cytoplasmic internalization vesicles or at the cell surface, whereas the arrowheads indicate colocalization between Y902 gB and ${alpha}$ -adaptin at the cell surface. Bar, 10 µm.

Subcellular localization of ${alpha}$ -adaptin during internalization of gB in transfected cells. A potential explanation for the somewhat puzzling observationof colocalization of some of the cell surface-localized, internalization-deficientgB molecules and ${alpha}$ -adaptin in PRV Y902A-infected PK15 cells couldperhaps be found in the presence of internalization motifs inthe cytoplasmic tails of some other cell surface-localized PRVglycoproteins, such as gD, gE, or gH, which may be present inclose proximity to the Y902A gB molecules. Alternatively, itcould be that a gB cytoplasmic sequence, different from thetyrosine 902-based YQRL motif, is also involved in the recruitmentof gB Y902A molecules to AP-2-rich regions in the plasma membrane.To investigate these assumptions, and also to test whether AP-2is associated with the internalization of wild-type and Y864AgB in the absence of other PRV proteins, PK15 cells were transientlytransfected with mammalian expression vectors encoding eitherwild-type gB, Y864A gB, Y902A gB, or a truncated gB that lacksthe cytoplasmic domain (gB truncated), and 24 h posttransfection,the cells were subjected to an antibody-mediated internalizationassay as described above. Figure 3 shows that, as in infectedPK15 cells, wild-type and Y864A gB are efficiently internalizedin transfected cells and the cytoplasmic gB-containing internalizationvesicles are coated with ${alpha}$ -adaptin. On the other hand, Y902AgB and gB truncated molecules are not internalized in transfectedcells (Fig. 3) and, importantly, show no or only minimal colocalizationwith ${alpha}$ -adaptin at the cell surface.

View larger version (65K):
[in this window]
[in a new window]
FIG. 3. Colocalization between gB and ${alpha}$ -adaptin in gB-transfected cells. PK15 cells were transiently transfected with either Be gB (pGVM3), Y864A gB (pGVM16), Y902A gB (pGVM17), or gB truncated (pGVM50). At 24 h posttransfection, the cells were incubated with FITC-labeled monoclonal anti-gB antibodies at 4°C for 1 h. Subsequently, the cells were shifted for 60 min to 37°C to allow internalization of gB (right column). Thereafter, the cells were fixed, permeabilized, and costained for ${alpha}$ -adaptin (middle column) by the use of monoclonal anti- ${alpha}$ -adaptin IgG1 antibodies, biotinylated IgG1-specific antibodies, and streptavidin-Texas Red. Merged images (right column), obtained by superposition of the green (gB) and red ( ${alpha}$ -adaptin) stainings, indicate areas of colocalization (yellow) between gB and ${alpha}$ -adaptin. The arrows indicate colocalization between wild-type or Y864A gB and ${alpha}$ -adaptin in cytoplasmic internalization vesicles. Bar, 10 µm.

Thus, the subcellular localization of gB and ${alpha}$ -adaptin in gB-transfectedPK15 cells indicates that, in the absence of other viral proteins,(i) the YQRL motif in the cytoplasmic domain of gB drives AP-2-associatedinternalization of gB and (ii) very little colocalization canbe observed between Y902A gB and AP-2.

The tyrosine-based YQRL motif in the cytoplasmic tail of gB mediates a physical interaction between the AP-2 adaptor complex and PRV gB. To test whether during internalization PRV gB physically interactswith AP-2 and, if so, whether this occurs via the YQRL motif,we performed coimmunoprecipitation experiments. Figure 4A andB show that immunoprecipitation of gB, during both spontaneousand antibody-mediated internalization of gB in infected PK15cells, results in coimmunoprecipitation of the ${alpha}$ subunit of AP-2,indicating that PRV gB and AP-2 are physically associated duringthese processes. In addition, the figure shows that mutationof the Y902 residue, but not of two other potential AP-2-interactingmotifs (YMSI at position 864 and LL at position 887), severelyimpairs this interaction between gB and AP-2. The LL887RR mutationresulted in a slightly, but consistently, elevated interactionbetween ${alpha}$ -adaptin and gB. The reverse-immunoprecipitation experimentin cells infected with wild-type or Y902A PRV during spontaneousinternalization further confirmed these results: immunoprecipitatesof AP-2 contained high levels of wild-type gB and only verylow levels of Y902A gB (Fig. 4C and D).

View larger version (35K):
[in this window]
[in a new window]
FIG. 4. PRV gB interacts with ${alpha}$ -adaptin, and mutation of the Y902 residue strongly reduces this interaction. (A) Coimmunoprecipitation of ${alpha}$ -adaptin with PRV gB during spontaneous gB internalization. At 6 h p.i., PK15 cells infected with either PRV Be, PRV Y864A, PRV Y902A, PRV LL887RR, PRV Y864A/Y902A, or PRV Y864A/Y902A/LL887RR were lysed and immunoprecipitated with monoclonal anti-gB antibodies, and the immunoprecipitates were analyzed for the presence of gB (upper row) and ${alpha}$ -adaptin (lower row). (B) Coimmunoprecipitation of ${alpha}$ -adaptin with PRV gB during antibody-mediated gB internalization. At 10 h p.i., PK15 cells infected with PRV Be, PRV LL887RR, PRV Y902A, or PRV Y864A/Y902A/LL887RR were incubated for 15 min at 37°C with monoclonal anti-gB antibodies to induce internalization. Subsequently, gB was immunoprecipitated as described for panel A, and the immunoprecipitates were analyzed for gB (upper row) and ${alpha}$ -adaptin (lower row). (C) Coimmunoprecipitation of PRV gB with ${alpha}$ -adaptin during spontaneous internalization of gB. At 6 h p.i., PK15 cells infected with either PRV Be or PRV Y902A were lysed and immunoprecipitated with monoclonal anti- ${alpha}$ -adaptin antibodies, and the immunoprecipitates were analyzed for the presence of ${alpha}$ -adaptin (upper row) and gB (lower row). (D) Densitometric quantification of coimmunoprecipitation (IP) of ${alpha}$ -adaptin with wild-type or Y902A gB (left) and of wild-type or Y902A gB with ${alpha}$ -adaptin (right) (both relative to wild-type gB band intensity).

Taken together, these results demonstrate that (i) during bothspontaneous and antibody-mediated internalization, wild-typePRV gB interacts with AP-2, and (ii) efficient interaction betweenPRV gB and AP-2 is critically dependent on the integrity ofthe YQRL motif.

DISCUSSION

Top

Discussion

In the present study, we found that PRV gB and the cellularclathrin-associated AP-2 adaptor complex colocalize and associatewith each other and that mutation of the tyrosine residue inthe YQRL motif in the cytoplasmic domain of PRV gB abrogatesthis interaction. The importance of the YQRL motif in establishinginteraction between gB and AP-2 most likely explains how thismotif drives spontaneous and antibody-mediated internalizationof gB, as we observed in the present study, and how it drivesefficient internalization of antibody-antigen complexes in PRV-infectedmonocytes (13), a process that protects these cells from efficientantibody-dependent lysis (49).

Although we show here that spontaneous and antibody-mediatedinternalizations of gB are closely related processes, spontaneousendocytosis has been shown to occur solely during the earlyphases of a PRV infection (<6 h p.i.), whereas antibody-mediatedinternalization can be triggered up to later time points ininfection (references 12 and 44 and the present study). Althoughthe viral and/or cellular factors that downregulate spontaneousinternalization are still unknown, it is remarkable that inhibitionof spontaneous internalization correlates with the time at whichmost glycoproteins are abundantly expressed. This may implythat the high expression level of viral glycoproteins like gBoverwhelm the endocytosis machinery and that antibody-mediatedcross-linking of gB is needed to allow efficient internalizationat later time points in infection. In line with this, it hasbeen suggested that ligand-induced multimerization of endocytosismotif-bearing cellular receptors results in a stronger internalizationsignal by increasing the affinity of these receptors for AP-2(51). Inhibition of spontaneous internalization also correlateswith the time at which the virion host shutoff protein (vhs)of PRV, like that of other alphaherpesviruses, shows efficientdownregulation of cellular and viral mRNA levels (5, 44). Perhaps,as has been suggested before (44), this vhs protein may negativelyregulate the amounts of the different endocytosis components(clathrin, AP-2, dynamin, etc.), requiring stronger internalizationsignals to allow efficient internalization of PRV gB. Furthermore,recent data indicate that some PRV cell surface glycoproteins,including gB, may be linked and segregate in lipid raft-likemicrodomains during later stages of infection (14). Althoughrecent studies indicate that at least some raft-associated proteinsmay be internalized via clathrin-dependent pathways, lipid raftsmost likely do not constitute very efficient platforms for clathrin-mediatedinternalization (1, 27, 30, 31, 42), perhaps also requiringstronger internalization signals for gB internalization at latertime points in infection.

We found that, in PRV-infected PK15 cells, mutation of tyrosine902 to an alanine residue (Y902A) abrogated the internalizationof gB. However, somewhat surprisingly, this mutation did notprevent colocalization of a minority of the cell surface-localizedgB molecules and AP-2 in these infected cells. At least twohypotheses can be put forward that may explain this. First,recent data indicate that several of the major PRV cell surfaceglycoproteins (gB, gC, gD, and gE) are linked and thereforemost likely are present in close proximity to each other (14).The exact nature of this link is still putative but may relyon the numerous protein-protein interactions that are believedto exist between viral glycoproteins and tegument proteins (26).Many PRV cell surface glycoproteins other than gB (e.g., gD,gE, and gH) contain potential or functional internalizationmotifs that may also interact with AP-2, and therefore, thecolocalization between a minority of the cell surface-localizedgB molecules and AP-2 that we observed in cells infected withthe PRV Y902A strain may be attributed to the juxtapositionof gB and other AP-2-interacting viral glycoproteins. An alternativeexplanation for this weak, but significant, colocalization maybe that the mutated YQRL motif or a cytoplasmic domain differentfrom the YQRL motif may display a weak affinity for AP-2. Wetend to favor the first hypothesis, since we found that, incontrast to infected cells, in Y902A gB-transfected cells, gBdid not show significant colocalization with AP-2.

The data from our coimmunoprecipitation and colocalization assaysshow that the YQRL motif, but not the YMSI or LL motif, in thecytoplasmic domain of PRV gB is required for interaction betweengB and AP-2, further confirming an earlier observation thatthe LL and YMSI motifs are not involved in endocytosis processes(13). Different hypotheses can be put forward to explain whythe YMSI motif and the LL doublet do not interact significantlywith AP-2. Perhaps these motifs have very low intrinsic affinityfor AP-2. In this context, it is important to note that someLL motifs require an acidic amino acid at position –4and/or –5 (relative to the first leucine of the doublet),which is absent in PRV gB, in order to be functional (39). Furthermore,it is known that some amino acids at the X position in a YXX ${phi}$ motif seem to be preferred over others to allow interactionwith the µ chain of the AP-2 complex (34). Ohno and colleagueshave shown that a YQRL motif, identical to the AP-2-interactingmotif in PRV gB, is the most favorable YXX ${phi}$ motif for this interaction(34). On the other hand, the internalization of HSV gB and VZVgB also depend on the membrane-distal YXX ${phi}$ motif that correspondsto the PRV gB YQRL motif, although these motifs (YSPL and YSRV)contain less-preferred amino acids at the X position (11, 17).Therefore, although the amino acids at the X position in theYXX ${phi}$ -type motifs in the gB tail may certainly be significantfor its capacity to interact with AP-2, other factors, suchas the conformational context of the motif, may be of equalimportance. The tyrosine-based motifs in the PRV and HSV gBtails form parts of ${alpha}$ -helical domains, and at least for PRV gB,it is believed that these domains adopt a tight-turn conformation(32, 15), which, according to the literature, is favorable forinteraction with the µ chain of the AP-2 complex (6, 47).

Interestingly, our present finding that the YQRL motif in thecytoplasmic domain of gB allows gB to interact with a memberof the clathrin-associated adaptor protein complexes, i.e.,AP-2, may be significant in explaining the important roles ofthis motif in two other processes: basolateral targeting ofgB in polarized cells and direct cell-to-cell spread of PRV(13). Indeed, besides AP-2, there are other members of the adaptorprotein complex family that interact with YXX ${phi}$ motifs, such asthe YQRL motif in gB. One of these, AP-1B, drives basolateralsorting in polarized cells. It is known that certain YXX ${phi}$ motifs,e.g., in the human immunodeficiency virus env protein, interactwith both AP-1B and AP-2, thereby driving both basolateral sortingand endocytosis of a protein (33). In this context, it is interestingthat, of the different YXX ${phi}$ motifs, the YQRL motif (like thatin PRV gB) has been predicted to be among the most preferredto establish an interaction with both types of adaptor proteincomplexes (34). Hence, the YQRL motif in gB may allow gB tointeract not only with AP-2 but perhaps also with AP-1B, therebyexplaining how this motif directs gB to basolateral surfacesin polarized cells. Since YXX ${phi}$ -mediated deposition of specificviral proteins or virus particles at basolateral surfaces enhancescell-to-cell spread of alphaherpesviruses and other viruses,such as human immunodeficiency virus (19, 21), the possibilitythat the YQRL motif in PRV gB interacts not only with AP-2 butalso with other members of the adaptor protein complex familymay provide a clue to how this motif facilitates direct cell-to-cellspread of PRV.

Taken together, our findings suggest that both spontaneous andantibody-mediated internalizations of PRV gB occur via an interactionof the membrane-distal tyrosine-based motif in its cytoplasmictail with the cellular clathrin-associated AP-2 complex. Therefore,internalization of PRV gB can be considered to be a viral mimicryof cellular receptor endocytosis and may perhaps constitutea common mechanism used by several alphaherpesviruses to achieveinternalization of envelope proteins from the surfaces of infectedcells.

ACKNOWLEDGMENTS

We thank Lynn Enquist, Christoph Hengartner, and Greg Smithfor invaluable help with the construction of the mutants; MauricePensaert, Peter Delputte, and Kristin Geenen for fruitful discussions;and Carine Boone for excellent technical assistance.

This research was supported by a cooperative research actionfund of the Research Council of Ghent University.

FOOTNOTES

* Corresponding author. Mailing address: Laboratories of Virology and Immunology, Faculty of Veterinary Medicine, Ghent University, Salisburylaan 133, 9820 Merelbeke, Belgium. Phone: 32 9 264 73 74. Fax: 32 9 264 74 95. E-mail: herman.favoreel{at}ugent.be.

REFERENCES

Top