,1,
Markus Wagner,2,
Astrid Krmpoti
,1
Tanja Saulig,1
Sungjin Kim,3
Wayne M. Yokoyama,3
Stipan Jonji
,1* and
Ulrich H. Koszinowski2
Department of Histology and Embryology, Faculty of Medicine, University of Rijeka, 51000 Rijeka, Croatia,1 Max von Pettenkofer Institute, LMU, D-80336 Munich, Germany,2 Howard Hughes Medical Institute, Rheumatology Division, Washington University School of Medicine, St. Louis, Missouri 631103
Received 10 November 2003/ Accepted 12 March 2004
| ABSTRACT |
|---|
|
|
|---|
m157 inhibitory phenotype was weak because MCMV encodes a number of proteins that mediate NK inhibition, whose contribution could be shown by another mutant. | INTRODUCTION |
|---|
|
|
|---|
The Cmv1r (Ly49h) gene encodes the Ly49H receptor (5, 9, 23, 24), which belongs to the Ly49 family of NK cell receptors and is expressed on approximately 50% of NK cells in C57BL/6 mice (41, 43, 47). Unlike the inhibitory Ly49 receptors, Ly49H lacks the immunoreceptor tyrosine-based inhibition motif and is noncovalently coupled with DAP12 at the cell surface, allowing transduction of an activation signal into the cell via its immunoreceptor tyrosine-based activation motif (16, 43) that is required for resistance to MCMV (40). However, Ly49H does not define resistance to vaccinia virus and gammaherpesvirus 68 (2, 12).
Unlike other members of the Ly49 receptor family, which use major histocompatibility complex (MHC) class I molecules as their cellular ligands, Ly49H binds to at least one MCMV-encoded protein, the m157 gene product (2, 42). The m157 protein has structural homology to MHC class I molecules, similar to several other proteins encoded by MCMV m145 gene family members (42). An MCMV deletion mutant restricted Ly49H activation to 15 genes in the HindIII-E region (2). Isolated open reading frames (ORFs) from this region, with the exception of m157, failed to activate Ly49H. However, a similar contribution of other genes in this region cannot be excluded since certain cytomegalovirus proteins encoded by different genes can only be expressed as a complex (27). Therefore, it remained an open question whether m157 is the only viral gene that contributes to MCMV resistance defined by Ly49H.
To investigate the biological relevance of the m157 gene, we constructed an m157 deletion mutant, as well as the corresponding revertant virus. We studied the susceptibility of these recombinant viruses to control by NK cells in vivo in Ly49H+ and Ly49H mouse strains. Loss of the m157 gene is associated with gain of virulence in Ly49H+ but not in Ly49H mouse strains. Therefore, m157 is the only MCMV-encoded protein that activates Ly49H+ NK cells. The absence of the gene that encodes this protein in the m157 deletion mutant gave us the opportunity to reveal the function of viral genes that down-modulate NK cell activity in Cmv1r mice. Cmv1 has been defined as a locus of resistance to MCMV, influencing virus control mainly in the spleen (37). Furthermore, since we could define m157 as the only MCMV-encoded ligand for the Ly49H receptor, we could also address the question of NK cell control of infection at a different site of infection.
| MATERIALS AND METHODS |
|---|
|
|
|---|
MS94.5 virus, which possesses a deletion of 15 genes (m151 to m165) is described elsewhere (46). All viruses were propagated on third-passage BALB/c mouse embryonic fibroblasts (MEFs) and purified by sucrose cushion centrifugation. Tissue culture-grown virus preparations were used for mouse inoculations. Cells of the mouse macrophage cell line IC-21 were obtained from the American Type Culture Collection (ATCC catalog no. TIB-186) and were grown in RPMI 1640 medium supplemented with 10% fetal calf serum.
Plasmid construction. Plasmid pori6k-pA, which contains the Zeocin resistance gene, the poly(A) signal from BHG, the origin of replication (ori6k), and an additional 34-bp FRT site, was generated by ligation of a 353-bp KpnI/PvuII fragment from plasmid pCDNA4TO (Invitrogen) into the KpnI/EcoRV sites of plasmid pori6kZeo (A. Bubeck, M. Wagner, Z. Ruzsics, M. Iglesias, I. R. Singh, and U. H. Koszinowski, submitted for publication). With primers SpeI-nt215895-918 and SpeI-nt217226-250 and pSM3fr as the template DNA, the m157 gene and its putative promoter (nucleotide [nt] positions 215895 to 217250, as described in reference 33) were amplified by PCR and inserted into the SpeI site of plasmid pori6k-pA, thereby generating plasmid pori6k-m157-pA. The correct amplification of the m157 promoter and the m157 gene was confirmed by sequencing with primers M157-1 (5'-TGTTGACCGCCATCTGTTCTTGA), M157-2rev (5'-GGTAAGATTAATATTCAAGGATCA), and M157-3 (5'-GGATTGAAAATTGTTACAGCACG) (data not shown).
Insertion of an FRT site into MCMV BAC pSM3fr between genes m16 and m17. Mutagenesis of the MCMV BACs was performed as previously described (49). The insertion of a 48-bp FRT site (5'-GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3') into the intergenic region between MCMV ORFs m16 and m17 (nt positions 15678 to 15748) was achieved as follows. A linear PCR fragment containing a kanamycin resistance gene flanked by two 48-bp FRT sites and viral homologies to the noncoding region between ORFs m16 and m17 was generated by PCR with primers 5-m16-FRT-Kan-pCP15 (5'-CCCTCTTAATCATGACAATTATAAGTGTCTTATACGCAATACTTTTATCATAATTCGGGGGTGTCCAGGGTTTTCCC) and 3-m17-FRT-Kan-pCP15 (5'-GAGGAATAGGAATAACTCACCACCGATTTCAGCGTCTGCCCCAAGTCTGACTTCCGGCTCGTATGTTGTGTGG) and plasmid pCP15 (8). This fragment was inserted into pSM3fr by homologous recombination in Escherichia coli, thereby deleting 70 bp of the noncoding region between these two genes (nt positions 15678 to 15748). The kanamycin resistance-encoding gene was subsequently excised by FLP-mediated site-directed recombination as described previously (49), leaving only one FRT site, which can be used for site-directed insertion of any gene of interest into this site. The correct mutagenesis of resulting MCMV BAC pSM3fr-FRT was confirmed by restriction pattern analysis and sequencing of the m16-m17 genome region with primers MCMV-15461-down (5'-GAAGTCCATGTATCTCCTTCA) and MCMV-15939-up (5'-TCGGACAAATTCTAAACCTCG) (data not shown). The w.t.-FRT-MCMV strain generated from pSM3fr-FRT was shown to replicate to w.t. MCMV titers in NIH 3T3 fibroblasts and also in the lungs, spleens, and livers of BALB/c mice infected with 2 x 105 PFU at days 3 and 7 postinfection (data to be published elsewhere). This confirmed that the insertion of short sequences into this intergenic genome region does not significantly interfere with virus replication in vitro or in vivo.
Deletion of the m157 ORF in MCMV BACs pSM3fr and pSM3fr-FRT.
For deletion of the m157 ORF in the respective MCMV BACs, a linear DNA fragment was generated by PCR with primers 5-m157-Kan (5'-CGTGGTCAAGCCGGTCGTGTTGTACCAGAACTCGACTTCGGTCGCGTTCGATTTATTCAACAAAGCCACG) and 3-m157-Kan and plasmid pACYC177 as the template DNA. This fragment was subsequently inserted into MCMV BACs pSM3fr and pSM3fr-FRT, respectively, by homologous recombination in E. coli as described previously (49), generating recombinant MCMV BACs p
m157 and p
m157-FRT. These genomes lack most parts of the m157 gene, including the ATG start codon (nt positions 216291 to 216874).
Reinsertion of the m157 gene, including its promoter, at an ectopic position into the m157 deletion genome.
For reinsertion of the m157 ORF including its promoter and an additional poly(A) signal from BHG into MCMV BAC p
m157-FRT at the ectopic position between genes m16 and m17, a linear DNA fragment that contains these elements and an additional Zeocin resistance gene was generated by PCR with primers 5-m157-Zeo-m16/17 (5'-CCCTCTTAATCATGACAATTATAAGTGTCTTATACGCAATACTTTTATCATAATACATGTGGAATTGTGAGC) and 3-m157-Zeo-m16/17 (5'-GAGGAATAGGAATAACTCACCACCGATTTCAGCGTCTGCCCCAAGTCTGATTAGCACGTGTCAGTCCT) and plasmid pori6k-m157-pA as the template DNA. After homologous recombination of this fragment with p
m157-FRT in E. coli, revertant MCMV BAC pm157rev was generated. The correct insertion of the m157 gene, including its promoter, at this ectopic position was confirmed by restriction pattern analysis and sequencing with primers M157-1 (5'-TGTTGACCGCCATCTGTTCTTGA), M157-2rev (5'-GGTAAGATTAATATTCAAGGATCA), and M157-3 (5'-GGATTGAAAATTGTTACAGCACG) (data not shown).
Reconstitution of virus mutants from recombinant BACs.
By transfection of 2 µg of the corresponding MCMV BAC DNA into MEFs, mutants
m157-MCMV and
m157-FRT-MCMV and revertant virus m157Rev-MCMV were reconstituted as previously described (51).
Northern blot analysis.
NIH 3T3 fibroblasts were infected at a multiplicity of infection (MOI) of 3 with
m157, w.t. MCMV, or m157Rev, and total RNA was isolated 6 and 24 h postinfection with the TriZol reagent (Invitrogen) in accordance with the manufacturer's instructions. An [
-32P]dCTP-labeled DNA probe specific for 528 bp of the m157 gene (nt positions 216350 to 216878, according to reference 33) was generated with the nick translation kit from Amersham (Amersham Biosciences Europe) in accordance with the manufacturer's instructions. Three micrograms of total RNA from each sample of virus-infected cells was separated on a denaturing formaldehyde gel, blotted to a nylon membrane, and hybridized with the [
-32P]dCTP-labeled DNA probe for detection of m157-specific mRNA transcripts.
Animals. BXD-8/Ty (H-2b), 129/SvJ (H-2b), and C57BL/6 RAG1/ (H-2b) mice were purchased from The Jackson Laboratory (Bar Harbor, Maine). All of the mice used in this study, including congenic inbred BALB.B6-Cmv1r (H-2d) and inbred C57BL/6 (H-2b) and BALB/c (H-2d) mice, were housed and bred under specific-pathogen-free conditions at the Central Animal Facility of the Medical Faculty, University of Rijeka, in accordance with the guidelines contained in the International Guiding Principles for Biomedical Research Involving Animals. The Ethical Committee at the University of Rijeka approved all of the animal experiments described here. C57BL/6 RAG1/ (H-2b) mice were maintained under specific-pathogen-free conditions in the animal facility of the Washington University School of Medicine, and the experiments conducted with these mice were in accordance with institutional guidelines for animal care and use. Six- to eight-week-old female mice were used in all of the experiments.
Infection conditions, detection of infectious MCMV in tissues, and statistical evaluation.
Mice were injected intravenously with 5 x 105 (Ly49H+ mice) or 2 x 105 (Ly49H mice) PFU of tissue culture-grown recombinant virus or w.t. MCMV in a volume of 500 µl of diluents. Organs were collected 3 days after infection, and viral titers were determined with a standard assay of viral plaque formation on MEFs (34). Each experiment shown here is representative of at least three independent experiments. The statistical significance of differences between experimental groups was determined by the Mann-Whitney exact rank test. Viral titers (from groups x and y) were considered significantly different for P (x versus y) <
= 0.05 (one sided), where P is the observed probability value and
is a selected significance level.
Depletion of NK cell subsets in vivo. Depletion of NK1.1+ cells was done with monoclonal antibody (MAb) PK136 (20) at a concentration of 1 mg per mouse by intraperitoneal inoculation 24 to 2 h before infection. The efficacy of depletion was assessed by cytofluorometric analysis of spleen cells with phycoerythrin (PE)-conjugated antibodies to mouse NK1.1 (BD Bioscience Pharmingen, San Diego, Calif.). Depletion of Ly49C/I+ NK cell subsets was performed with MAb 5E6 (31) at a concentration of 150 µg per mouse, and depletion of Ly49C/H/I+ NK cell subsets was performed with MAb 1F8 (9) at a concentration of 150 µg per mouse by intraperitoneal inoculation 24 h before infection.
Staining of intracellular IFN-
.
An in vitro assay to detect gamma interferon (IFN-
) production was performed as previously described (42). Briefly, C57BL/6 RAG1/ splenocytes were cocultured for 12 h with IC-21 cells that were either uninfected or infected for 24 h at an MOI of 5 with
m157 mutant, m157Rev, or w.t. MCMV. Brefeldin A (BD Bioscience Pharmingen) was added for the last 11 h of coincubation. Cells were first surface stained with biotinylated 3D10 (
-Ly49H) (41) and then stained with PE-streptavidin and allophycocyanin-PK136. Cells were fixed and permeabilized with the Cytofix/Cytoperm kit (BD Bioscience Pharmingen) in accordance with the manufacturer's instructions. Intracellular IFN-
was stained with fluorescein isothiocyanate-XMG1.2 (BD Bioscience Pharmingen) in the permeabilization buffer. Cells were analyzed with a FACScalibur cytometer (BD Biosciences, San Jose, Calif.) gating on the NK1.1+ CD3 populations.
| RESULTS |
|---|
|
|
|---|
m157 and
m157-FRT) were prepared (Fig. 1). In vitro and in vivo testing in the lungs, spleens, and livers of BALB/c and C57BL/6 mice at day 3 postinfection revealed no difference between
m157 and
m157-FRT (data not shown). In the experiments described here, only
m157 was used. Thereafter, a revertant virus (m157Rev) was constructed. Rather than reconstructing the w.t. situation, in the revertant virus the m157 gene was reintroduced at an ectopic position between ORFs m16 and m17 of the MCMV genome to selectively study the effect of the m157 ORF. All mutants were derived from parental MCMV BAC pSM3fr, which has w.t. MCMV properties in vitro and in vivo (50). The correct mutagenesis of the resulting
m157 and
m157-FRT strains, as well of the m157Rev MCMV strain, was confirmed by restriction pattern analysis and sequencing of the m157 genome region.
|
m157 and m157Rev in cell culture.
Multistep growth curves of recombinant and w.t. MCMVs served to assess whether deletion of the m157 gene and its ectopic reinsertion affect virus growth in cell culture. After infection of primary BALB/c MEFs at 0.01 PFU per cell, the replication of
m157 and the m157Rev was indistinguishable from that of w.t. MCMV (Fig. 2). These results indicated that the m157 gene product is dispensable for virus growth in fibroblasts and that ectopic reinsertion of this gene between MCMV ORFs m16 and m17 does not compromise viral growth in vitro.
|
m157 gains virulence in Ly49H+ mice through loss of NK cell-mediated control.
Replication of MCMV in vivo during the early period after infection inversely correlates with the ability of mouse strains to mount an effective NK cell response, which is controlled by the Ly49h locus (15). The MCMV protein encoded by the m157 gene is the only ligand for the Ly49H receptor that has been identified so far (2, 42). To test whether the m157 protein is the only MCMV protein interacting with Ly49H, we used the
m157 virus. C57BL/6 (Ly49H+) mice (Fig. 3, top) and congenic BALB.B6-Cmv1r mice (Fig. 3, bottom) were injected with
m157 or w.t. MCMV, and virus titers in their organs were determined 3 days later. The spleens and lungs of mice infected with
m157 showed significantly higher virus titers than did those of mice infected with w.t. MCMV. Consistent with published data (6, 52, 53), depletion of NK cells by anti-NK1.1 MAbs increased the virus titers in mice infected with w.t. MCMV, whereas it had no effect on the virus titers in the spleens and lungs of mice infected with
m157. We concluded that
m157 virus is resistant to NK cell control in vivo and that there is no other viral ligand for Ly49H encoded by the MCMV genome.
|
Reintroduction of the m157 gene reverses the susceptibility of MCMV to NK cells.
To confirm that resistance of mutant virus to NK cells in vivo is solely due to lack of the m157 protein and no other unwanted effect in
m157, we compared the abilities of
m157, m157Rev, and w.t. MCMVs to induce activation of Ly49H+ NK cells. Splenocytes derived from C57BL/6 RAG1/ mice were incubated for 12 h with MCMV-infected IC-21 cells, and the frequency of Ly49H+ IFN-
-secreting cells was measured (Fig. 4 A). The incubation of splenocytes with w.t. MCMV- or m157Rev-infected IC-21 cells resulted in a comparable expansion of Ly49H+ IFN-
-secreting cells (11.1 and 15.6%, respectively). IC-21 cells infected with
m157 failed to activate Ly49H+ cells, and the percentage of activated Ly49H+ NK cells was the same as in cultures incubated with uninfected IC-21 cells. These findings confirm previously published data, obtained by anti-Ly49H blockade and reporter cell assays, that showed that the isolated m157 protein is crucial for the activation of Ly49H+ NK cells (2, 42). The results presented here extend the above studies to the situation found during virus infection. As shown in Fig. 4B, reintroduction of the m157 gene into the
m157 genome also reversed the sensitivity of the virus to NK cell control in vivo. This is illustrated by the fact that the titers of the m157Rev virus in C57BL/6 mice were significantly lower than those of
m157. Furthermore, the depletion of NK cells increased the titer of m157Rev whereas, consistent with the data presented in Fig. 3,
m157 remained resistant to NK cell control. The reconstitution of viral sensitivity to NK cells essentially confirmed the role of the m157 gene. Still, the in vivo function of the gene in m157Rev was not fully restored. This is probably due to the fact that the bona fide promoter of m157 was transferred together with the ORF. Therefore, other sequences modulating gene expression may be lacking, and indeed, Northern blot analysis revealed that the m157 transcripts appear earlier in m157Rev-infected cells and peak later in w.t.-infected cells (see supplemental material). This difference in the activity of ectopic m157 might explain the variance in virus sensitivity to NK cells in vivo.
|
m157 lacks a phenotype in C57BL/6 mice depleted of Ly49H+ NK cells and in mice lacking the Ly49H receptor.
To address the role of the Ly49H+ NK cell subset in the control of MCMV infection and the role of the m157 protein, C57BL/6 mice were injected with MAb 5E6 (
Ly49C/I), 1F8 (
Ly49C/H/I), or PK136 (
NK1.1) prior to infection with either w.t. or
m157 MCMV. Depletion of 1F8+ cells, but not 5E6+ cells, in mice infected with w.t. MCMV led to an increase in virus titers comparable to the effect of NK1.1+ cell depletion. This indicates that other NK cell subsets contribute very little, if at all, to virus control (Fig. 5A). In accordance with the data presented in Fig. 3, in mice infected with
m157, depletion of the Ly49H+ subset did not increase the virus titers. Therefore, the m157 effect on NK cell activation was mediated solely by the Ly49H+ NK cell subset, thus confirming previous studies (5, 9).
|
m157 and that infected with w.t. MCMV were observed (Fig. 5B). Furthermore, NK depletion had no influence on virus titers, confirming that in the absence of Ly49H the m157 protein plays no role in virus control.
Weak phenotype of
m157 in BALB/c and 129/SvJ mice.
We tested the role of the m157 protein in mice lacking the Ly49H but expressing the Ly49I NK cell receptor. 129/J mice do not contain Ly49H or other NK cell activation receptors that recognize m157 (2). However, 129/J mice express the inhibitory NK cell receptor Ly49I (26). The m157 protein binds to 129/J NK cells but not to NK cells of BALB/c mice in vitro (2). If the in vitro conditions reflect the situation in vivo,
m157 should be more attenuated in 129/J mice than in BALB/c mice. To test this, BALB/c and 129/SvJ mice were injected with
m157 or w.t. MCMV and virus titers were tested. Remarkably, there was no difference in the reactivities of these two mouse strains. However, there was a small but statistically significant difference (P < 0.025) between
m157 and w.t. MCMV control in the spleen, indicating a certain degree of attenuation (Fig. 6). Nevertheless, we concluded that the presence or absence of the m157 gene has no strong phenotype in mice expressing the Ly49I NK receptor.
|
m157 in C57BL/6 mice is prevented by viral evasion genes.
MCMV has several NK silencing genes, of which only m152 and m144 have been characterized (13, 22, 25). To show the impact of viral silencing genes in a Ly49H+ strain, we compared
m157 with w.t. MCMV and a virus in which in addition to m157, 14 other genes, including m152, were deleted (Fig. 7). W.t. MCMV is strictly controlled by NK cells, and the virus grows only after NK cell depletion.
m157 lacks the NK activation via m157-Ly49H, and therefore NK depletion has no phenotype. The
MS94.5 virus lacks m157 and, in addition, 14 other genes, including m152, that prevent NK cell activation by down-modulating NKG2D ligands (22, 25). We now have evidence that at least one more MCMV gene, in addition to m152, can down-modulate ligands for the NKG2D receptor (S.J., unpublished data). This inhibitory effect is present in the
m157 virus, and therefore the
m157 virus grows to a higher titer than the
MS94.5 virus, which has lost this NK silencing gene(s). Deletion of NK cells abolishes this type of control, resulting in identical titers of the
MS94.5 and
m157 viruses. This situation is comparable to the situation in Cmv1s mice after infection in the absence or presence of the m152 gene (22). Therefore, in the presence of a number of additional viral silencing genes the effect of the m157-Ly49I interaction is not expected to have a strong impact.
|
| DISCUSSION |
|---|
|
|
|---|
m157, lose their MCMV-encoded resistance phenotype. m157 also serves as a ligand for the inhibitory NK receptor Ly49I in the MCMV-susceptible 129/J strain, and it also binds to NK cells of other MCMV-sensitive strains (1). Therefore, m157 is seen as an inhibitory NK cell ligand and Ly49H+ mice are considered an exception to the rule. However, no experiments in which NK cell function is blocked through m157-Ly49I have been published. Loss of NK cell activation can be studied in the context of virus infection when the virus either expresses or lacks the gene of interest. However, when we studied the effect of m157 deletion in the 129/SvJ strain no vigorous phenotype became apparent. A certain degree of virus attenuation was noticed in both BALB/c and 129/SvJ mice. Considering that the m157 protein binds to the Ly49I allelic form of 129/J but not of BALB/c mice (2), it is not clear whether this effect is related to the m157-Ly49I interaction. A strong signal was not to be expected, since in comparison to NK cells from the C57BL/6 strain only a minority of NK cells from 129/J mice binds m157 but does not lyse m157+ targets in vitro (2).
The absence of NK activation in Ly49H+ mice infected with
m157 provided the opportunity to demonstrate the function of other viral genes inhibiting NK cell function. These genes act by down-modulating NKG2D ligands similarly to the function of m152 (22, 25). There is another not yet identified gene(s) in the left end of the genome (28), and we have evidence of at least one additional gene elsewhere (U.H.K. and S.J., unpublished data). Most NK cells express NKG2D receptors (18). Therefore, the loss of one silencing signal from a chorus of several is difficult to detect. This situation is similar to that of the genes modulating MHC class I expression, in which identification of the three genes involved (m04, m06, and m152) had to precede the construction of virus mutants that lack or express class I modulating functions in all possible combinations (49). In addition, deletion of the viral gene that down-modulates a ligand for an activating NK cell receptor has an immediate effect on NK control, since virus infection upregulates stress-induced ligands (7, 11). On the other hand, deletion of a viral ligand for an inhibitory NK cell receptor should not have a strong phenotype, especially if the stress-induced activating ligands are down-modulated at the same time.
Our study also confirms and extends the known complexity of NK cell control in different organs (30, 44). The Cmv1 locus has been described as a host resistance locus that regulates NK cell responses during acute MCMV infection in the spleen (37). Accordingly,
m157 lacks this type of control. In addition, we show here for the first time that, akin to virus control in the spleen, Ly49H+ NK cells also mediate MCMV control in the lungs. Additional evidence for this is provided by C57BL/6 mice depleted of Ly49H+ NK cells, in which the titer of w.t. MCMV in the lungs reached a level comparable to that after depletion of NK1.1+ NK cells. In contrast, MCMV control in the liver appears to be independent of m157-Ly49H interaction. This finding is in accordance with the minimal effects of anti-Ly49H MAbs on the virus titer in the liver (5), pointing at a different type of NK control of MCMV in that organ (30, 44). After MCMV infection, NK cells pass through two different stages of activation. The first, nonspecific phase, during the first 2 days after MCMV infection, is characterized by IFN-
production and NK cell proliferation, irrespective of Ly49H expression, while in the second, specific phase, there is a selective proliferation of Ly49H+ NK cells (12). This early activation of NK cells may be sufficient to control virus infection in the liver but not in the spleen and lungs. The mode by which NK cells mediate their antiviral effector function also differs between the liver and spleen. While in the spleen NK cells act via a cytolytic mechanism, in the liver MCMV is controlled by cytokines including IFN-
produced by NK and NKT cells (30, 44). In perforin-deficient C57BL/6 mice, no differences between
m157 and w.t. MCMV titers in the spleen were observed, which suggests that Ly49H-positive cells mediate their effect almost exclusively via a perforin-dependent pathway (I.B., unpublished data).
The MCMV genome harbors genes, in addition to m152 (22), whose products down-modulate NKG2D ligands, also in mice expressing Cmv1r (Ly49h) (S.J., unpublished). However, this inhibition of NK cell activation is overridden by NK activation through m157, which makes these mice an exception to the rule. It has been proposed that natural isolates from wild mice, depending on the presence or absence of the Ly49H receptor, are expected to be variable in the m157 gene (1, 35). Indeed, this has been recently demonstrated by Voigt et al., who reported that most of the MCMV strains they isolated from wild mice possessed a specific mutation of the m157 gene (48). Furthermore, this study provides evidence that NK cells can exert sufficient immunological pressure on MCMV that it undergoes rapid and specific mutation in the m157 gene region. Accordingly, we have been studying immunodeficient C57BL/6 mice that rely on NK functions to survive MCMV infection. Under these selective conditions, virus mutants arise that indeed do not respond to the Ly49H receptor (R. A. French, T. J. Pingel, M. Wagner, I. Bubic, L. Yang, S. Kim, U. H. Koszinowski, S. Jonjic, and W. M. Yokoyama, submitted for publication).
| ACKNOWLEDGMENTS |
|---|
This work was supported by Croatian Ministry of Science grants 0062004 (S. Jonjic) and 0062007 (A. Krmpotic), Deutsche Forschungsgemeinschaft SFB 455, and the Bayerische Forschungsstiftung (U. H. Koszinowski). W. M. Yokoyama is supported by NIH grants, the Barnes-Jewish Hospital Foundation, and the Howard Hughes Medical Institute.
| FOOTNOTES |
|---|
Supplemental material for this article may be found at http://jvi.asm.org/. ![]()
Ivan Bubi
and Markus Wagner contributed equally to this work. ![]()
Present address: Department of Pathology, Harvard Medical School, Boston, MA 02115. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||