This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Y.
Right arrow Articles by Yuan, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.
Right arrow Articles by Yuan, Y.

 Previous Article  |  Next Article 

Journal of Virology, August 2004, p. 8615-8629, Vol. 78, No. 16
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.16.8615-8629.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Kaposi's Sarcoma-Associated Herpesvirus ori-Lyt-Dependent DNA Replication: cis-Acting Requirements for Replication and ori-Lyt-Associated RNA Transcription

Yan Wang,1 Hong Li,1 Man Yee Chan,1 Fan Xiu Zhu,1 David M. Lukac,2 and Yan Yuan1*

Department of Microbiology, University of Pennsylvania School of Dental Medicine, Philadelphia, Pennsylvania 19104,1 Department of Microbiology and Molecular Genetics, University of Medicine and Dentistry of New Jersey, Newark, New Jersey 071032

Received 25 November 2003/ Accepted 7 April 2004


arrow
ABSTRACT
 
Herpesvirus lytic DNA replication requires both the cis-acting element, the origin, and trans-acting factors such as virally encoded origin-binding protein and DNA replication enzymes. Recently, the origins of lytic DNA replication (ori-Lyt) in Kaposi's sarcoma-associated herpesvirus (KSHV) have been identified and a virally encoded bZip protein, K8, has been shown to specifically bind to the origin. To map cis-acting elements within KSHV ori-Lyt that are required for DNA replication function and to define the nature of K8 bZip protein binding to the origin, we constructed consecutive internal deletion mutations across the core domain of a KSHV ori-Lyt and tested them for DNA replication function in a transient replication assay. This mutagenesis study allowed the identification of four components within the ori-Lyt, and all were indispensable for ori-Lyt function. The first component contains eight CCAAT/enhancer binding protein (C/EBP) binding motifs that organize as four spaced C/EBP palindromes. Each palindrome contains two head-to-head CCAAT consensus motifs that are separated by a 13- or 12-bp space sequence. Substitution mutagenesis of these C/EBP motifs showed that these C/EBP palindromes are required for both K8 binding and ori-Lyt-dependent DNA replication. The second component is an 18-bp AT palindrome, which is essential for ori-Lyt function. The third component was determined to be a 32-bp previously unidentified sequence and is required for DNA replication. The last component consists of an open reading frame 50 (ORF50)/Rta responsive element (RRE) and a TATA box. We showed that the binding of an ORF50/Rta protein to the RRE was essential for ori-Lyt-dependent DNA replication. The presence of a functional RRE and a downstream TATA box suggested that this region serves as an ORF50/Rta-dependent promoter and a transcription event may be necessary for ori-Lyt-dependent DNA replication. Using a luciferase reporter system, we demonstrated that the region of the RRE and TATA box constitutes an ORF50/Rta-dependent promoter. Furthermore, a polyadenylated RNA of 1.4 kb was identified downstream of the promoter.


arrow
INTRODUCTION
 
As a gammaherpesvirus, Kaposi's sarcoma-associated herpesvirus (KSHV) has two alternative life cycles, namely latent and lytic replication cycles (14, 16). During latency, only a limited number of viral genes are expressed and no infectious virus is produced. In latently infected cells, multiple copies of the viral genome are maintained as extrachromosomal episomes (plasmids) and are replicated in synchrony with cell division (3). The terminal repeat sequence in the KSHV genome is necessary and sufficient for episome persistence and likely serves as the origin of latent plasmid replication (ori-P) (2). Virally encoded latency-associated nuclear antigen specifically binds to cis-acting terminal repeat DNA and acts in trans on the ori-P to mediate episome persistence (2). When latency is disrupted, KSHV switches to a lytic life cycle (14, 16). In the lytic phase, the virus expresses most or all of its genes and viral DNA is amplified by a replication mechanism distinct from that for latent viral DNA replication (9, 21). In general, lytic DNA replication of herpesviruses differs in two aspects from latent DNA replication. First, in contrast to latent DNA replication that is in synchrony with the host cell for a stable amount of viral episomal DNA in each cell, viral DNA is amplified 100- or even 1,000-fold in lytic replication via a rolling circle mechanism. Second, in contrast to latent DNA replication that depends on host cellular DNA polymerase and accessory factors, viral lytic replication utilizes its own DNA polymerase and other factors.

Lytic cycle DNA replication of herpesviruses is initiated from an origin (ori-Lyt) and requires many viral gene products. The origin region is bound by a virus-specified origin-binding protein (OBP) that recruits the core replication machinery. Recently, two duplicated copies of the lytic DNA replication origin [referred to as ori-Lyt (L) and ori-Lyt (R)] were identified in the KSHV genome in our laboratory and another laboratory (1, 11). These ori-Lyt are located in the KSHV genome between K4.2 and K5 and between K12 and open reading frame 71 (ORF71), respectively. In addition, we also found that a KSHV-encoded bZip protein, namely K8 (also referred to as replication-associated protein), was associated with a 500-bp essential core segment of the KSHV ori-Lyt (11). This finding, together with the observation that K8 is incorporated into the KSHV viral DNA replication compartments (21), suggests that K8 may be an OBP, similar to the Zta protein of Epstein-Barr virus (EBV) (8).

The structural and functional associations of KSHV ori-Lyt appear to be complex. Two ori-Lyt share an almost identical 1.1-kb sequence and 600-bp GC-rich repeats that are represented as 20- and 30-bp tandem arrays. Previous data showed that the whole 1.7-kb DNA sequences are necessary and sufficient as a cis-acting signal for KSHV replication (11). The first 465-bp sequence is 100% identical between these two ori-Lyt. Many interesting motifs are found in the highly conserved region, including two long AT-rich palindromes, four multiple short repetitive motifs containing XcaI and PvuII sites that are found in EBV ori-Lyt, two FspI/SphI motifs that are found within cytomegalovirus ori-Lyt, and clustered consensus binding motifs for AP-1, CCAAT/enhancer binding protein (C/EBP), and ATF (11, 15). Among them, two AT palindromes are extremely intriguing. AT palindromes are often found in eukaryotic cellular DNA replication origins, and initiation of replication generally involves local unwinding at an AT palindromic sequence (5). Another remarkable feature is that eight C/EBP motifs are found in a 200-bp segment between two AT palindromes, and they are arrayed as four unusually spaced palindromes. However, the roles of these motifs in initiating DNA replication have not been experimentally tested.

The goal of this study was to understand the structure and function of KSHV ori-Lyt and identify cis-acting elements that are essential for origin function. A systematic mutational analysis was performed on the core domain of a KSHV ori-Lyt for cis-acting constituents essential for the origin function. The ability of each ori-Lyt mutant to support lytic DNA replication was examined in a transient replication assay. By analyzing more than 50 ori-Lyt mutants, we defined several components in the ori-Lyt. First, we found that the palindromically arrayed C/EBP motifs are absolutely essential for both K8 binding to the ori-Lyt and lytic DNA replication. Second, mutation of the 18-bp AT palindrome completely abolished the origin function. Third, an ORF50 (Rta) responsive element (RRE) and a TATA box consensus sequence are found to be essential for ori-Lyt-dependent DNA replication. We demonstrated that the RRE and TATA box constitute an ORF50-dependent promoter, which directs transcription of a 1.4-kb polyadenylated RNA. Our data implied that a transcription activity is associated with KSHV lytic DNA replication.


arrow
MATERIALS AND METHODS
 
Cell culture. The primary effusion lymphoma cell line BCBL-1, which carries latently infected KSHV and was established by Renne and colleagues (16), was obtained from the National Institutes of Health AIDS Research and Reference Reagent Program. The cells were grown in RPMI 1640 medium (Gibco-BRL, Gaithersburg, Md.) supplemented with 10% fetal bovine serum (Gibco-BRL). BC-1 cells, which carry KSHV and EBV and were established by Cesarman et al. (4), were purchased from the American Type Culture Collection and grown in RPMI 1640 medium supplemented with 15% fetal bovine serum. BJAB cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum. 293 cells were maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum. All cultures contained penicillin-streptomycin (50 U/ml) and Fungizone (1.25 µg of amphotericin B/ml and 1.25 µg of sodium deoxycholate/ml).

Plasmids and DNA transfection. Plasmid pOri-A was constructed by cloning an EcoRI-PstI fragment (nucleotides 22409 to 26491, according to the numbering of Russo et al. [17]) of KSHV DNA in pBluescript at the EcoRI/PstI site. The internal deletion mutants of pOri-A (pOri-ID1 and pOri-ID2, etc.) were generated by using a PCR-based mutagenesis system, namely ExSite (Stratagene). In brief, a pair of phosphorylated oligonucleotides toward opposite directions was used in a high-fidelity PCR with pOri-A plasmid as a template. After PCR, the template DNA (wild-type pOri-A) was removed by complete digestion with DpnI, which does not degrade PCR-synthesized DNA. The PCR products were self-ligated and used to transform Escherichia coli-competent cells. Thirty deletion mutants of pOri-A are listed and described in Table 1. The nucleotide substitution mutants of pOri-A were also engineered by using the ExSite mutagenesis system. Twenty-one substitution mutants are listed and described in Table 1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Characteristics of a KSHV ori-Lyt plasmid and its mutants

pCR3.1-ORF50 was constructed by cloning the cDNA sequence of the ORF50 coding region into the pCR3.1 vector (Invitrogen). The construct was described in detail by Lin et al. (11). The expression vectors for Gal4 fusion proteins (pSG-C50 and pSG-424) were described by Lukac et al. (13).

To transfect cells, 5 µg of pOri-A or its mutant plasmids and 5 µg of pCR3.1-ORF50 (or pCR3.1 vector) were mixed with 107 BCBL-1 cells in OPTI-MEM medium (Gibco-BRL) and electroporated (200 V, 960 µF) with a Genepulser II (Bio-Rad, Hercules, Calif.). Electroporated cells were then transferred to RPMI 1640 medium supplemented with 10% serum and grown for 72 h.

DNA replication assay. Extrachromosomal DNAs were prepared from cells by using the Hirt DNA extraction method as follows. Cells were lysed in 700 µl of lysis buffer (10 mM Tris-HCl [pH 7.4], 10 mM EDTA, and 0.6% sodium dodecyl sulfate). Chromosomal DNA was precipitated at 4°C overnight by adding 5 M NaCl to the final concentration of 0.85 M. Cell lysates were centrifuged at 4°C at 14,000 rpm (Eppendorf 5417R) for 30 min. The supernatant containing extrachromosomal DNA was subjected to phenol-chloroform extraction, followed by ethanol precipitation. The DNA was treated with RNase A at 25°C for 30 min and then with proteinase K at 50°C for 30 min. Five micrograms of DNA was digested with KpnI/SacI or KpnI/SacI/DpnI (New England Biolabs). The DNAs were separated by electrophoresis on 1% agarose gels and transferred onto GeneScreen membranes (Perkin Elmer, Boston, Mass.). The Southern blots were hybridized with 32P-labeled pBluescript plasmid in 5x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 2x Denhardt's solution, 1% sodium dodecyl sulfate, and 50 µg of denatured salmon sperm DNA/ml at 68°C.

In vitro DNA binding assay. Various DNA fragments were synthesized by PCR with pOri-A DNA or its mutants as templates and two oligonucleotides as primers. The two oligonucleotides were ori-2.1F (5'-AGGTCGCCGAGGTGGCAAGGTGACT-3') and ori-7R (5'-ACTGGAATAGGGGCTGCGATGACTC-3'). One of the oligonucleotides was biotinylated at its 5' end. The resultant biotinylated PCR fragments were coupled to streptavidin-conjugated magnetic beads (Dynal, Oslo, Norway) and then incubated with nuclear extracts prepared from tetradecanoyl phorbol acetate (TPA)-induced (and uninduced) BCBL-1 cells for 45 min at 25°C. The bound material was washed four times in D150 buffer (20 mM HEPES [pH 7.9], 20% glycerol, 0.2 mM EDTA, 150 mM KCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.05% NP-40) and then progressively eluted with D300 (same as above, except 300 mM KCl), D500 (500 mM KCl), and D1000 (1 M KCl). The affinity-purified materials were assayed by Western blot analysis with anti-K8 antibody.

Reporter plasmids and luciferase assays. Reporter plasmid 4F and its mutants (4F{Delta}RRE, 4F{Delta}7, 4F-Gal4, 4F-2xGal4, and 4F{Delta}TATA) were constructed by cloning the appropriate PCR-generated fragments into the SmaI/NcoI-digested pGL3-Basic vector (Promega). These fragments were generated by PCR with oligonucleotides 4F (5'-CCCATAATCCTCTGCCCCGCTCCCAT-3') and OriT-2(5'-CATGCCATGGTGCTGCCGGGGCTCCTCGTTAC-3') as primers and pOri-A or its mutants (pOri-ID15.4, pOri-ID15.7, pOri-Gal4{Delta}6, pOri-2xGal4, and pOri-16.2) as templates, followed by digestion with NcoI. 13F and its mutants (13F{Delta}RRE, 13F{Delta}7, 13F-Gal4, 13F-2xGal4, and 13F{Delta}TATA) were generated by digesting plasmid 4F and its mutants with restriction endonucleases AscI and MluI and religating these plasmids. The inserts of these constructs have been illustrated (see Fig. 7A).





View larger version (47K):
[in this window]
[in a new window]
  		FIG. 7. Transcription activation of putative ori-Lyt-associated promoter by ORF50/Rta. (A) Schematic illustration of reporter plasmids containing the firefly luciferase gene under the control of the wild-type ori-Lyt sequence or its mutants where the RRE and TATA box have been deleted or mutated. These reporter plasmids were used to cotransfect BJAB or BCBL-1 cells with pCR3.1-ORF50 or empty pCR3.1 vector by electroporation. Renilla luciferase plasmid was included in each transfection as an internal control. At 48 h posttransfection, dual luciferase assays were performed with the cell lysates of transfected BJAB cells (B) and BCBL-1 cells (C). Relative luciferase activities were calculated by dividing the normalized firefly luciferase activity of each reporter by that of the pGL3 plasmid in pCR3.1-transfected cells.

Ten micrograms of luciferase reporter construct, 1 µg of pRL-TK plasmid, and 3 µg of pCR3.1-ORF50 (or pCR3.1 empty vector) were mixed with 107 BJAB or BCBL-1 cells in OPTI-MEM medium (Gibco-BRL) and electroporated (250 V, 960 µF) with a Genepulser II (Bio-Rad). Electroporated cells were then transferred to RPMI 1640 medium supplemented with 10% serum and grown for 48 h. The pRL-TK plasmid was included as an internal control which constitutively expresses Renilla luciferase. The dual luciferase reporter assay system (Promega) was used to examine the responsiveness of the promoters to ORF50/Rta. Transfected cells were washed once with 1x phosphate-buffered saline and suspended in 400 µl of 1x passive lysis buffer. Cells were freeze-thawed once and centrifuged in a microcentrifuge for 1 min. Supernatants were assayed for firefly luciferase and Renilla luciferase activities by using a TD-20/20 luminometer with a dual autoinjector (Turner Designs). The luciferase assays were carried out according to the manufacture's instructions (Promega).

Northern blotting and hybridization. Total RNA was isolated from BC-1 cells with Trizol reagent (Gibco-BRL), and poly(A+) mRNA was purified by using the PolyAtract mRNA isolation system (Promega). The mRNA was separated by electrophoresis in 1% agarose-6% formaldehyde gel in 20 mM morpholinepropanesulfonic acid (MOPS) buffer, pH 7.0. Each lane was loaded with mRNA from 2 x 107 cells. The RNA was transferred to a Nytran membrane (Schleicher & Schuell, Keene, N.H.) and hybridized with a single-stranded 32P-labeled probe. The probe was prepared by asymmetric PCR with PmlI-digested pOri-A plasmid as the template and the oligonucleotide OriT-1(5'-TGTTTATTTCAAGAGCCTATGCTCG-3', nucleotides 25428 to 25403) as the primer. The labeling reaction was performed in 15 µl of reaction solution (1x Taq polymerase buffer: 16.67 µM [each] dATP, dGTP, and dTTP, 1.67 µM dCTP, 5 µl of [{alpha}-32P]dCTP [800 Ci/mmol, 10 µCi/µl; Amersham], 100 ng of DNA, 20 pmol of primer, and 2.5 U of Taq polymerase). The PCR was initiated with a denaturing step of 2 min at 94°C, followed by 15 cycles of sequential steps of 1 min at 94°C, 1 min at 50°C, and 3 min at 74°C. Finally, the reaction was extended for 10 min at 74°C. The RNA loading equivalence was controlled by probing with ß-actin cDNA. A 0.24- to 9.5-kb RNA ladder (Gibco-BRL) was included in each agarose-formaldehyde gel and detected in Northern blots by hybridization with labeled {lambda} DNA.

RACE. A rapid amplification of cDNA ends (RACE)-ready cDNA pool was generated by using the Marathon cDNA amplification kit with Advantage cDNA polymerase mix (Clontech, Palo Alto, Calif.). Polyadenylated RNA was isolated from BC-1 cells that had been treated with sodium butyrate for 24 h. Double-stranded cDNA was synthesized with avian myeloblastosis virus reverse transcriptase and cDNA synthesis primer [a modified lock-docking oligo(dT) primer; Clontech]. The cDNAs were ligated with the Marathon cDNA adapter (Clontech).

To obtain the 5' RACE fragment of ori-Lyt-associated transcript, the RACE-ready cDNA pool was amplified first with oriT-RACE2 primer (5'-GAGGGTGGCGCGCCGGGGCT-3') and adaptor primer AP-1 (provided in the Marathon cDNA kit). The PCR products were then amplified with oriT-RACE3 (5'-GGGTGCTGCCGGGGCTCCTCGTTAC-3') and nested adaptor primer AP-2 from the kit. Similarly, the 3' portion of the cDNA was obtained through two PCRs. RACE4 (5'-TGGATTTACCCGTAACGAGGAGC-3') and AP-1 primers were used in the first reaction, and RACE1 (5'-AGCCCCGGCGCGCCACCCTC-3') and AP-2 were used in the second. DNA fragments generated in the RACE reactions were cloned into the T/A type PCR cloning vector pCR2.1 (Invitrogen) and sequenced.


arrow
RESULTS
 
Mapping of cis-acting elements for ori-Lyt function. Although both duplicated ori-Lyt are able to mediate KSHV lytic DNA replication (11), we focused on the ori-Lyt (L) (located in the KSHV genome between K4.2 and K5) for further analysis. Previous study with progressive deletion mutants of an ori-Lyt plasmid established minimal ori-Lyt boundaries (11). According to these data, serial internal deletion mutants across the KSHV ori-Lyt core domain (nucleotides 23137 to 24290) were constructed by using a PCR-based mutagenesis system, namely ExSite (Stratagene), and designed as scanning mutations (Fig. 1A). Deletion mutants were generated in pOri-A, which contains a 2.6-kb insert of KSHV ori-Lyt sequence (nucleotides 22409 to 25063) in a pBluescript backbone (11). Each mutant contains a small internal deletion (33 to 134 bp), and the whole set of mutants was used to scan the entire ori-Lyt core domain. Replication of pOri-A and its derivatives was measured in BCBL-1 cells, which are latently infected with KSHV and support the lytic replication of KSHV when the virus is induced to lytic phase by either chemical induction or expressing virally encoded transcription activator ORF50 (Rta). The cells were cotransfected with the wild-type or mutant ori-Lyt plasmids and the ORF50 expression vector (pCR3.1-ORF50). ORF50 (Rta) induced the lytic cycle in these cells to provide KSHV lytic replication function in trans. At 72 h posttransfection, DNAs were isolated from the cotransfected cells and digested with KpnI/SacI and KpnI/SacI/DpnI. The replicated plasmid DNA can be distinguished from the input plasmid by DpnI restriction digestion, which cleaves input DNAs that have been methylated in dam-positive E. coli strains but leaves DNA intact that has been replicated in at least one round in eukaryotic cells. In other words, newly replicated DNA in BCBL-1 cells was resistant to DpnI digestion. The cleaved DNAs were separated on agarose gels and subjected to Southern hybridization with 32P-labeled pBluescript plasmid probe. Then each deletion mutant was scored for its ability to be replicated in the viral lytic phase. As illustrated in Fig. 1, the majority of deletion mutants displayed reduced replication function in comparison with that of the wild-type ori-Lyt plasmid (pOri-A). But some mutants had greater effects on ori-Lyt-dependent DNA replication than others, such as ID6, ID7, ID8, ID9, ID15, and ID16, in which the ori-Lyt function was apparently completely abolished. To focus on the most critical elements in the ori-Lyt in our initial phase of the study, we decided to choose those mutants that retained less than 10% of wild-type ori-Lyt function for further analysis. This cutoff value let us continue to analyze the regions that were deleted in the mutants ID6, ID7, ID8, ID9, ID13, ID15, and ID16.



View larger version (44K):
[in this window]
[in a new window]
  		FIG. 1. Scanning mutation analysis of KSHV ori-Lyt for cis-acting elements. (A) Schematic diagram of two KSHV ori-Lyt and plasmid constructs of the wild-type (wt) origin and deletion mutants. The sequence elements in the ori-Lyt are illustrated by symbols including the CCAAT boxes, RRE, TATA box, and AT palindromic sequences. The homology between two duplicated ori-Lyt is indicated. The positions of wild-type ori-Lyt and each deletion are indicated with the nucleotide numbers of the KSHV genome (the numbers are according to the method of Russo et al. [17]). (B) The abilities of these constructs to mediate DNA replication were tested in BCBL-1 cells by a transient replication assay as described in Materials and Methods. KSHV lytic replication is induced by expression of ORF50 (Rta). Extrachromosomal DNAs were prepared by the Hirt extraction method and used for the assay. DpnI-resistant products of DNA replication were detected by Southern blotting with 32P-labeled pBluescript plasmid. The replicated DNAs were quantitated by PhosphorImager scanning and normalized with their total plasmid DNAs (without DpnI digestion). The replication rate of each mutant relative to that of wild-type pOri-A was calculated by comparing the intensity of the replicated (Rep'd) DNA band with that of wild type pOri-A. Each number is the average of the results from two independent experiments.

Unusually spaced C/EBP palindromic motifs are essential for the association of K8 to the ori-Lyt and DNA replication. The ori-Lyt functions were severely impaired or completely lost in mutants ID6, ID7, ID8, and ID9 (Fig. 1). Among the four mutants, ID9 had an 18-bp AT palindromic sequence deleted, and the AT palindrome has been shown to be very crucial for ori-Lyt-dependent DNA replication (11). The region covered by ID6, ID7, and ID8 lies between two AT palindromic motifs and is also critical for ori-Lyt function. Interestingly, this 240-bp region between nucleotides 23332 and 23572 falls within the region that has been shown to be required for association of the K8 protein with the ori-Lyt (11). We wondered whether the sequences that were deleted in ID6, ID7, and ID8 contain cis-acting requirements for K8 protein binding. Therefore, we examined the effects of these deletion mutants on K8 binding to ori-Lyt DNA. Biotinylated DNA fragments were synthesized by PCR with pOri-A DNA and serial deletion mutants (ID4, ID5, ID6, ID7, ID8, ID9, and ID10) as templates. The DNAs were coupled to streptavidin-conjugated magnetic beads and then incubated with nuclear extract of TPA-induced BCBL-1 cells. The bound materials were washed with 150 mM KCl-containing buffer and eluted with 300 mM KCl. Each eluted fraction was assayed by Western blotting with anti-K8 antibody. The result, as illustrated in Fig. 2, showed that K8 failed to bind to the ori-Lyt DNA with ID6, ID7, ID8, and ID9 deletions. Thus, the sequences that were deleted in these mutants (between nucleotides 23332 and 23599) are critical for K8 binding to the ori-Lyt, and the losses of ori-Lyt function in ID6, ID7, ID8, and ID9 were possibly attributed to failure of K8 protein binding to the ori-Lyt DNA.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 2. Effects of deletion mutations on binding of K8 protein to KSHV ori-Lyt. Biotinylated DNA fragments were prepared by PCR with pOri-A (wild type [wt]) DNA template and scanning mutations as described in Materials and Methods. TPA-induced BCBL-1 nuclear extract was incubated with the DNA fragments conjugated on magnetic beads, washed, and eluted with D300 elution buffer. Samples were assayed by Western blotting with anti-K8 antibody (K8{alpha}).

Then we attempted to define the cis-acting elements in the sequences that were deleted in ID6, ID7, and ID8 for K8 binding and ori-Lyt-dependent DNA replication. Inspection of the 240-bp sequence revealed eight putative C/EBP binding sites. Interestingly, these eight C/EBP sites organize as four paired palindromic sequences. All four palindromes contain two head-to-head CCAAT motifs that are separated by a 13- or 12-bp space sequence (approximately equivalent to one full turn of a DNA helix). We designated these eight C/EBP binding sites as C/EBP-1 to C/EBP-8 (Fig. 3A). To investigate the contribution of these C/EBP palindromic motifs to ori-Lyt-dependent DNA replication and K8 binding to DNA, each CCAAT consensus sequence in an ori-Lyt plasmid was mutated to GTCAT or CGTCT. These mutants were introduced into BCBL-1 cells with an ORF50/Rta expression vector and tested for ori-Lyt function in a transient replication assay (Fig. 3B). We also examined the effects of these C/EBP point mutations on K8 association to the ori-Lyt by using an in vitro binding assay (Fig. 3C). The results showed that mutation of C/EBP-1, -2, and -6 completely abolished ori-Lyt-dependent DNA replication. The ori-Lyt function was partially or fully retained with mutations on the rest of the C/EBP motif. However, every double mutation, which altered two individual C/EBP in a palindrome, led to the loss of ori-Lyt function, suggesting that all four of the C/EBP palindromes are required for ori-Lyt-dependent DNA replication (Fig. 3B). The in vitro K8 binding assay showed that K8 protein can bind to the region of the ori-Lyt when one C/EBP palindrome is mutated. However, K8 binding to the DNA became very weak when two C/EBP palindromes were mutated (Fig. 3C). Recently, Hayward and his colleagues reported that two of these four C/EBP {alpha} palindromic structures, i.e., C/EBP-1 and -2 and C/EBP-5 and -6, were able to be bound by C/EBP {alpha} in vitro. Furthermore, they also showed that C/EBP {alpha} can physically interact with K8 protein (22). Taken together, the data from our laboratory and Hayward’s laboratory suggest that the four C/EBP motifs are indeed the sites for K8 binding to ori-Lyt DNA and that the K8 binding may occur by interacting with the C/EBP {alpha}, which are bound to four C/EBP motifs. K8 can bind to ori-Lyt DNA only when all four of the C/EBP motifs have been bound by C/EBP {alpha}.





View larger version (111K):
[in this window]
[in a new window]
  		FIG. 3. Identification of four unusually spaced C/EBP palindromic motifs in KSHV ori-Lyt that are critically required for DNA replication. (A) Schematic diagram of the sequences and locations of eight C/EBP binding sites that are organized as four spaced palindromes as well as site-specific mutations on these C/EBP motifs. (B) Effects of the mutations of these C/EBP binding sites on ori-Lyt-dependent DNA replication. A transient replication assay was performed on these mutants in BCBL-1 cells, and DpnI-resistant products of DNA replication were detected by Southern blotting. The replication rate of each mutant relative to that of pOri-A was calculated by measuring the intensities of the replicated (Rep'd) DNA bands normalized with total plasmid DNA (without DpnI digestion). The experiment was repeated three times with similar results. +, present; –, absent. (C) A K8 binding assay was performed with biotinylated DNA fragments with point mutations of C/EBP binding sites (Table 1 and Fig. 3A). Samples were assayed by Western blotting with anti-K8 antibody (K8{alpha}). C, control with an irrelevant DNA; Wt, wild type.

It is interesting that the binding of K8 protein to ori-Lyt DNA was also greatly impaired in the ID9 mutant (Fig. 2) in which the 18-bp AT palindrome was deleted but all eight C/EBP binding sites were intact. This result suggests that these C/EBP motifs are required but not sufficient for K8 binding to the ori-Lyt DNA. Other sequences including the 18-bp AT palindrome have influences on K8 association with the ori-Lyt DNA.

An AT palindrome sequence in ori-Lyt is required for lytic DNA replication. In agreement with previous data (11), two AT palindromes in the ori-Lyt contribute to the ori-Lyt-dependent DNA replication. The 18-bp AT palindrome is more critical for the ori-Lyt function because deletion of the palindromic sequence in ori-Lyt plasmid ID9 completely abolished ori-Lyt-dependent DNA replication (Fig. 1). To further define the role of the 18-bp AT palindrome in ori-Lyt function, three nucleotide substitution mutations were generated by introducing G-C pairs into the AT palindromic sequence. When four G-C pairs were introduced into the first half of palindrome (pOri-M9), the ori-Lyt replication was completely lost. However, when the second half of the AT palindrome was interrupted by G-C pairs, the mutant ori-Lyt (pOri-M10) was still able to support lytic DNA replication (Fig. 4). No DNA replication was detected in a combined mutant of M9 and M10 (pOri-M9M10). This result confirmed the importance of the AT palindromic sequence in ori-Lyt function and also suggests that the AT palindrome can be shortened to the first 10 bp, in which the ori-Lyt function still remains.



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 4. The 18-bp AT palindrome is essential for KSHV ori-Lyt replication. (A) Nucleotide sequence of the wild-type (wt) 18-bp AT palindrome in the ori-Lyt and its mutants. (B) The wild-type and mutant plasmids were examined in BCBL-1 cells by a transient replication assay for their abilities to support lytic-phase DNA replication. KSHV lytic replication is induced by expression of ORF50 (Rta). Extrachromosomal DNAs were prepared by the Hirt extraction method and used for the assay. Replicated DNAs were distinguished from input DNAs by DpnI digestion and detected by Southern blotting with 32P-labeled pBluescript plasmid. The replication rate of each mutant relative to that of pOri-A was calculated by measuring the intensities of the replicated (Rep'd) and input DNA bands. +, present; –, absent.

An RRE and a TATA box are essential for ori-Lyt function. Mutant plasmids pOri-ID13, ID15, and ID16 identified two discontiguous regions that appear to be absolutely required for DNA replication (Fig. 1). These regions were further analyzed by using smaller deletions to identify cis-acting elements required for ori-Lyt function in these regions. Four smaller deletion mutants were constructed to scan the 108-bp region of pOri-ID13. These four deletion plasmids were introduced into BCBL-1 cells for transient transfection and replication assay (Fig. 5). Among these four mutants, pOri-ID13.2 had the greatest effect on DNA replication and resulted in an 85% loss of DNA replication activity. Thus, this study narrowed down the DNA sequence required for ori-Lyt function to a 32-bp region (5'-CTACCCCCAACTGTATTCAACCCTCCTTTGTTT-3'). Six smaller deletion mutants were designed to scan the region between nucleotides 24025 to 24164 that was shown to be critical for DNA replication by mutant pOri-ID15. These six deletion plasmids were introduced into BCBL-1 cells for transient replication assay (Fig. 5). The ori-Lyt function was greatly impaired in mutants pOri-ID15.3, ID-15.4, ID-15.5, and ID-15.6, suggesting that the sequence that was missing in these mutants harbors component(s) important for ori-Lyt function. Inspection of the sequences that were deleted in these four mutants revealed that a putative RRE, which is identical to the RRE in the K12 promoter and similar to the RRE in poly(A) nuclear RNA (PAN) or PAN RNA promoter (6, 20), lies in the sequence. The transient DNA replication assay showed that the putative RRE is essential for the ori-Lyt function, and partial or entire deletion of the RRE severely impaired ori-Lyt-dependent DNA replication. However, the 32-bp sequence downstream of the RRE consensus sequence also appears to be required for efficient DNA replication, as shown with the mutant ID15.6.



View larger version (62K):
[in this window]
[in a new window]
  		FIG. 5. Mutations in two discontiguous essential regions. (A) A series of small deletion mutants were constructed across the regions that were identified by ID13 and ID15-ID16. wt, wild type. (B) Each mutant plasmid was assayed in BCBL-1 cells for its ability to support lytic-phase DNA replication. KSHV lytic replication is induced by expression of ORF50 (Rta). Extrachromosomal DNAs were prepared by the Hirt extraction method and used for the assay. Replicated (Rep'd) DNAs were distinguished from input DNAs by DpnI digestion and detected by Southern blotting with 32P-labeled pBluescript plasmid. The replicated DNAs were quantitated by PhosphorImager scanning and normalized with their total plasmid DNAs (without DpnI digestion). The replication rate of each mutant relative to that of wild-type pOri-A was calculated by comparing the intensity of the replicated DNA band with that of wild-type pOri-A. Each number is the average of the results from two independent experiments.

To confirm that the RRE is bound by the ORF50/Rta protein and that ORF50/Rta binding is required for ori-Lyt-dependent DNA replication, we mutated the putative RRE by replacing 22-bp RRE consensus sequence (5'-AACATGGGTGGCTAACGCCTAC-3') with a yeast Gal4 binding motif (5'-GATCCGGAGGACTGTCCTCCGG-3'). The mutant, designated pOri-Gal4, was introduced into BCBL-1 cells with pCR3.1-ORF50 for a transient DNA replication assay. As shown in Fig. 6C, ori-Lyt function was greatly impaired in the pOri-Gal4 plasmid, again confirming a critical role of the RRE in ori-Lyt-dependent DNA replication. When a construct of the Gal4-ORF50 fusion protein (SG-C50), in which the activation domain of ORF50/Rta (205 carboxy-terminal amino acids of ORF50) is fused with the DNA binding domain of yeast protein Gal4, was included in the cotransfection, the DNA replication was found to be totally restored (Fig. 6C). It was shown previously that SG-C50 retained the full transcription function of ORF50 when targeted to DNA as a Gal4 fusion (13). As a control, pSG424, which expresses Gal4 alone, was not able to restore the DNA replication (Fig. 6C). Our result suggested that binding of ORF50/Rta to the ori-Lyt is necessary and critical for ori-Lyt-dependent DNA replication.





View larger version (159K):
[in this window]
[in a new window]
  		FIG. 6. Restoration of ori-Lyt function by Gal4-ORF50 fusion protein—evidence that association of ORF50/Rta with KSHV ori-Lyt is required for DNA replication. (A) Sequence of the consensus RRE in KSHV ori-Lyt and the mutants in which the consensus RRE has been deleted or replaced with one or two copies of yeast Gal4 binding motif (in red). (B) Schematic illustration of ORF50 structure and domains and a fusion protein in which the ORF50/Rta activation domain fused N-terminally to the DNA binding domain of yeast Gal4 protein (adapted from Lukac et al. [13]). (C) Wild-type pOri-A and pOri-Gal4 were introduced into BCBL-1 cells in the absence (–) and presence (+) of Gal4 fusion proteins (SG-C50 and SG424) in various amounts (2, 5, and 10 µg) and ORF50 expression vectors. The pOri-Gal4 plasmid was assayed for its ability to support lytic-phase DNA replication. (D) Wild-type pOri-A, pOri-Gal4{Delta}6, and pOri-2xGal4 were introduced into BCBL-1 cells. DNA replication in the absence and presence of the SG-C50 fusion protein and ORF50/Rta was analyzed by a DNA replication assay. Replicated (Rep'd) DNAs were distinguished from input DNAs by DpnI digestion and detected by Southern blotting with 32P-labeled pBluescript plasmid.

Since the 32-bp sequence downstream of the consensus RRE was also found to contribute to ori-Lyt-dependent DNA replication, we sought to determine, if the 32-bp sequence is deleted, whether an ORF50 or a fusion protein binding to the ori-Lyt is able to support the DNA replication. We replaced the RRE and the following 32-bp sequence (54 bp in total) with a Gal4 binding motif (designated pOri-Gal4{Delta}6) and examined it in a transient DNA replication assay in the presence and absence of SG-C50 fusion protein. The results showed that the SG-C50 fusion protein could not restore the DNA replication of pOri-Gal4{Delta}6 (Fig. 6D). However, DNA replication was restored when two copies of Gal4 binding motifs were used to replace the 54-bp sequence (designated pOri-2XGal4) and the SG-C50 fusion protein was included in the replication assay (Fig. 6D). This result suggested that the 32-bp sequence may serve as another RRE or a binding motif for another transactivator and that KSHV DNA replication needs an ORF50/Rta dimer, either homodimer or heterodimer, binding to the 54-bp bipartite RRE sequence.

Similarly, three smaller deletion mutants were designed to scan the region between nucleotides 24165 and 24252 that was identified by mutant pOri-ID16. A transient DNA replication assay with these three mutants showed that removal of the 25-bp sequence from nucleotide 24190 to 24224 (pOri-ID16.2) resulted in the complete loss of ori-Lyt function. The most remarkable sequence in the 25-bp region is a TATA consensus motif. It is likely that this TATA box is indispensable for ori-Lyt function.

Identification of transcription promoter within KSHV ori-Lyt and its transcript. The presence of an RRE and a downstream TATA box within the ori-Lyt suggests that there is an ORF50/Rta-dependent promoter. We can further speculate that a transcription event may be necessary for ori-Lyt-dependent DNA replication. To examine whether the RRE and TATA box indeed constitute an ORF50/Rta-dependent promoter, we made reporter constructs in which various ori-Lyt DNA sequences that contain the RRE, TATA box, and 100-bp downstream sequence were cloned into the pGL3-basic vector right in front of the firefly luciferase coding sequence (Fig. 7A). These constructs were cotransfected into KSHV-negative BJAB and KSHV-positive BCBL-1 cells with pCR3.1-ORF50 or empty pCR3.1 plasmids for ORF50-dependent promoter activities. The results showed that in the presence of ORF50/Rta, the transcription activities of 4F, which contained an ori-Lyt sequence between nucleotides 23331 and 24342, were 236-fold higher than that of empty vector pGL3 in BJAB cells (Fig. 7B). Similarly, in BCBL-1 cells, the transcription activities of 4F were 2,056-fold higher than that of pGL3 (Fig. 7C). The promoter activities of the constructs were ORF50-inducible because its transcription activities were elevated up to 20- and 12-fold by ORF50/Rta in BJAB and BCBL-1 cells, respectively (Fig. 7). Progressive deletion of the ori-Lyt sequence from the 5' end up to nucleotide 24093 (10F, 12F, and 13F) had a trivial effect on the promoter activity and the responsiveness to ORF50/Rta, suggesting that the sequence upstream of the RRE (including the K8 binding region) is not involved in the transcription activity. To further characterize the ori-Lyt-associated promoter, several mutants were constructed based on 13F as illustrated in Fig. 7A. When the TATA box was deleted from 13F plasmid (13F{Delta}TATA), the majority of transcription activity was lost in both BJAB and BCBL-1 cells (Fig. 7B and C). Deletion of the 17-bp RRE consensus sequence (AACATGGGTGGCTAACG) (13F{Delta}RRE) resulted in a reduction of luciferase activity by 57% in BJAB cells and 71% in BCBL-1 cells, but the mutant still displayed considerable responsiveness to ORF50-Rta induction (5-fold induction in BJAB cells, 11-fold induction in BCBL cells). However, removal of the RRE and its following 32-bp sequence (13F{Delta}7) brought about greater reduction in both luciferase activities (93% in both BL41 and BCBL-1 cells) and ORF50 responsiveness. The data strongly suggest that the RRE is not restricted in the 22-bp consensus sequence but extends to the whole 54-bp sequence. Replacement of the whole RRE (54 bp) with one or two copies of yeast Gal4 binding sequence (GATCCGGAGGACTGTCCTCCGG) caused 90 to 96% loss in both BJAB and BCBL-1 cells of ORF50-dependent transcription activities. When a Gal4-ORF50 fusion protein (SG-C50) was included in a cotransfection, the transcription activity of 13F-Gal4 was induced 51-fold in BJAB cells and 120-fold in BCBL-1 cells in the absence of ORF50/Rta. However, the presence of ORF50 brought about additional three- and fivefold increases in transcription activities in BCBL-1 and BJAB cells, respectively (Fig. 7). In addition, SG-C50 caused a greater induction of luciferase activity of the construct in which the RRE has been replaced with two copies of Gal4 binding motif (13F-2xGal4). In the absence of ORF50, SG-C50 induced the transcription activities of the 13F-2xGal4 construct 2,298-fold in BJAB cells and 2,566-fold in BCBL-1 cells. Obviously, two SG-C50 molecules synergistically stimulated transcription of the promoter. In summary, the data from the luciferase assays demonstrated that the region, which was identified to be critical for ori-Lyt function by mutants ID-15 and ID-16, serves as an ORF50/Rta-dependent promoter and may direct an ori-Lyt-associated transcription. It was also suggested that there are two RRE motifs in the 54-bp region which are bound by two ORF50/Rta molecules or an ORF50 dimer. Taken together with the transient replication assays with ori-Lyt mutants and Gal4-ORF50 fusion proteins, our data indicate that this ORF50-dependent promoter is critical for lytic DNA replication.

To examine whether there is a transcription event occurring downstream of the ORF50-dependent promoter, we carried out a Northern analysis of mRNAs isolated from virally latent and reactivated BC-1 cells. The Northern blot was hybridized with a single-stranded DNA probe from nucleotide 25600 to 24250. As shown in Fig. 8A, the Northern analysis identified a rightward RNA transcript of around 1.4 kb which is absent in the latent phase but induced in the viral lytic life cycle. Interestingly, the transcription of the RNA was inhibited by phosphonoacetic acid (PAA), suggesting the transcription is coupled with viral lytic DNA replication. In contrast, the transcription of the K8 gene was not affected by PAA (Fig. 8B).



View larger version (43K):
[in this window]
[in a new window]
  		FIG. 8. Northern analysis of transcripts downstream of the ori-Lyt-associated promoter. Poly(A+) RNAs were isolated from BC-1 cells that had been treated with sodium butyrate for various times in the absence (–) or presence (+) of cycloheximide (cyclo) and PAA as indicated above each lane. These RNAs were separated on a 1.0% agarose-formaldehyde gel and transferred onto Nytran membranes. The membranes were probed with 32P-labeled single-stranded DNA probes that were complementary to the sequence from nucleotide 25428 to 24250 (5' to 3') (A) and K8 mRNA (B). Molecular marker, 0.24- to 9.5-kb RNA ladder.

The full-length cDNAs for the 1.4-kb ori-Lyt-associated RNA were obtained by a PCR-based cDNA amplification procedure and then cloned and sequenced. The 5' and 3' ends of the RNA were determined by using a RACE approach. The results revealed that the 5' end of the RNA is at or near nucleotide 24243, 30 bp downstream of the TATA box. The RNA terminates at nucleotide 25442, 16 nucleotides downstream of a consensus AAUAAA polyadenylation signal, and is followed by a poly(A) tail (Fig. 9). The sequence of the RNA consists of the whole GC-rich direct repeat region and is followed by an ORF of 75 amino acids (Fig. 9).



View larger version (58K):
[in this window]
[in a new window]
  		FIG. 9. Nucleotide sequence of the ori-Lyt-associated transcript and its predicted ORF. The amino acid sequence deduced from the cDNA sequence is depicted beneath each line of nucleotide sequence.


arrow
DISCUSSION
 
Multipartite and complex structure of KSHV ori-Lyt. The goal of this study is to dissect the KSHV ori-Lyt and determine the cis-acting components that are essential for ori-Lyt function. Initially, 16 deletion mutants were engineered across the 1.1-kb core domain of a KSHV ori-Lyt and tested for the origin function. This assay led to the identification of four regions that are absolutely required for ori-Lyt-dependent DNA replication. Then these regions were further analyzed by using smaller deletions, and some notable motifs within these regions were further examined by substitution mutations. This study allows us to identify cis-acting elements of the origin and to assign functions to some of the elements. The most critical cis-acting elements are as follows: (i) eight C/EBP binding motifs, arranged as four spaced palindromes, that appear to be associated with K8 protein through interacting with C/EBP {alpha}; (ii) an 18-bp AT palindromic sequence that is believed to involve local unwinding of double-stranded DNA during the initiation of replication; (iii) a 32-bp sequence that had no previously assigned function; and (iv) an ORF50/Rta-dependent promoter which is composed of an RRE closely resembling the RRE in the K12 and PAN RNA promoters and a TATA box.

In addition to the mutants that had any of the four crucial cis-acting elements deleted, many other deletions also displayed reduced ori-Lyt replication activity (Fig. 1). The regions, represented by the deletion mutants that produced significantly reduced (but not abolished) ori-Lyt activities, determine the relative efficiency of ori-Lyt function. These DNA sequences may either have auxiliary functions for ori-Lyt-dependent DNA replication or simply provide space requirements between two components of the ori-Lyt. The nature of our scanning deletion mutants could not distinguish these two possibilities. Thus, to focus our study on the most critical cis-acting elements, we decided to set up a cutoff value in which only those mutants that retained 10% ori-Lyt function or less would be further analyzed in detail. The other regions that only had moderate effects on ori-Lyt function were left for future studies.

Association of K8 protein with ori-Lyt through C/EBP binding motifs. A virally encoded bZip protein, namely K8, was found to bind to the KSHV ori-Lyt. Further analysis showed that a stable K8 binding to DNA requires an extended DNA sequence between nucleotides 23128 and 23635 (11). The region that is required for K8 binding to ori-Lyt DNA is 100% conserved between two KSHV ori-Lyt. K8 protein displays significant similarity to the Zta protein of EBV, which is known to be an OBP of EBV (8). Therefore, it is suggested that K8 may function as an OBP of KSHV.

The most striking structural feature in the 500-bp sequence that K8 binds is eight C/EBP consensus motifs that are arrayed as four spaced palindromic pairs. The mutagenesis studies showed that three of these C/EBP sites (C/EBP-1, -2, and -6) are essential for ori-Lyt function and that mutations in any of these three C/EBP motifs completely abolished ori-Lyt-dependent DNA replication. In addition, every C/EBP palindrome is indispensable for ori-Lyt function. In parallel, deletion or mutation of these C/EBP motifs also impaired the binding of K8 to the ori-Lyt, suggesting that K8 may bind to the ori-Lyt through these C/EBP motifs. However, in spite of great efforts, we were unable to demonstrate any direct binding of K8 protein to the region that harbors these C/EBP motifs by electrophoretic mobility shift assay (11). Recently, Wu et al. (22) showed that C/EBP {alpha} can bind to four of these C/EBP sites (C/EBP-1, -2, -5, and -6). Furthermore, they also demonstrated that K8 protein specifically associated with C/EBP {alpha}. Taken together, these data implied that K8 binds to KSHV ori-Lyt through interacting with DNA-bound C/EBP {alpha}. We do not know whether K8 binds to DNA through C/EBP {alpha} in a piggybacking fashion or whether K8 can directly bind DNA while C/EBP {alpha} stabilizes the binding. But it is clear that both K8 and C/EBP {alpha} are important components for KSHV ori-Lyt-dependent DNA replication.

In EBV, seven Zta-responsive elements (ZREs) were found in its ori-Lyt domain. Among them, four ZREs (designated ZRE1 to ZRE4) are necessary and sufficient to activate lytic replication. The other three (ZRE5 to ZRE7) have no or only very marginal influence on the replication efficiency (18). Similarly, there are eight C/EBP motifs in KSHV ori-Lyt that are the sites for K8 and C/EBP {alpha} binding. They were also shown to be essential for ori-Lyt-dependent DNA replication. Although Zta of EBV can bind to its ZREs efficiently by itself while K8 binds to C/EBP sites in the aid of C/EBP {alpha} molecules, once they bind to ori-Lyt, they are likely to exercise the same function for the activation of ori-Lyt. In both viruses, the biochemical basis for the activation of ori-Lyt by Zta or K8 has not been elucidated yet. It was hypothesized that binding of Zta to four sites within the EBV ori-Lyt may cause linking and distortion of the origin which could be a prerequisite for ori-Lyt-dependent DNA replication (19). We think that K8 may play the same role as Zta does in ori-Lyt activation. We further hypothesize that four K8 molecules or a K8 tetramer binds four C/EBP sites by interacting with C/EBP {alpha} proteins and causing a structure change in the ori-Lyt domain. As a result, DNA replication compartments form in the altered structure of the ori-Lyt and DNA replication begins.

Role of AT palindromes in ori-Lyt-dependent DNA replication. There are two perfect AT palindromic sequences in a KSHV ori-Lyt, i.e., a 16-bp AT palindrome and an 18-bp AT palindrome. Although both of them were found to contribute to maximal DNA replication of the ori-Lyt, the 18-bp AT palindrome is more critical for the ori-Lyt function because deletion or mutation of the AT palindrome abolished the ori-Lyt function completely (Fig. 1 and 4). An AT-rich palindrome is a common feature of both cellular and viral DNA replication origins (5, 12). It is believed that an AT-rich palindrome facilitates DNA unwinding and enhances helicase activity during replication. Our mutagenesis study showed that introduction of G-C pairs into the first half of the 18-bp AT palindrome completely abolished ori-Lyt-dependent DNA replication while mutations in the second half of the palindrome had little effect on the ori-Lyt function. There are two implications in this result: (i) the AT palindrome can be shortened to 10 bp and its function remains and (ii) besides the possible function as a DNA unwinding region, the AT palindrome may have an additional function such as serving as a protein binding site. The second implication came from three considerations as follows. (i) The different effects of the mutations in the first and second halves of the palindrome suggested that facilitating DNA unwinding may not be the only function of the AT-rich sequence. (ii) Our result showed that the 18-bp AT palindrome had an influence on K8 binding to the ori-Lyt (Fig. 2C). (iii) In the adenovirus origin, an AT-rich sequence is the DNA binding site for proteins involved in the initiation of DNA replication (7).

RRE in the origin and ori-Lyt-associated RNA transcription. The mutagenesis study revealed the requirement of an RRE and a downstream TATA box for lytic DNA replication. Using a Gal4-ORF50 fusion protein and pOri-Gal4 mutants, where the RRE consensus sequence has been replaced by a Gal4 binding motif, we provided evidence that binding of ORF50/Rta to the RRE in the ori-Lyt is necessary and essential for DNA replication. It was also shown by using a luciferase reporter system that the RRE and the TATA box constitute a promoter for a transcription in the ori-Lyt [ori-Lyt (L)]. A similar sequence in the other ori-Lyt [i.e., ori-Lyt (R)] was known to serve as a promoter for K12 (6). In addition, the luciferase reporter assay and transient replication assay consistently suggested that an ORF50/Rta dimer, either homodimer or heterodimer, may bind an extended RRE region (54 bp). Binding of two ORF50 or fusion proteins to the bipartite element synergistically stimulates transcription of the promoter. Also, binding of two ORF50 or fusion proteins to the extended RRE region is required for ori-Lyt-dependent DNA replication.

The ori-Lyt-associated transcript was identified as a 1.4-kb rightward polyadenylated RNA by Northern analysis. The full-length cDNAs of the RNA were generated by using a PCR-based cDNA amplification strategy. The most striking feature of this RNA is the GC-rich tandem repeat sequences in its 5' half of the molecule. An ORF of 75 amino acids is seen in the 3' approximate sequence of the RNA. We do not know whether the ORF in the 1.4-kb RNA is translated or not.

A promoter is present within the EBV ori-Lyt and is essential for lytic DNA replication. When the promoter was deleted, the ori-Lyt function was lost. However, when the promoter is replaced with a human cytomegalovirus immediate-early promoter, the EBV ori-Lyt function was restored (10). The EBV ori-Lyt promoter controls the transcription of BHLF1 RNA, which encompasses the entire GC-rich tandem repeat region. The function of the transcript is unknown. Overall, the KSHV ori-Lyt promoter and related transcript share some similarity with those found in the EBV ori-Lyt. The roles of these promoters in KSHV and EBV ori-Lyt-dependent DNA replication need to be explored.

The importance of the RRE and TATA box for the ori-Lyt function strongly suggested that a transcription event is necessary for ori-Lyt-dependent DNA replication. However, it should be noted that transient assays may not accurately reflect regulation in the context of the viral genome, and the role of the RRE in that context remains to be established. In addition, it is interesting that the ori-Lyt-associated transcription is inhibited in the presence of viral DNA polymerase inhibitor PAA (Fig. 8). Since PAA acts on viral DNA polymerase and does not inhibit ORF50/Rta-dependent transcription of viral delayed-early genes such as K8 (as shown in Fig. 8), the role of ORF50/Rta in transcription and DNA replication appears to be more sophisticated than simply serving as a transcription activator. It appears that there is a reciprocal interaction between DNA replication and transcription, and ORF50/Rta is directly involved in both events. Besides being a transcription activator, ORF50/Rta may also participate in directing the assembly of replication complexes that remodel the chromosome context and/or in recruiting specific proteins required for initiation of DNA synthesis, which could be an antecedent event to activation of transcription in the viral genome context.


arrow
ACKNOWLEDGMENTS
 
This work was supported by research grants from the National Institutes of Health (R01CA86839 and R01AI52789).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, School of Dental Medicine, University of Pennsylvania, 240 S. 40th St., Philadelphia, PA 19104. Phone: (215) 573-7556. Fax: (215) 898-8385. E-mail: yuan2{at}pobox.upenn.edu. Back


arrow
REFERENCES
 
    1
  1. AuCoin, D. P., K. S. Colletti, Y. Xu, S. A. Cei, and G. S. Pari. 2002. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) contains two functional lytic origins of DNA replication. J. Virol. 76:7890-7896.[Abstract/Free Full Text]
    2. 2
  2. Ballestas, M. E., and K. M. Kaye. 2001. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 mediates episome persistence through cis-acting terminal repeat (TR) sequence and specifically binds TR DNA. J. Virol. 75:3250-3258.[Abstract/Free Full Text]
    3. 3
  3. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284:641-644.[Abstract/Free Full Text]
    4. 4
  4. Cesarman, E., P. S. Moore, P. H. Rao, G. Inghirami, D. M. Knowles, and Y. Chang. 1995. In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 86:2708-2714.[Abstract/Free Full Text]
    5. 5
  5. Challberg, M. D., and T. J. Kelly, Jr. 1989. Animal virus DNA replication. Annu. Rev. Biochem. 58:671-717.[CrossRef][Medline]
    6. 6
  6. Chang, P.-J., D. Shedd, L. Gradoville, M.-S. Cho, L.-W. Chen, J. Chang, and G. Miller. 2002. Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements. J. Virol. 76:3168-3178.[Abstract/Free Full Text]
    7. 7
  7. De Pamphilis, M. L. 1993. Origins of DNA replication that function in eukaryotic cells. Curr. Opin. Cell Biol. 5:434-441.[CrossRef][Medline]
    8. 8
  8. Fixman, E. D., G. S. Hayward, and S. D. Hayward. 1995. Replication of Epstein-Barr virus oriLyt: lack of a dedicated virally encoded origin-binding protein and dependence on Zta in cotransfection assays. J. Virol. 69:2998-3006.[Abstract]
    9. 9
  9. Gradoville, L., J. Gerlach, E. Grogan, D. Shedd, S. Nikiforow, C. Metroka, and G. Miller. 2000. Kaposi's sarcoma-associated herpesvirus open reading frame 50/Rta protein activates the entire viral lytic cycle in the HH-B2 primary effusion lymphoma cell line. J. Virol. 74:6207-6212.[Abstract/Free Full Text]
    10. 10
  10. Hammerschmidt, W., and B. Sugden. 1988. Identification and characterization of oriLyt, a lytic origin of DNA replication of Epstein-Barr virus. Cell 55:427-433.[CrossRef][Medline]
    11. 11
  11. Lin, C. L., H. Li, Y. Wang, F. X. Zhu, S. Kudchodkar, and Y. Yuan. 2003. Kaposi's sarcoma-associated herpesvirus Ori-Lyt-dependent DNA replication: identification of the Ori-Lyt and association of K8 bZIP protein with the origin. J. Virol. 77:5578-5588.[Abstract/Free Full Text]
    12. 12
  12. Lockshorn, D., and D. A. Galloway. 1988. Sequence and structural requirements of a herpes simplex viral DNA replication origin. Mol. Cell. Biol. 8:4018-4027.[Abstract/Free Full Text]
    13. 13
  13. Lukac, D. M., J. R. Kirshner, and D. Ganem. 1999. Transcriptional activation by the product of the open reading frame 50 of Kaposi's-associated herpesvirus is required for lytic viral reactivation in B cells. J. Virol. 73:9348-9361.[Abstract/Free Full Text]
    14. 14
  14. Miller, G., L. Heston, E. Grogan, L. Gradoville, M. Rigsby, R. Sun, D. Shedd, V. M. Kushnaryov, S. Grossberg, and Y. Chang. 1997. Selective switch between latency and lytic replication of Kaposi's sarcoma herpesvirus and Epstein-Barr virus in dually infected body cavity lymphoma cells. J. Virol. 71:314-324.[Abstract]
    15. 15
  15. Nicholas, J., J. Zong, D. Alcendor, D. M. Ciufo, L. Poole, R. T. Sarisky, C. Chiou, X. Zhang, X. Wan, H. Guo, M. Reitz, and G. S. Hayward. 1998. Novel organizational features, captured cellular genes, and strain variability within the genome of KSHV/HHV8. J. Natl. Cancer Inst. Monogr. 23:79-88.
    16. 16
  16. Renne, R., W. Zhong, B. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342-346.[CrossRef][Medline]
    17. 17
  17. Russo, J. J., R. A. Bohenzky, M.-C. Chien, J. Chen, M. Yan, D. Maddalena, J. P. Parry, D. Peruzzi, I. S. Edelman, Y. Chang, and P. S. Moore. 1996. Nucleotide sequence of the Kaposi's sarcoma-associated herpesvirus (HHV8). Proc. Natl. Acad. Sci. USA 91:14862-14867.
    18. 18
  18. Schepers, A., D. Pich, and W. Hammerschmidt. 1996. Activation of oriLyt, the lytic origin of DNA replication of Epstein-Barr virus, by BZLF1. Virology 220:367-376.[CrossRef][Medline]
    19. 19
  19. Schepers, A., D. Pich, and W. Hammerschmidt. 1993. A transcription factor with homology to the AP-1 family links RNA transcription and DNA replication in the lytic cycle of Epstein-Barr virus. EMBO J. 12:3921-3929.[Medline]
    20. 20
  20. Song, M. J., H. J. Brown, T. T. Wu, and R. Sun. 2001. Transcription activation of polyadenylated nuclear RNA by Rta in human herpesvirus 8/Kaposi's sarcoma-associated herpesvirus. J. Virol. 75:3129-3140.[Abstract/Free Full Text]
    21. 21
  21. Wu, F. Y., J. Ahn, D. J. Alcendor, W. Jang, J. Xiao, S. D. Hayward, and G. S. Hayward. 2001. Origin-independent assembly of Kaposi's sarcoma-associated herpesvirus DNA replication compartments in transient cotransfection assays and association with the ORF-K8 protein and cellular PML. J. Virol. 75:1487-1506.[Abstract/Free Full Text]
    22. 22
  22. Wu, F. Y., S. E. Wang, Q.-Q. Tang, M. Fujimuro, C.-J. Chiou, Q. Zheng, H. Chen, S. D. Hayward, M. D. Lane, and G. S. Hayward. 2003. Cell cycle arrest by Kaposi's sarcoma-associated herpesvirus replication-associated protein is mediated at both the transcriptional and posttranslational levels by binding to CCAAT/enhancer-binding protein and p21CIP-1. J. Virol. 77:8893-8914.[Abstract/Free Full Text]

Journal of Virology, August 2004, p. 8615-8629, Vol. 78, No. 16
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.16.8615-8629.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Chang, P.-J., Shedd, D., Miller, G. (2008). A Mobile Functional Region of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein Independently Regulates DNA Binding and Protein Abundance. J. Virol. 82: 9700-9716 [Abstract] [Full Text]  
  • Wang, Y., Li, H., Tang, Q., Maul, G. G., Yuan, Y. (2008). Kaposi's Sarcoma-Associated Herpesvirus ori-Lyt-Dependent DNA Replication: Involvement of Host Cellular Factors. J. Virol. 82: 2867-2882 [Abstract] [Full Text]  
  • Kato-Noah, T., Xu, Y., Rossetto, C. C., Colletti, K., Papouskova, I., Pari, G. S. (2007). Overexpression of the Kaposi's Sarcoma-Associated Herpesvirus Transactivator K-Rta Can Complement a K-bZIP Deletion BACmid and Yields an Enhanced Growth Phenotype. J. Virol. 81: 13519-13532 [Abstract] [Full Text]  
  • Palmeri, D., Spadavecchia, S., Carroll, K. D., Lukac, D. M. (2007). Promoter- and Cell-Specific Transcriptional Transactivation by the Kaposi's Sarcoma-Associated Herpesvirus ORF57/Mta Protein. J. Virol. 81: 13299-13314 [Abstract] [Full Text]  
  • Carroll, K. D., Khadim, F., Spadavecchia, S., Palmeri, D., Lukac, D. M. (2007). Direct Interactions of Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 ORF50/Rta Protein with the Cellular Protein Octamer-1 and DNA Are Critical for Specifying Transactivation of a Delayed-Early Promoter and Stimulating Viral Reactivation. J. Virol. 81: 8451-8467 [Abstract] [Full Text]  
  • Bu, W., Carroll, K. D., Palmeri, D., Lukac, D. M. (2007). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 ORF50/Rta Lytic Switch Protein Functions as a Tetramer. J. Virol. 81: 5788-5806 [Abstract] [Full Text]  
  • Wang, Y., Tang, Q., Maul, G. G., Yuan, Y. (2006). Kaposi's Sarcoma-Associated Herpesvirus ori-Lyt-Dependent DNA Replication: Dual Role of Replication and Transcription Activator. J. Virol. 80: 12171-12186 [Abstract] [Full Text]  
  • Xu, Y., Rodriguez-Huete, A., Pari, G. S. (2006). Evaluation of the Lytic Origins of Replication of Kaposi's Sarcoma-Associated Virus/Human Herpesvirus 8 in the Context of the Viral Genome. J. Virol. 80: 9905-9909 [Abstract] [Full Text]  
  • Grundhoff, A., Sullivan, C. S., Ganem, D. (2006). A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses. RNA 12: 733-750 [Abstract] [Full Text]  
  • Ziegelbauer, J., Grundhoff, A., Ganem, D. (2006). Exploring the DNA Binding Interactions of the Kaposi's Sarcoma-Associated Herpesvirus Lytic Switch Protein by Selective Amplification of Bound Sequences In Vitro. J. Virol. 80: 2958-2967 [Abstract] [Full Text]  
  • Taylor, J. L., Bennett, H. N., Snyder, B. A., Moore, P. S., Chang, Y. (2005). Transcriptional Analysis of Latent and Inducible Kaposi's Sarcoma-Associated Herpesvirus Transcripts in the K4 to K7 Region. J. Virol. 79: 15099-15106 [Abstract] [Full Text]  
  • Bechtel, J., Grundhoff, A., Ganem, D. (2005). RNAs in the Virion of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 79: 10138-10146 [Abstract] [Full Text]  
  • Matsumura, S., Fujita, Y., Gomez, E., Tanese, N., Wilson, A. C. (2005). Activation of the Kaposi's Sarcoma-Associated Herpesvirus Major Latency Locus by the Lytic Switch Protein RTA (ORF50). J. Virol. 79: 8493-8505 [Abstract] [Full Text]  
  • Al Mehairi, S., Cerasoli, E., Sinclair, A. J. (2005). Investigation of the Multimerization Region of the Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Protein K-bZIP: the Proposed Leucine Zipper Region Encodes a Multimerization Domain with an Unusual Structure. J. Virol. 79: 7905-7910 [Abstract] [Full Text]  
  • Colletti, K. S., Xu, Y., Yamboliev, I., Pari, G. S. (2005). Human Cytomegalovirus UL84 Is a Phosphoprotein That Exhibits UTPase Activity and Is a Putative Member of the DExD/H Box Family of Proteins. J. Biol. Chem. 280: 11955-11960 [Abstract] [Full Text]  
  • Xu, Y., AuCoin, D. P., Huete, A. R., Cei, S. A., Hanson, L. J., Pari, G. S. (2005). A Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 ORF50 Deletion Mutant Is Defective for Reactivation of Latent Virus and DNA Replication. J. Virol. 79: 3479-3487 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Y.
Right arrow Articles by Yuan, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.
Right arrow Articles by Yuan, Y.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»