Previous Article | Next Article ![]()
Journal of Virology, August 2004, p. 8630-8640, Vol. 78, No. 16
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.16.8630-8640.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Howard Hughes Medical Institute, Institute of Molecular Biology, University of Oregon, Eugene, Oregon 97403
Received 20 January 2004/ Accepted 27 May 2004
| ABSTRACT |
|---|
|
|
|---|
-helical in both viruses. However, only in measles virus P is the NBD stable and folded, having a lesser degree of tertiary organization in mumps virus P. With isothermal titration calorimetry, we demonstrate that the measles virus P NBD binds to residues 477 to 505 of measles virus N with 1:1 stoichiometry. The dissociation constant (Kd) was determined to be 13 µM at 20°C and 35 µM at 37°C. Our data are consistent with a model in which an
-helical nucleocapsid binding domain, located at the C terminus of P, is responsible for tethering the viral polymerase to its template yet also suggest that, in detail, polymerase binding in morbilliviruses and rubulaviruses differs significantly. | INTRODUCTION |
|---|
|
|
|---|
Measles and mumps virus nucleocapsids, as visualized by transmission electron microscopy, are flexible rods, approximately 20 nm in diameter, with a hollow central cavity approximately 5 nm in width (3, 14, 33, 54). RNA is tightly bound within the nucleocapsid, which is not believed to dissociate during RNA synthesis. Expression of the N protein from measles virus and mumps virus in a variety of heterologous systems results in the formation of nucleocapsid-like particles (3, 26, 44, 46, 47, 52, 53). For the measles virus N protein, it has been shown that these structures result from the nonspecific encapsidation of cellular RNA (47), a result which is likely to hold for the mumps virus N protein as well, based on the reported densities of mumps virus nucleocapsid-like particles in CsCl (44, 46). These nucleocapsid-like particles are a useful model for the authentic viral nucleocapsid.
The N protein (525 amino acids in measles virus, 549 amino acids in mumps virus) can be divided into two regions. An N-terminal assembly domain, encompassing the first 400 amino acids of the protein, is responsible for RNA binding and formation of the helical nucleocapsid. A C-terminal tail, varying widely in length and sequence among the paramyxoviruses, is located on the nucleocapsid exterior and is thought to be dispensable for nucleocapsid assembly. In Sendai virus, the tail of N encompasses a binding site for the P protein and hence for the viral polymerase (5, 9, 43), but for other paramyxoviruses, less is known. For measles virus, it has been established that the tail of N binds to the P protein (30, 32), and the binding site has been tentatively mapped to residues 457 to 525 (2). For mumps virus, nothing is known from experiments regarding this interaction.
The P protein does not have a compact structure but contains a number of functional elements separated by intrinsically disordered sequences (10, 45). Thus, the size of P varies considerably among paramyxoviruses, ranging from approximately 250 to 600 amino acids in length. All paramyxovirus P proteins are likely to be oligomeric, containing heptad sequence repeats in the central region of the molecule, characteristic of helical coiled coils (8). The structure of this region of the Sendai virus P protein has been determined and is a tetrameric coiled coil (50), but it is not known if all paramyxoviral P proteins are similarly tetrameric. The extreme C terminus of P is critical for nucleocapsid binding, as short deletions at the C terminus of P from Sendai virus (40), human respiratory syncytial virus (15), and human parainfluenza virus 3 (12) eliminate or dramatically decrease binding to N-RNA. The final 50 amino acids of P are predicted to form a trihelical structural motif in many paramyxoviral P proteins, including those of measles virus and mumps virus (8). A very recent crystal structure of this domain from measles virus P (24) shows it to be a compact bundle of three
-helices. For measles virus, the C-terminal region of P, including the putative coiled coil and downstream sequences, can bind to the N protein (18, 22, 31, 32). For mumps virus, there is no direct evidence, but for the closely related La Piedad Michoacan Mexico virus (LPMV), the equivalent region of P may be involved in nucleocapsid binding (49).
The N, P, and L proteins of measles virus are functionally equivalent to those of mumps virus, yet sequence homology between proteins from these viruses is limited, and the viruses have been placed in different genera (Morbillivirus and Rubulavirus, respectively). We began to study components of the replication complex from both viruses in order to clarify the similarities and the differences in the organization of these familiar pathogens. In this paper, we define the regions of the P and N proteins that mediate association of the polymerase with the nucleocapsid for both measles and mumps viruses. The binding site for the P protein maps to a different region of N in the two viruses. We show, however, that in each case the last 50 amino acids of the P protein constitute the nucleocapsid-binding domain, and we report a comparative analysis of the secondary and tertiary structure of this domain. For measles virus, we characterized the binding process by isothermal titration calorimetry and report the binding parameters.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of P protein expression plasmids. Constructs encoding the full-length measles virus and mumps virus P proteins (MEP and MUP, respectively) were made by ligating the P genes into plasmid pET-22b(+) (Novagen) between the unique NdeI and XhoI sites. Plasmids for expression of truncated P proteins lacking the final 49 amino acids of the wild-type sequence (MEP1-458 and MUP1-342) were derived by introducing a stop codon (TAA) at the appropriate point in the coding sequence. Variants of the all these constructs carrying a 20-amino-acid N-terminal His tag (MGSSHHHHHHSSGLVPRGSH) were created by subcloning the coding sequences into pET28b(+) (Novagen)
Construction of GST-P fusion protein-expression plasmids. To prepare proteins for both biophysical analysis and glutathione S-transferase (GST) pulldown experiments, the C-terminal region of the P protein (MEP457-507 and MUP343-391) was fused to the C terminus of GST, with an interleaving tobacco etch virus protease cleavage site allowing release of the P fragments if required. Exploiting a recent finding that a number of side chains can be tolerated in the P1' position of the tobacco etch virus protease recognition sequence (25), the constructs were designed so that the proteins released after protease digestion did not retain any nonnative residues at the N terminus. First plasmid pET41a(+) was modified, replacing the sequence GGTTCA, between the end of the GST gene and the SpeI site, with the sequence GGCAGTGACTACGATATCCCA, encoding GSDYDIP. DNA encoding the desired regions of the P proteins was amplified by PCR and ligated into the modified plasmid between the unique SpeI and XhoI sites. In each case, PCR primers were designed to append the sequence GAGAACCTCTATTTCCAG, encoding ENLYFQ, between the SpeI site and the 5' end of the P coding sequence. The resulting vectors encode the GST fusion proteins GST-MEP457-507 and GST-MUP343-391. For GST-MEP457-507, cleavage by tobacco etch virus protease was found to be greatly improved by mutating the P2' position from Pro to Gly. For this construct, the protein released after protease cleavage was MEP457-507, with a Pro-to-Gly mutation at residue 458 (MEP457-507/P458G)
Construction of N protein expression plasmids. Constructs encoding the full-length measles virus and mumps virus N proteins (MEN and MUN, respectively), with and without an 8-amino-acid polyhistidine tag at the C terminus (LEHHHHHHHH), were made by ligating the N genes into pET-26b(+) between the unique NdeI and XhoI sites. To create truncated variants for analysis of nucleocapsid assembly, a SalI site was introduced at the desired location within N. A SalI-XhoI restriction digest excised the unwanted 3' end of the N gene, and the compatible ends of the plasmid were religated. Plasmids created in this fashion encode the truncated N proteins with an 8-amino-acid tag appended at the C terminus (VEHHHHHHH). Untagged, truncated measles virus and mumps virus N proteins for GST pulldown analysis were created by introducing a stop codon at the appropriate point within the N coding sequence.
Construction of GST-N fusion protein expression plasmids. To create fusion proteins for GST pulldown experiments, DNA encoding the tail of the N protein (MEN374-525 and MUN374-549) was amplified by PCR and ligated into plasmid pGEX-4T-1 (Amersham Biosciences) between the EcoRI and XhoI sites, creating vectors encoding the GST fusion proteins GST-MEN374-525 and GST-MUN374-549. Variants truncated at the C terminus of N were created by introduction of stop codons within the N coding sequence. Plasmids encoding GST fused to short fragments of the tail of measles virus N (MEN477-505 and MEN495-505) were created in a different fashion which allowed release and purification of the tail fragment. Starting with the plasmid encoding GST-MUP343-391, described above, a KpnI site was introduced directly after the tobacco etch virus protease recognition sequence. The N coding sequences were subcloned into the modified plasmid with the KpnI and XhoI sites. If the fusion proteins were treated with tobacco etch virus protease, tail peptides were released, carrying a nonnative Thr-Ser dipeptide at their N terminus. To allow quantitation of the peptide for calorimetric studies, a variant was produced in which a tyrosine was appended to the C terminus.
Protein expression. High-level expression of N, which contains multiple codons rarely used by Escherichia coli, required the presence of a separate compatible plasmid carrying additional copies of the rare tRNA genes (plasmid pRARE; Novagen). Accordingly, N or GST-N protein expression plasmids were transformed into Rosetta (DE3) (for pET-based vectors) or Rosetta (for pGEX-based vectors). P and GST-P protein expression plasmids were transformed into BL21-Star(DE3) (Invitrogen). Transformed bacteria were grown in Luria broth with selective antibiotics at 37°C until induction. Protein expression was induced by addition of isopropylthiogalactopyranoside (IPTG) (0.1 to 1 mM final concentration). After induction, bacteria were maintained at 16 to 28°C for 4 to 16 h before harvest. Cell pellets were stored at 80°C before use. Uniformly 15N-labeled proteins (GST-MEP457-507, GST-MUP343-391, and GST-MUP343-391/C356S) were prepared by growing transformed bacteria in minimal medium (see reference 35 for medium composition) with 15NH4Cl (Spectra Stable Isotopes) as the sole nitrogen source. Following induction, bacteria were maintained at 28°C for 14 to 18 h before harvest.
GST pulldown assay. For GST pulldown assays, cell pellets were resuspended in phosphate-buffered saline buffer (10 mM Na2HPO4/KH2PO4 [pH 7.4], 137 mM NaCl, 2.7 mM KCl; 1 ml/100-mg pellet) and lysed by sonication. Lysates were clarified by centrifugation in a benchtop centrifuge. The assays were carried out with MicroSpin columns containing 50 µl of glutathione-Sepharose 4B (Amersham Biosciences); 400 µl of clarified lysate containing GST or the GST fusion protein was applied to the column and incubated 5 min at room temperature with occasional mixing. The column was washed twice with 400 µl of PBS buffer, and 400 µl of lysate containing the potential binding partner was applied to the column, incubated, and washed in the same fashion. Bound proteins were eluted in 100 µl of 50 mM Tris-HCl (pH 8.0) containing 20 mM reduced glutathione, and the results were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry. GST, for use as a negative control in the pulldown assay, was produced with plasmid pGEX-4T-1 (Amersham Biosciences) or plasmid pET41a(+) (Novagen) into which a stop codon had been introduced at the end of the GST gene.
Electron microscopy. Samples were prepared for electron microscopy by applying them to carbon- and Formvar-coated electron microscopy grids and negatively staining with 2% (wt/vol) sodium phospotungstate (pH 7.5). Images of the specimens were recorded with a Phillips CM-120 electron microscope.
Western blotting. Proteins resolved on SDS-PAGE gels were transferred onto a polyvinylidene difluoride membrane (Hybond-P; Amersham Biosciences) by electroblotting. Primary and secondary antibody hybridization was done according to standard protocols. The primary antibody was a mouse immunoglobulin G recognizing a polyhistidine tag (Penta-His antibody; Qiagen). The secondary antibody was an anti-mouse immunoglobulin G whole antibody conjugated to horseradish peroxidase (Amersham Biosciences). Antibody binding was detected with the enhanced ChemiLuminesence system (ECL; Amersham Biosciences), and the results were recorded on Kodak XAR photographic film.
Mass spectrometry. MALDI-TOF mass spectra were obtained with a Voyager-DE instrument (Applied Biosystems). The matrix (ferulic acid dissolved a 1:1 mixture of 2-propanol and water, with addition of 0.25%[vol/vol] trifluoroacetic acid) was mixed directly with the sample and air dried before data collection.
Purification of truncated N proteins for analysis of nucleocapsid assembly. All constructs used for analysis of nucleocapsid assembly carried a C-terminal polyhistidine tag, which was used to isolate the expressed proteins. Frozen cell pellets were resuspended in primary-amine-free BugBuster (Novagen) a proprietary lysis buffer, to which was added a protease inhibitor cocktail (complete, EDTA-free; Roche Diagnostics), and small quantities of lysozyme and DNase I. The mixture was stirred gently at 4°C for 45 min. The lysate was clarified by centrifugation, and the supernatant was added to Talon resin (Clontech), preequilibrated with buffer A (25 mM morpholinepropanesulfonic acid [MOPS]-NaOH [pH 7], 200 mM NaCl, 0.5 mM TCEP-HCl, 5 mM imidazole). The resin was thoroughly washed with buffer A, and then the bound protein was eluted by increasing the imidazole concentration to 500 mM. Samples were analyzed by SDS-PAGE and Western blot to assess N protein expression and by electron microscopy to assess nucleocapsid assembly.
Purification of the nucleocapsid-binding domain from measles virus and mumps virus P. The nucleocapsid-binding domains from measles virus and mumps virus P (constructs MEP457-507, MUP343-391, MUP343-391/C356S, and MEP457-507/P458G) were initially isolated as GST fusion proteins. Frozen cell pellets were resuspended in buffer B (50 mM Tris-HCl [pH 7.9], 200 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA; 5 ml/g of pellet), with addition of a protease inhibitor cocktail (Roche Diagnostics), and cells were disrupted by sonication. The lysate was clarified by centrifugation, and the supernatant was passed over glutathione-Sepharose 4B resin (Amersham Biosciences), preequilibrated with buffer B, which was then washed extensively with the same buffer. Tobacco etch virus protease (Invitrogen) was added and gently mixed with the resin-bound fusion protein. Following overnight incubation at 16 to 24°C, the released P proteins were eluted by washing the resin with buffer B. P proteins were further purified by cation-exchange chromatography, by first binding them to SP Sepharose HP resin (Amersham Biosciences) buffered with 25 mM MOPS-KOH (pH 7.0)-25 mM NaCl and then displacing them with a linear salt gradient.
Purification of the measles virus N tail peptide. The tail peptide MEN477-505 was first isolated as a GST fusion protein. The initial purification of the fusion protein and proteolytic cleavage to release the peptide were performed as described above. The peptide was further purified by cation-exchange chromatography, by first binding it to SP Sepharose HP resin (Amersham Biosciences) buffered with 25 mM malic acid-KOH (pH 3.7)-50 mM NaCl and then displacing it with a linear salt gradient.
Circular dichroism spectroscopy and thermal unfolding measurements.
For measurement of circular dichroism, the proteins (1 to 2 µM) were dialyzed into 5 mM Na2HPO4-NaH2PO4 buffer (pH 7.0), with or without 10 mM NaCl (for MUP343-391 and MEP457-507/P458G, respectively). Peptide concentrations were estimated by measuring sample absorbance at 190 nm with a Varian 2290 spectrophotometer flushed with dry nitrogen gas, and assuming a per residue molar extinction coefficient
190 = 10,000 M1 cm1, which is characteristic of folded proteins (20). Circular dichroism spectra were collected on samples in a 0.1-cm optical cell at a temperature of 2°C with a J-600 JASCO spectrophotometer configured for circular dichroism measurement. Thermal unfolding of the peptides (0.3 to 0.7 µM) in the same buffers was monitored by following the circular dichroism signal at 220 nm as a function of temperature, as previously described (11).
Nuclear magnetic resonance spectroscopy. For nuclear magnetic resonance spectroscopy, concentrated protein samples were dialyzed into 10 mM Na2HPO4-NaH2PO4 buffer (pH 5.7) with 50 to 100 mM NaCl; 10% (vol/vol) 2H2O was added to each sample before data acquisition. HSQC spectra (27, 57) were acquired on a Varian Inova 600 MHz spectrometer equipped with a triple-resonance pulsed-field gradient probe. 1H chemical shifts were referenced with an external DSS standard. 15N chemical shifts were referenced indirectly with standard frequency ratios (56). Nuclear magnetic resonance data were analyzed with the programs NMRPipe and NMRDraw (13).
Dynamic light scattering and size exclusion chromatography. Dynamic light scattering measurements were made at 25°C with a DynaPro99 instrument (Protein Solutions Inc.). Translational diffusion coefficients were calculated from the measured autocorrelation function, and the hydrodynamic radius was calculated via the Stokes-Einstein equation. Size exclusion chromatography was carried out on a Hi Load 16/60 Superdex 75 column (Amersham BioSciences). For both measurements, the starting protein concentration was equivalent to that used for nuclear magnetic resonance spectroscopy, and the sample buffer was 12.5 mM MOPS-KOH (pH 7.0)-100 mM NaCl.
Isothermal titration calorimetry. For isothermal titration calorimetry, the purified proteins (MEN477-505 and MEP457-407/P458G) were dialyzed extensively against 10 mM Na2HPO4-NaH2PO4 buffer (pH 7.0)-100 mM NaCl-0.01% (wt/vol) sodium azide. Protein concentrations were calculated from UV absorption measurements at 280 nm (16). Before use, protein solutions were outgassed at 1/3 atm for 4 min. Isothermal titration calorimetry measurements were made with a VP-ITC microcalorimeter (MicroCal, Inc.) operated at 20 and 37°C. MEP457-407/P458G was used as the injectant in the titrations, with the injection syringes carefully dried to avoid dilution effects. A 3% correction was applied to account for dilution of MEN477-505 upon loading into the VP-ITC reaction chamber. For each titration, an initial injection of 2 µl was followed by 23 injections of 12 µl at intervals of 240 s. Baseline mixing heats were determined by duplicate injections of MEP457-407/P458G into buffer at both temperatures, and these were subtracted from the binding heat profiles before model fitting. The standard multiple independent binding-site model was fitted to the data with the Origin software package, version 5.0 (MicroCal).
| RESULTS |
|---|
|
|
|---|
The full-length N proteins and many of the truncated variants assembled into nucleocapsid-like particles when expressed in E. coli. For both measles virus and mumps virus, all constructs encompassing residues 1 to 375 of the N protein remained assembly competent. The other constructs that were tested (1 to 300, 1 to 325, and 1 to 350) showed high-level expression in E. coli but were not soluble and could not be isolated from cell lysates. In addition to helical nucleocapsids, ring structures were also observed which correspond to single turns of the helical nucleocapsid (3). While only the first 375 amino acids of N are strictly required for nucleocapsid formation, modifications to the tail of the molecule did affect assembly in more limited fashion. The shortest of the assembly-competent variants (1 to 375, 1 to 400, and 1 to 425) gave rise to long and regular nucleocapsid-like particles. The longer variants (1 to 475, 1 to 500, and the wild-type proteins) gave rise to shorter, more fragmented particles and increased numbers of subnucleocapsid rings.
P protein binds to the nucleocapsid-like particles resulting from heterologous expression of the N protein. Before proceeding with a detailed investigation of the interaction between the P protein and the nucleocapsid, we needed to verify that the N and P proteins produced in our heterologous expression system bound one another. To establish this, the N and P proteins from measles virus and mumps virus were individually expressed in E. coli. The measles virus and mumps virus N proteins were wild-type, while the corresponding P proteins carried a polyhistidine tag at their N termini. We used these proteins in a polyhistidine tag pulldown assay, confirming the association between N and P from each virus (data not shown).
The measles virus P protein binds to the nucleocapsid via a short sequence within the tail of the measles virus N protein (MEN374-525). Since the measles virus P protein was already known to associate with the nucleocapsid via the tail of N protein, we fused this region of N to the C terminus of Schistosoma japonicum GST and assayed for binding to P. For the purpose of our experiments, we defined the tail of the N protein as the entire sequence that was earlier shown to be dispensable for nucleocapsid assembly (i.e., MEN374-525). With a GST pulldown assay, we showed that MEN374-525 retained the ability to bind measles virus P (Fig. 1A, lanes 5 and 6), consistent with prior observations (2, 24, 30, 32).
|
To further map the binding region, two short tail fragments were tested for their ability to bind to P. The fragments encompassed 11 and 29 residues of the tail of N, ending in each case at residue 505. These fragments were fused to the C terminus of GST, and the results of a GST pulldown experiment are shown in Fig. 1C. While the shorter of the two fragments (MEN495-505) did not bind to P, the longer tail fragment (MEN477-505) retained binding ability.
Last 51 amino acids of the measles virus P protein (MEP457-507) mediate binding to the tail of the measles virus N protein (MEN374-525). Having mapped the binding site for the measles virus P protein to a short and contiguous sequence within the tail of the N protein, we sought to establish if the trihelical motif located at the C terminus of the P protein was directly mediating the interaction. We had previously demonstrated that deletion of the 49 amino acids at the C terminus of P, which encompass this motif, eliminated binding to the tail of N (Fig. 1A, lanes 7 and 8). We then sought to ascertain if this region of P was not only necessary but also sufficient for binding to the tail of N.
We fused MEP457-507 to the C terminus of GST and assayed for binding to nucleocapsid-like particles resulting from the expression of full-length and truncated measles virus N proteins (Fig. 2). MEP457-507 fused to GST bound to the full-length N protein and bound weakly to a truncated variant (1 to 500) lacking a small part of the previously identified P protein binding site (477 to 505). Binding to truncated variants from which the P protein binding site had been completely eliminated (1 to 450 and 1 to 398) did not exceed background levels. This experiment confirms our previous observations and showed that MEP457-507 alone had an intrinsic ability to bind to the tail of N. The same point was independently demonstrated by a recent study of the changes in circular dichroism that occur on titration of the tail of the N protein with MEP459-507 (24). Our experiment additionally indicates that binding of the P protein to the nucleocapsid occurs exclusively through its association with the tail of N.
|
|
|
50 amino acids of both measles virus and mumps virus P constituted the nucleocapsid-binding domain. Hence we carried out a spectroscopic characterization of these domains to assess their secondary and tertiary structure. For this structural analysis, the C-terminal regions of measles virus and mumps virus P (MEP457-507 and MUP343-391) were initially isolated as GST fusion proteins. The P fragments were released from GST through proteolytic cleavage and purified to homogeneity by cation-exchange chromatography (see Materials and Methods). Because the GST-MEP457-507 fusion protein was not cleaved efficiently, a Pro458Gly mutation was introduced into this construct to facilitate isolation of the P fragment. Correspondingly, some structural work was carried out with the mutated protein (MEP457-507/P458G).
Circular dichroism spectra of the two P fragments (Fig. 5) showed negative bands near 222 and 208 nm and a positive band near 192 nm. Such spectra are characteristic of proteins that are predominantly
-helical (17). By means of a simple and approximate method (17), we estimate the
-helical content to be
80% for MEP457-507 and
70% for MUP343-391 on the basis of the magnitude of the circular dichroism signal at 208 nm. The thermal stability of the two proteins was examined by monitoring the change in the circular dichroism signal at 220 nm as a function of temperature (2 to 95°C). For both proteins, the circular dichroism signal increased sigmoidally as the temperature was raised, indicative of loss of the helical structure (data not shown). In both cases, the
-helical structure persisted at physiological temperatures. For MUP343-391, the transition to the unfolded state appeared to be complete within the studied temperature range, with little evidence of cooperative unfolding. For MEP457-507/P458G, the transition was incomplete at 95°C, the limit imposed by the instrumentation, indicating a much higher thermal stability of this protein relative to MUP343-391.
|
|
Interaction between the measles virus P nucleocapsid-binding domain and MEN477-505 studied by isothermal titration calorimetry.
To complete this study, we obtained some quantitative data on the interaction between the measles virus P NBD and MEN477-505 with isothermal titration calorimetry, monitoring the heat generated as the two purified proteins were titrated. Analysis of such data yields the binding parameters, including the stoichiometry of binding (n), the strength of the association (which we express in terms of the dissociation constant Kd), as well as the enthalpic (
H) and entropic (
S) contributions to the Gibbs free energy of association.
The data for one such titration, performed at 20°C, is shown in Fig. 7. When the data were fit with the standard multiple independent binding-site model, the binding parameters were determined to be n = 0.93, Kd = 13 µM,
H = 1.1 x 104 cal/mol, and
S = 14 cal/K.mol. A second titration, carried out at 37°C, resulted in fitted parameters n = 0.87, Kd = 35 µM,
H = 1.9 x 104 cal/mol, and
S = 42 cal/K.mol. In both cases, the fit of the model to the experimental data was very good. The deviation of the experimentally determined stoichiometry from unitary values could arise from a large number of factors (e.g., small errors in the estimated protein concentration) and is not significant.
|
| DISCUSSION |
|---|
|
|
|---|
Consistent with a large body of prior data, our study shows directly that for both measles virus and mumps virus, the tail of N is dispensable for nucleocapsid assembly. The minimal region found to be capable of supporting assembly (amino acids 1 to 375 in each case) is slightly shorter than had been previously supposed. Modifications to the tail did, however, influence the length of the nucleocapsid-like particles that were produced. Constructs in which most or all of the tail was removed (1 to 375, 1 to 400, and 1 to 425) produced the longest particles. Very similar observations were recently reported for the Newcastle disease virus N protein (28).
The major objective of this study was an analysis of the interaction between the P protein and the nucleocapsid for both measles virus and mumps virus (see summary in Fig. 8). We mapped the P protein-binding site within the measles virus nucleocapsid to a short and contiguous sequence (amino acids 477 to 505) near the end of the N protein (Fig. 3). Among the morbilliviruses, this corresponds to a relatively conserved sequence within the largely hypervariable tail of N (4, 29, 39). It has previously been shown that the tail of measles virus N, which is intrinsically disordered, undergoes a structural transition upon binding the P protein (24, 32). This transition has been hypothesized to involve helix formation by residues 489 to 504 of N (24). The minimal binding sequence that we have defined encompasses this region. Additionally, we have shown that the binding of MEN477-505 to MEP457-507 occurs with low affinity and is entropically disfavored at both temperatures studied. This is consistent with binding of MEN477-505 being coupled with folding.
|
As the tail of the N protein is arrayed on the exterior of the nucleocapsid, its involvement in binding the P protein makes sense on the basis of accessibility. In Sendai virus, the P binding site is also located within the tail of the N protein (5, 9, 43). However, in contrast to these results, we found that the mumps virus P protein binds specifically to the assembly domain of mumps virus N (residues 1 to 398). Some support for this finding comes from a recent study of interactions between the N and P proteins from LPMV, a porcine rubulavirus closely related to mumps virus (proteins from the two viruses exhibit 45 to 55% amino acid identity) (49). On the basis of a series of pulldown experiments, it was concluded that the last 236 amino acids of the LPMV P protein bound to residues 1 to 333 of the N protein.
We suggest that the assembly domain of mumps virus N is the primary site of attachment for the P protein within the nucleocapsid. Several factors suggest that this is plausible. The tail of N is likely to be unstructured and may allow access to assembly domain (Fig. 8) in a way that might not be possible if the tail were fully folded. Additionally, the nucleocapsid is an inherently flexible structure, and it may be unwound during RNA synthesis (19), which could facilitate binding of the polymerase to the assembly domain. It would therefore be of interest to know whether a tailless mumps virus N protein can serve as a template for RNA synthesis.
We have also shown, for both the measles virus and mumps virus P proteins, that the last
50 amino acids constitute the nucleocapsid-binding domain (NBD). This domain was found to be both necessary and sufficient for binding to nucleocapsid-like particles. For measles virus, this domain was shown by others to be capable of inducing a structural transition with tail of the N protein (24), consistent with our data. The Sendai virus P protein has previously been subject to very detailed analysis. A deletion of 30 amino acids at the C terminus of Sendai virus P abolishes nucleocapsid binding (40), in accord with the results for measles virus and mumps virus. However, in a cosedimentation assay, the last 95 amino acids of Sendai virus P, encompassing the NBD, did not associate with nucleocapsids under conditions where the full-length P protein was able to bind (42). On the basis of deletion analysis, it was concluded that two noncontiguous regions of Sendai virus P were required for nucleocapsid binding (41, 42), the C-terminal 90 amino acids (479 to 568), and an upstream sequence (345 to 412) which is now known to be part of the coiled-coil domain (50).
It is possible to reconcile the experimental results for measles virus, mumps virus, and Sendai virus through the following model (Fig. 8), initially suggested by Curran (7). First, it is supposed that the binding of the P protein to the nucleocapsid occurs in each case through the NBD at the very C terminus of P, but this association is intrinsically weak, as required for movement of the viral polymerase along the nucleocapsid during RNA synthesis. Within the P protein, the coiled-coil oligomerization domain effectively holds the downstream NBDs in close proximity and in the correct orientation for binding to the nucleocapsid. The sequence that interleaves the coiled coil and the NBD is likely to be unstructured (34). By tethering the NBDs together in this fashion, the coiled coil modulates the association of the NBD with the nucleocapsid. In this model, the role of sequences upstream of the NBD is a general one, restricted to the localization and positioning of the binding domain, thereby enabling the polymerase to walk along the nucleocapsid during RNA synthesis. This model (Fig. 8) can account for weak nucleocapsid binding by the isolated NBD and the much stronger binding by the full-length P protein.
Our calorimetric results for measles virus contribute to this model in several ways. First, they show that each NBD from the measles virus P protein will bind the tail of a single N protein. Second, the results demonstrate that binding of the tail by the measles virus P NBD is indeed weak, with a dissociation constant of 35 µM at 37°C. This is consistent with the processive movement of the P protein along the nucleocapsid during RNA synthesis. Finally, they suggest that burial of hydrophobic amino acids is likely to be driving the binding process, since the enthalpy change
H associated with binding becomes increasingly negative at higher temperature, which is characteristic of such interactions (48). Indeed, residues 491 through 502 of measles virus N protein are predominantly hydrophobic.
In this regard, the very recent X-ray crystal structure of the measles virus P nucleocapsid-binding domain (amino acids 459 to 507) is revealing (24). This structure was reported after the experiments described in this paper were completed. The binding domain consists of three
-helices, arranged in an antiparallel bundle, and it is proposed that a hydrophobic cleft on the surface of the molecule might accommodate a short helix contributed by the tail of the measles virus N protein (24). This model of binding is consistent with the data that we have presented here, especially in its suggestion that the interaction with N involves the burial of a hydrophobic surface.
The NBD from measles virus P is a stable and folded domain. The analogous region of the Sendai virus P protein is also highly structured (34). However, this finding does not extend to the mumps virus P NBD, which retains helical secondary structure (Fig. 5) but lacks a defined tertiary structure (Fig. 6). This implies that the binding domain from mumps virus P, unlike its counterpart from measles virus, cannot act as a template into which a sequence from the N protein simply docks. It seems likely that the mumps virus P NBD will be stabilized upon binding to the N protein, representing an inversion of the situation found for measles virus. We speculate that this difference may be related to the migration of the binding site for the P protein, which is in the relatively unstructured tail of N in measles virus and within the structured assembly domain of N in mumps virus.
In conclusion, we have shown for both measles virus and mumps virus that a 50-amino-acid helical domain at the C terminus of the P protein engages the nucleocapsid. However, the binding domains have different levels of tertiary organization in measles virus and mumps virus P and attach to distinct sites within the nucleocapsid. Isothermal titration calorimetry binding studies of the proteins from measles virus has provided the first quantitative information on the interaction between P and the nucleocapsid. While our results support previously proposed models for polymerase attachment in many aspects, they also suggest that there may be some significant differences among the paramyxoviruses.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles: