This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Auwerx, J.
Right arrow Articles by Balzarini, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Auwerx, J.
Right arrow Articles by Balzarini, J.

 Previous Article  |  Next Article 

Journal of Virology, July 2004, p. 7427-7437, Vol. 78, No. 14
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.14.7427-7437.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

The Phenylmethylthiazolylthiourea Nonnucleoside Reverse Transcriptase (RT) Inhibitor MSK-076 Selects for a Resistance Mutation in the Active Site of Human Immunodeficiency Virus Type 2 RT

Joeri Auwerx,1 Miguel Stevens,1 An R. Van Rompay,2,{dagger} Louise E. Bird,3 Jingshan Ren,3 Erik De Clercq,1 Bo Öberg,4 David K. Stammers,3 Anna Karlsson,2 and Jan Balzarini1*

Rega Institute for Medical Research, K. U. Leuven, B-3000 Leuven, Belgium,1 Karolinska Institute, Huddinge University Hospital, S-141 86 Huddinge/Stockholm,2 Medivir AB, S-141 11 Huddinge, Sweden,4 Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, Oxford OX3 7BN, United Kingdom3

Received 15 December 2003/ Accepted 18 February 2004


arrow
ABSTRACT
 
The phenylmethylthiazolylthiourea (PETT) derivative MSK-076 shows, besides high potency against human immunodeficiency virus type 1 (HIV-1), marked activity against HIV-2 (50% effective concentration, 0.63 µM) in cell culture. Time-of-addition experiments pointed to HIV-2 reverse transcriptase (RT) as the target of action of MSK-076. Recombinant HIV-2 RT was inhibited by MSK-076 at 23 µM. As was also found for HIV-1 RT, MSK-076 inhibited HIV-2 RT in a noncompetitive manner with respect to dGTP and poly(rC)·oligo(dG) as the substrate and template-primer, respectively. MSK-076 selected for A101P and G112E mutations in HIV-2 RT and for K101E, Y181C, and G190R mutations in HIV-1 RT. The selected mutated strains of HIV-2 were fully resistant to MSK-076, and the mutant HIV-2 RT enzymes into which the A101P and/or G112E mutation was introduced by site-directed mutagenesis showed more than 50-fold resistance to MSK-076. Mapping of the resistance mutations to the HIV-2 RT structure ascertained that A101P is located at a position equivalent to the nonnucleoside RT inhibitor (NNRTI)-binding site of HIV-1 RT. G112E, however, is distal to the putative NNRTI-binding site in HIV-2 RT but close to the active site, implying a novel molecular mode of action and mechanism of resistance. Our findings have important implications for the development of new NNRTIs with pronounced activity against a wider range of lentiviruses.


arrow
INTRODUCTION
 
More than a decade ago, the first nonnucleoside reverse transcriptase inhibitors (NNRTIs) were discovered and found to be potent and highly specific inhibitors of human immunodeficiency virus type 1 (HIV-1) (2, 23, 24). In contrast with the nucleoside reverse transcriptase inhibitors (NRTIs), which act as DNA chain terminators and are broad-spectrum anti-HIV drugs, the NNRTIs encompass a broad range of chemical structures but are very specific for HIV-1 strains, showing no inhibition of other lentiviruses, including HIV-2, simian immunodeficiency virus (SIV), and feline immunodeficiency virus (FIV), or other RNA or DNA viruses. Given the highly conserved nature of the antiviral target (reverse transcriptase [RT]) (Fig. 1), the specificity of NNRTIs for HIV-1 strains is remarkable. The HIV-2 serotype has been shown to be closely related to SIVmac and has approximately 60% overall amino acid identity with HIV-1 RT and comparable catalytic polymerase activity (15). Despite this amino acid similarity with HIV-1 RT, it became clear that a relatively small number of amino acids in HIV-2 RT were responsible for the lack of inhibitory activity of the NNRTIs. Chimeric HIV-1-HIV-2 RT constructs (4, 36) and site-directed mutagenesis of HIV-1 and HIV-2 RTs (12, 16, 20, 33) revealed that the nature of the amino acids at positions 181 and 188 in RT plays a major role in the recognition of the first-generation NNRTIs (i.e., HEPT, TIBO, nevirapine, pyridinone, delavirdine, TSAO, etc.). Also, some mutant HIV-1 strains that were selected in cell culture for high-level resistance against delavirdine contain the 181-Ile or 188-Leu mutation in the RT (6, 29). Such single-mutation virus strains proved highly resistant to all first-generation NNRTIs and contain those aliphatic amino acids (Ile, Leu) at location 181 or 188 that are present in wild-type HIV-2 RT. The critical role of these and other amino acids in the recognition of NNRTIs has been visualized in the crystal structures of RT-NNRTI drug complexes (27). These studies also revealed that a variety of different NNRTI structures bind to a well-defined lipophilic pocket in HIV-1 RT, and usually subtle differences in their interactions with the protein could be found between the different NNRTIs. The recently published crystal structure of HIV-2 RT (9, 30) revealed that HIV-2 RT has an overall fold similar to that of HIV-1 RT but has structural differences in a putative NNRTI pocket at both conserved and nonconserved residues. The crystal structure points to a role of sequence differences that can give rise to unfavorable inhibitor contacts or cause destabilization of parts of the binding pocket at amino acid positions 101, 106, 138, 181, 188, and 190. There is also confirmation that the HIV-2 RT Ile-181 amino acid, compared with the HIV-1 RT Tyr-181, could be a significant contributing factor in the inherent resistance of HIV-2 to NNRTIs. However, there have been a few reports on a modest inhibitory activity of some NNRTIs against other lentiviruses. TIBO has been found to be inhibitory to several SIV strains in MT-4 cell cultures (13), and delavirdine and a few other NNRTIs were reported to be inhibitory to the HIV-2 EHO and SIV agm3 strains (but not to the HIV-2 ROD and SIV mac251 and mndGB1 strains) in MT-4 cell cultures (35).



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. Alignment of important amino acid stretches in the NNRTI-binding pocket of HIV-1 RT with the corresponding amino acids in other lentivirus RTs. Amino acids instrumental in the susceptibility of HIV-1 RT to NNRTIs are shaded and numbered. Amino acid mutations in HIV-2 and HIV-1 RT that are related to MSK-076 resistance are highlighted. The underlined sequence is highly conserved among lentivirus RTs and includes residues D185 and D186, which are critical for polymerase activity.

One defined series of NNRTIs previously described is the phenylethylthiazolylthiourea (PETT) derivatives, which were reported to have potent activity against HIV-1 RT (1, 8, 11, 17). Further PETT analogues have been designed and synthesized based on structure-activity relationships and molecular modeling (18, 21, 22, 26, 31, 34); several of these showed activity against HIV-1 in the low nanomolar concentration range. Interestingly, some members of the PETT derivative NNRTIs inhibit HIV-2 RT at ~2 µM (28). Kinetic analysis of a member of the PETT series (PETT-2) with both HIV-1 and HIV-2 RTs indicated noncompetitive inhibition modes with respect to deoxynucleoside triphosphates (dNTP). PETT-2 also showed noncompetitive inhibition of HIV-2 RT with respect to either the template-primer or a variable substrate. Such kinetic results are consistent with PETT-2 binding to HIV-2 RT at a site equivalent to the HIV-1 RT NNRTI-binding site but do not eliminate the possibility that the inhibitor binds at a distinctive allosteric site.

In the present study we investigated the anti-HIV-1 and anti-HIV-2 activities of the PETT derivative MSK-076 (Fig. 2) and selected for PETT-resistant HIV-1 and HIV-2 strains in cell culture. The amino acid mutations that appeared in HIV-2 RT were found to be novel mutations at amino acid positions 112 and 101, resulting in full resistance of mutant HIV-2 and recombinant mutant HIV-2 RT to MSK-076. The significance of these findings is discussed from a structural viewpoint on the basis of the available coordinates of the HIV-2 RT structure (9, 30).



View larger version (7K):
[in this window]
[in a new window]
 
FIG. 2. Structures of the PETT derivatives MSK-076 and PETT-2.


arrow
MATERIALS AND METHODS
 
Viruses. HIV-1(IIIB) and HIV-2(ROD) were kindly provided by R. C. Gallo (at that time at the National Cancer Institute, National Institutes of Health, Bethesda, Md.) and L. Montagnier (at that time at the Pasteur Institute, Paris, France), respectively.

Cells. CEM cells were obtained from the American Type Culture Collection (Manassas, Va.) and cultured in RPMI 1640 medium (Invitrogen, Merelbeke, Belgium) supplemented with 10% fetal bovine serum (Integro, Leuvenheim, The Netherlands), 2 mM L-glutamine (Invitrogen), and 0.075% NaHCO3 (Invitrogen).

Test compounds. The PETT derivative MSK-076 was kindly provided by Medivir AB, Huddinge, Sweden. Delavirdine and lamivudine were provided by Jörg-Peter Kleim (GlaxoSmithKline, Stevenage, United Kingdom). Nevirapine BI-RG587 was obtained from Boehringer Ingelheim (Ridgefield, Conn.). UC-781 was obtained from Uniroyal Chemical Ltd. (Middlebury, Conn., and Guelph, Ontario, Canada). Efavirenz was obtained from L. Bacheler (DuPont Pharmaceuticals, Wilmington, Del.). Foscarnet (PFA) and zidovudine were purchased from Sigma Chemicals (St. Louis, Mo.). Stavudine, didanosine, and zalcitabine were provided by D. G. Johns (National Cancer Institute). Tenofovir was obtained from Gilead Sciences (Foster City, Calif.). The bicyclam AMD3100, a CXCR4 antagonist, was provided by G. Henson, AnorMed (Langley, Canada). Ritonavir was obtained from Abbott Laboratories (Abbott Park, Ill.). The quinolone derivative K-37, an inhibitor of HIV mRNA synthesis (3), was kindly provided by M. Baba (Kagoshima, Japan).

Assay of drug activity against wild-type and mutant HIV-1 and HIV-2 strains. CEM cells were suspended at 250,000 cells/ml of RPMI 1640 cell culture medium (supplemented with 10% fetal calf serum, 2 mM L-glutamine, and 0.075% NaHCO3) and infected with wild-type HIV-1(IIIB) and HIV-2(ROD) or mutant HIV-1 or HIV-2 strains at ~100 50% cell culture infected doses (CCID50) per ml. Then 100 µl of the infected cell suspension was added to 200-µl microtiter plate wells containing 100 µl of an appropriate concentration of the test compound. After 4 days of incubation at 37°C, the cell cultures were examined for HIV-induced syncytium formation. The 50% effective concentration (EC50) was determined as the compound concentration required to inhibit HIV-induced syncytium formation by 50%.

Selection of PETT- and lamivudine-resistant HIV-1 and HIV-2 strains in CEM cell cultures. MSK-076 or lamivudine was exposed at fixed concentrations (indicated in Tables 1 and 3) to 1 ml of HIV-1- or HIV-2-infected CEM cell cultures in 48-well microtiter plates. For each subcultivation (every 3 or 4 days), 0.1 ml of the drug-treated HIV-infected cell culture was added to 900 µl of fresh CEM cells (at ~3 x 105 cells/well). The drug concentrations were not increased during ~14 subsequent subcultivations, and the drug-exposed HIV-infected CEM cell culture supernatants were frozen in aliquots at –70°C after abundant syncytium formation became evident. Those cell cultures that did not show visible giant-cell formation after 12 subcultivations were further passaged for at least an additional 3 subcultivations in the absence of the test compounds. Then p24 determinations were performed on the culture supernatant fluids by a p24 enzyme-linked immunosorbent assay (ELISA) (DuPont, Brussels, Belgium) according to the manufacturer's instructions to confirm the lack of virus production in the cell cultures.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Appearance of HIV-2(ROD)-induced cytopathicity in CEM cell cultures in the presence of fixed concentrations of MSK-076 and lamivudine


View this table:
[in this window]
[in a new window]
 
TABLE 3. Breakthrough of HIV-1(IIIB) in CEM cell cultures treated with different concentrations of MSK-076 or lamivudine

Time-of-addition experiments in CEM cells. CEM cell cultures (5 x 105 cells/ml) were infected with HIV-2(ROD) at approximately 100 times the CCID50 per ml. Following a 2-h adsorption period, cells were washed three times and incubated at 37°C. The following test compounds were added at ≥100-fold their EC50s at different time points (0, 1, 3, 5, 7, 9, 12, 18, 24, and 36 h) after virus infection: the CXCR4 antagonist AMD3100 at 10 µM, the NRTI lamivudine at 90 µM, the nucleotide RT inhibitor tenofovir at 700 µM, MSK-076 at 50 µM, the HIV protease inhibitor ritonavir at 15 µM, and the HIV transcription inhibitor K-37 at 5 µM. Viral p24 antigen production was determined at 72 h postinfection by an HIV-2 p24 ELISA (Innogenetics, Ghent, Belgium).

Inhibitory effects of test compounds against recombinant HIV-1 and HIV-2 RT. The assay procedure for measuring the inhibitory effects of the test compounds against HIV RT has been described previously (5). Poly(rC)·oligo(dG) (0.015 mM) was used as the template-primer, and [2.8-3H]dGTP (2 µCi/assay in 50 µl; 2.5 µM) was used as the radiolabeled substrate. Inhibition of HIV RT activity by the different concentrations of MSK-076, nevirapine, delavirdine, UC-781, PFA, and ddGTP was determined. The 50% inhibitory concentration (IC50) was defined as the concentration of the compound required to inhibit enzyme activity by 50%.

Steady-state kinetic assays were also performed as described previously (5), except that the reaction mixtures were incubated for 30 instead of 60 min during the assays with variable substrate (dGTP) or template-primer [poly(rC)·oligo(dG)] concentrations. Under these experimental conditions, the catalytic reactions of the different enzymes proceeded linearly and proportionally with time. The Km and Vmax (kcat) values for poly(rC)·oligo(dG) and dGTP were determined in the presence of fixed concentrations of [2.8-3H]dGTP (specific radioactivity, 14.1 Ci/mmol) (1.25 µM; 1 µCi) and poly(rC)·oligo(dG) (0.1 mM), respectively. The Km and Vmax (kcat) values were derived from the double-reciprocal Lineweaver-Burk plots of the variable substrate (dGTP) or template-primer [poly(rC)·oligo(dG)] concentrations versus the velocities of dGTP incorporation at each substrate or template-primer concentration. To determine the Ki of PETT (MSK-076) (Ki, PETT) and its kinetic mechanism of RT inhibition (competitive, noncompetitive, or uncompetitive), the assays, using [2,8-3H]dGTP and poly(rC)·oligo(dG), were performed in the presence of different concentrations of MSK-076 (26 and 52 µM for HIV-2 RT and 0.013, 0.026, and 0.052 µM for HIV-1 RT).

Sequencing of the RT genes of HIV-1(IIIB) and HIV-2(ROD). The HIV-1 RT gene region (2,217 bp) is well characterized. By aligning the HIV-2 ROD strain with the HIV-1(IIIB) RT gene, we found a similarity from bp 1829 to 4639, and we designated this region the HIV-2(ROD) RT (2,810 bp). When the numbering of HIV-2(ROD) RT is used, bp 1 in the HIV-1 RT gene corresponds with bp 1829 in the HIV-2(ROD) RT gene. Wild-type HIV-1 DNA and drug-treated HIV-1 DNA samples were amplified by PCR with a biotinylated primer (5' TGTACAGAAATGGAAAAGGAAGG at bp 127) and a standard antisense primer (5' GTAAACTCCTTAGAGGAACCAAAGCACT at bp 881). Wild-type HIV-2 DNA and drug-treated HIV-2 DNA samples were amplified by PCR with a biotinylated primer (5' GGGAAAGATGGACCAAAACTGAGAC at bp 595) and a standard primer (5' GAAAAAGAGCTAGAAGCAACAGTCCA at bp 1701). PCRs were performed in a 50-µl volume containing 5 mM dNTP, 100 mM MgCl2 (Roche, Brussels, Belgium), 5 µl of 10x buffer II (Roche), 10 µM each primer, and 1.6 U of AmpliTaq DNA polymerase. The amplified fragment was purified with a Microspin S400 HR column (Amersham Biosciences, Roosendaal, The Netherlands). Further template purification was performed by using Dynabeads M280 streptavidin (Dynal). The amplified fragment was directly sequenced by using an automated laser fluorescent (ALF) sequencer (Amersham Biosciences). For HIV-1 RT, the beads were sequenced with Cy5-labeled antisense primers (5' TCAGTTCCCTTAGATGGAGAC at bp 384 and 5' GACATACAGAAGTTAGTGGGAAAAT at bp 805). The supernatant was sequenced with Cy5-labeled primers (5' CCTGAAAATCCATACAATACTCCAGTATTTG at bp 169, 5' TACTGCATTTACCATACCTAGTAT at bp 396, and 5' CTCCATTCCTTTGGATGGGTTAT at bp 689). The HIV-2 beads were sequenced with Cy5-labeled antisense primers (5' TAAAGTCCTCATGTAGTGGT at bp 813, 5' ACCTGTCTCATTGTGTGTTG at bp 1033, 5' ACTGTATTTTCTGCAACTTCC at bp 1268, and 5' TTCTTGGTAATAGTGTCCCCTC at bp 1495). The supernatant was sequenced with a Cy5-labeled primer (5' GAGACAATGGCCCTTAACAAAAGA at bp 615). Each sample was sequenced full-length in triplicate. Sequences were analyzed and aligned with the wild-type RT gene.

Site-directed mutagenesis of amino acids A101P and G112E in HIV-2(ROD) RT. Mutant enzymes used in this study were translated from the HIV-2(ROD) RT sequence which was cloned into pET21RT2p68. The NcoI-HindIII fragment from this plasmid, which contains the HIV-2 RT gene, was ligated into NcoI-HindIII-digested pKRT2His (25) to create pKRT68His, which contains a His6 tag for easy purification.

Site-directed mutagenesis was performed by using the QuikChange site-directed mutagenesis kit (Stratagene). Briefly, supercoiled double-stranded pKRT68His DNA and two synthetic oligonucleotide primers containing the desired mutation were used. For the mutation of A to P at position 101, primer JA7 (5' CAGTTAGGAATACCACACCCAGCAGGATTGCCCAAGAAGAG), which contained the desired mutation at position 101 and a silent mutation that alters an EcoRI site (underlined), and its complement primer JA8 were used. For the G112E mutation, primer JA9 (5' GAATTACTGTTCTAGATGTAGAGGATGCTTACTTTTCCATAC), containing the desired mutation and a silent mutation creating a unique XbaI restriction site (underlined), and its complement primer JA10 were used. The two primers, each of which was complementary to opposite strands of the vector, were extended during temperature cycling by means of Pfu DNA polymerase, leading to a mutated plasmid containing staggered nicks. After temperature cycling, the product was treated with DpnI. The DpnI endonuclease is specific for methylated and hemimethylated DNA and is used to digest the parental DNA template and to select for mutation-containing synthesized DNA. The nicked vector DNA containing the desired mutations was then transformed into Escherichia coli XL-1 Blue. The presence of the desired mutation was determined by restriction with EcoRI (for A101P) or XbaI (for G112E) and confirmed by sequencing the complete RT gene on an ABI Prism 310 sequencer (Perkin-Elmer) by using the dRhodamine terminator cycle sequencing reaction kit (Perkin-Elmer).

Preparation of HIV-2 RT-containing E. coli extracts. Twenty-five milliliters of Luria Broth medium containing 100 µg of ampicillin/ml were inoculated with an overnight culture of E. coli XL-1 Blue transformed with wild-type or mutated pKRT68His. The culture was started at an optical density at 600 nm (OD600) of 0.1 and incubated at 37°C with vigorous shaking until the late-logarithmic phase (OD600, about 1). Expression of the recombinant p68 form of HIV-2 RT was induced with isopropyl-ß-D-thiogalactopyranoside to a final concentration of 0.5 mM. After 4 h, the cells were harvested, washed with wash buffer (75 mM NaCl, 20 mM Tris-HCl [pH 8], 1 mM EDTA), and kept frozen overnight at –20°C. The cell pellet was resuspended in 1 ml of lysis buffer (500 mM NaCl, 50 mM Tris-HCl, 2 mM EDTA, 5 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.1% Triton X-100, 1 mg of lysozyme/ml, and 10% glycerol) and sonicated for 10 min. The lysate was centrifuged (at 17,000 x g for 20 min), and supernatants were stored at –80°C in aliquots of 100 µl.

Locations of resistance mutations in HIV RT structures. The positions of the resistance mutations selected by MSK-076 in relation to ligand binding sites on RT were assessed by using structures of HIV-1 and HIV-2 RTs. PETT-2, an analogue of MSK-076 which differs by a substituted phenyl ring instead of a substituted pyridine ring and a cyclopropyl bridge instead of an ethylene bridge (see Fig. 1), was modeled into HIV-2 RT by using an overlap of the 110 residues around the NNRTI site of the HIV-1 RT-PETT-2 structure (28) with the corresponding residues of HIV-2 RT (30). The structure of the catalytic complex of HIV-1 RT (19) was used to map the relationship of G112 to the RT active site including the template-primer and dTTP ligands.


arrow
RESULTS
 
Antiviral activity of MSK-076. MSK-076 was evaluated for its inhibitory activity against HIV-1(IIIB) and HIV-2(ROD) replication in CEM cell cultures. The compound inhibited HIV-1-induced cytopathicity at an EC50 of 0.0018 µM. HIV-2-induced cytopathicity was inhibited at an EC50 of 0.63 µM (see Table 6), that is, at a ~300-fold-higher concentration than that required to inhibit HIV-l. The compound was not markedly cytotoxic to the cell cultures at 50 µM.


View this table:
[in this window]
[in a new window]
 
TABLE 6. Sensitivities of mutant HIV-2 strains containing the mutations G112E and Met184Ile in their RTs to the inhibitory effects of NRTIs, NtRTIs, and NNRTIs

Time (site) of intervention. Time-of-addition experiments were performed to pinpoint the possible step(s) of the replication cycle of HIV-2 that could be inhibited by MSK-076 (Fig. 3). CEM cell cultures were infected at a high multiplicity of infection with HIV-2(ROD). p24 antigen production was measured as the parameter of viral replication. The test compounds were added at different time points after infection. The experiments revealed that the antiviral potential of MSK-076 in virus-infected cell cultures could be preserved if drug addition was delayed for no longer than 5 h postinfection. Longer delay of drug administration resulted in diminished suppression of virus production by MSK-076. This is comparable with earlier findings for NNRTIs in HIV-1-infected cell cultures (24). NRTIs and NtRTIs, such as lamivudine and tenofovir, lose their antiviral activity when added later than 4 h after infection, approximately 0.5 to 1 h before the NNRTIs (including MSK-076) lose their antiviral potential. Other time-of-addition studies performed in the same experiment clearly confirmed that the bicyclam AMD3100, an entry inhibitor, interacted with an early replication step (virus entry) and the protease inhibitor ritonavir interacted with a late stage of the HIV replication cycle. Also, administration of K-37, a compound that inhibits mRNA transcription, could be markedly delayed before its antiviral activity was lost (Fig. 3). Our findings indicate that MSK-076 most likely interacts at the reverse transcription process during HIV-2 infection and thus might act as an NNRTI against HIV-2 in cell culture.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. Time-of-addition experiment. CEM cells were infected with HIV-2(ROD) at approximately 100 times the CCID50 per ml. Test compounds were added at different times postinfection. Viral p24 antigen production was determined at 72 h postinfection. Solid squares, AMD3100 at 10 µM; small solid rectangles, lamivudine at 90 µM; multipliers, tenofovir at 700 µM; solid triangles, MSK-076 at 50 µM; asterisks, ritonavir at 15 µM; plus signs, K-37 at 5 µM; solid diamonds, untreated control.

Selection of mutant HIV-2(ROD) and HIV-1(IIIB) strains in the presence of MSK-076. Mutant HIV-2 strains resistant to MSK-076 were selected in CEM cell cultures by passaging the virus in the presence of a variety of fixed concentrations of MSK-076 (Table 1). HIV-2(ROD) was able to replicate fully in the continuous presence of 4.2 µM MSK-076 after 5 passages (designated HIV-2/MSK-076a) or after 8 passages in the presence of 8.2 µM MSK-076 (designated HIV-2/MSK-076b). Proviral DNAs of these virus isolates were harvested at passages 7 and 12, respectively, and sequenced. Genotypic analysis of the RT-coding gene of the MSK-076-resistant viruses HIV-2/MSK-076a and HIV-2/MSK-076b revealed the amino acid mutation G112E (Table 2). In a second, independent experiment, another MSK-076-exposed resistant HIV-2 strain selected in the presence of 8.2 µM MSK-076 was isolated and shown to contain the amino acid mutation A101A/P in its RT.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Mutations in HIV-2(ROD) RT that appeared in HIV-2-infected CEM cell cultures under MSK-076 drug pressure

Under similar experimental conditions, selection of HIV-2(ROD) strains was carried out in the presence of fixed concentrations of lamivudine (Table 1). The virus was able to attain full cytopathogenicity after 4 passages in the presence of lamivudine concentrations between 1.7 and 28 µM. Analysis of the genotype of the virus strains selected in the presence of lamivudine showed that Met184Ile was invariably present in the RTs of all virus isolates recovered at passage 7.

HIV-1(IIIB) was also exposed to a variety of fixed concentrations of MSK-076 (in duplicate) (Table 3). Full breakthrough of virus-induced cytopathicity and replication occurred in the presence of a fixed MSK-076 concentration of 0.01 µM after 6 passages. Higher fixed concentrations of MSK-076 (i.e., 0.05, 0.26, and 1.3 µM) prevented breakthrough of the virus. Genotypic analysis of the proviral DNA of the virus isolates grown in the presence of 0.01 µM revealed the K101E mutation and a mixture of Y181C/Y in HIV-1 RT (Table 4), which have already been described earlier as HIV-1 RT resistance mutations appearing in the presence of NNRTIs (for a review of NNRTI-specific mutations in RT, see reference 6). When the mutant HIV-1 strain that emerged in the presence of 0.01 µM MSK-076 was exposed to escalating MSK-076 concentrations, additional mutations appeared. At a concentration of 0.05 µM MSK-076, a pure Y181C mutation was observed in combination with K101E, whereas further increasing the drug concentration to 0.26 µM resulted in the appearance of an additional (third) mutation (G190R) in the RT of the HIV-1 isolate (Table 4).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Mutations in HIV-1(IIIB) RT that appeared in HIV-1-infected CEM cell cultures with escalating MSK-076 concentrations

Selection of HIV-1 virus strains under lamivudine pressure showed that mutant virus strains emerged at different (fixed) drug concentrations that ranged between 0.44 and 7 µM. At 14 µM lamivudine, no virus breakthrough was observed. Analysis of the HIV-1 proviral DNAs of the several isolates showed that the virus strains contained the M184I mutation in their RT.

Inhibitory activities of NNRTIs, ddGTP, and PFA against wild-type and mutant HIV-2 RT. By site-directed mutagenesis, we constructed mutant HIV-2 RTs with single amino acid replacements (A101P and G112E) and a double mutant containing both amino acid mutations in the same RT. The recombinant wild-type, A101P mutant, G112E mutant, and A101P G112E double-mutant RTs were evaluated for their sensitivities to a variety of NNRTIs, ddGTP, and PFA {with [3H]dGTP as the radiolabeled substrate and poly(rC)·oligo(dG) as the template-primer} (Table 5). The single- and double-mutant HIV-2 RTs retained their insensitivity to the NNRTIs efavirenz, delavirdine, and UC-781, as was also the case for wild-type HIV-2 RT. However, in contrast to wild-type HIV-2 RT, which showed pronounced sensitivity to the inhibitory activity of MSK-076 (IC50, 22.9 µM), none of the mutant HIV-2 RT enzymes showed sensitivity toward MSK-076 at a drug concentration as high as 300 µM. Thus, the A101P and G112E single-mutant RTs and the double-mutant RT bearing the two mutations together in one enzyme molecule showed a >15-fold degree of resistance to MSK-076. The inhibition values obtained for ddGTP and PFA for the wild-type and mutant HIV-2 RTs were very similar.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Inhibitory activities of test compounds against wild-type and mutant recombinant HIV-2 RT

Inhibitory activities of NNRTIs, N(t)RTIs, and PFA against wild-type and mutant HIV-2/MSK-076a and HIV-2/MSK-076b strains in CEM cell cultures. To reveal to what extent the novel mutation (G112E) found in two PETT-treated HIV-2 strains affected the sensitivities of these virus strains to MSK-076 and a variety of NNRTIs, NRTIs, and the NtRTI adefovir, the two virus isolates, together with a lamivudine-resistant HIV-2 strain, were evaluated for their sensitivities to these drugs (Table 6). Interestingly, the NtRTI and the NRTIs listed in Table 6 showed similar suppressive activities against the wild-type and mutant HIV-2 strains, except for lamivudine, which had completely lost antiviral activity against the virus strain with the Met184Ile mutation in its RT. However, MSK-076 completely lost (>80-fold) antiviral activity against the virus isolates with the G112E RT mutation, keeping full activity against the wild-type (EC50, 0.63 µM) and Met184Ile RT mutant (EC50, 1.69 µM) viruses.

Kinetic analysis of the nature of inhibition of HIV-2 and HIV-1 RTs by MSK-076. Ki, PETT values for HIV-1 and HIV-2 RTs obtained by using dGTP as the substrate and the template-primer poly(rC)·oligo(dG) are shown in Table 7. The Ki, PETT for HIV-2 RT was 14.6 µM (against dGTP) and 26.1 µM [against the template-primer poly(rC)·oligo(dG)]. These values are in agreement with the corresponding IC50s for drug-exposed RT (IC50, 22.9 µM) in the presence of dGTP (2.5 µM). For HIV-1 RT, we found Ki, PETT values as low as 0.0052 µM when dGTP was used as a variable substrate and 0.0044 µM when poly(rC)·oligo(dG) was used at variable template-primer concentrations. When the Ki, PETT/Km ratio for HIV-1 RT [0.0003 for poly(rC)·oligo(dG) and 0.0023 for dGTP] was compared with that for HIV-2 RT [0.73 for poly(rC)·oligo(dG) and 8.1 for dGTP], it could be concluded that MSK-076 binds with a much higher affinity to HIV-1 RT than to HIV-2 RT. This is in line with the markedly higher (>100-fold) inhibitory activity of MSK-076 against HIV-1 replication than against HIV-2 replication in CEM cell cultures.


View this table:
[in this window]
[in a new window]
 
TABLE 7. Kinetic analysis of HIV-1 and HIV-2 RT enzymes with poly(rC).oligo(dG) as the template-primer and dGTP as a variable substrate

To investigate the kinetic mechanism of inhibition of HIV-2 RT by MSK-076, we analyzed the mode of inhibition of HIV-2 RT in comparison with that of HIV-1 RT in the presence of various concentrations of MSK-076 (Fig. 4). Double-reciprocal Lineweaver-Burk plots for the inhibition of the HIV-2 and HIV-1 RTs by MSK-076 with respect to dGTP as a variable substrate, or poly(rC)·oligo(dG) as a variable template-primer, revealed noncompetitive inhibition in both cases, indicating that the binding of the drug to the enzyme was independent of the prior binding of the substrate or template-primer to the HIV-1 or HIV-2 RT.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. Double-reciprocal plots for inhibition of wild-type HIV-2 RT (A and B) and HIV-1 RT (C and D) by MSK-076. MSK-076 concentrations were as follows: {blacksquare}, 52 µM; {blacktriangleup}, 26 µM; x, 0.052 µM; {circ}, 0.026 µM; +, 0.013 µM; {diamondsuit}, 0 µM (control). In panels B and D, 0.1 mM template-primer [poly(rC)·oligo(dG)] and variable concentrations of [3H]dGTP were used. In panels A and C, 1.4 µM [2.8-3H]dGTP and variable concentrations of the template-primer poly(rC)·oligo(dG) were used.

Structural context for the role of amino acid mutations G112E and A101P in HIV-2 RT. The position of PETT-2, an analogue of MSK-076, determined from the crystal structure of the complex with HIV-1 RT, is shown in relation to the HIV-2 RT active site and putative NNRTI-binding pocket in Fig. 5a. It is clear that the PETT compound is in close juxtaposition to the mutated A101P residue, while the separation between the NNRTI and G112E is much greater (>12 Å). The location of G112 in relation to the active site in the HIV-1 RT catalytic complex is shown in Fig. 5b. G112 is 2 residues away from one of the key catalytic aspartates, D110. The introduction of a bulky negatively charged side chain adjacent to the polymerase active site, however, does not appear to compromise HIV-2 RT enzyme activity.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 5. Positions of the MSK-076 resistance mutations A101P and G112E in HIV RT. (a) A101P and G112E mutations relative to the polymerase active site and the putative NNRTI site in HIV-2 RT. The protein backbone is shown as blue ribbons and coils, and protein side chains are shown as ball-and-stick structures with carbon, oxygen, and nitrogen atoms represented as orange, red and blue, respectively. The thicker ball-and-stick structure with grey carbon atoms represents the PETT-2 molecule, marking the putative NNRTI site. The possible orientations of 101P and 112E are shown. (b) Position of residue G112 (green sphere) relative to the polymerase active site of HIV-1 RT. Blue ribbons and coils, protein backbones. The protein side chains and the substrate dTTP are shown as thinner and thicker ball-and-stick structures, respectively. The two purple spheres represent manganese ions, and the yellow and green ladder shows the bound oligonucleotide, with the template and primer strands labeled T and P, respectively.


arrow
DISCUSSION
 
We have shown that MSK-076 is a potent inhibitor of HIV-1 in cell culture. This is in line with reports for other members of the PETT series (1, 11). However, the PETT compound reported here also has the ability to markedly inhibit HIV-2, albeit at a much higher concentration than that required for HIV-1. Only recently have the inhibitory activities of other, related members of the PETT series against HIV-2 been reported (28). Also, a modest activity of the NNRTIs delavirdine and emivirine (MKC442) against the HIV-2(EHO) strain, but not the HIV-2(ROD) strain, has been reported (35). The possibility that the remarkable activity of MSK-076 against HIV-2, compared to the inactivity of other NNRTIs, is due to interaction with a different target or, alternatively, that MSK-076 inhibits RT but binds to an entirely different site of the enzyme than the "classical" NNRTIs, was considered. First, the time-of-addition experiments reported here show that the molecular site of action of MSK-076 is most likely the HIV-2 RT. Compared to the NRTIs, which lose their antiviral activity approximately 1 h earlier than MSK-076 when drug administration is delayed after the time of virus infection, the time of interaction with its target after infection is in agreement with that found for all other NNRTIs against HIV-1. Second, MSK-076 has been found inhibitory to HIV-2 RT, in contrast with the other "classical" NNRTIs such as efavirenz, UC-781, delavirdine, and nevirapine. Moreover, the decreased affinity of HIV-2 RT versus HIV-1 RT for the MSK-076 compound correlated well with the decreased antiviral activity of MSK-076 against HIV-2 versus HIV-1 in cell culture. This observation is in agreement with the view that the HIV-2 target for MSK-076 inhibition is the virus-encoded RT. Third, kinetic studies, performed in an attempt to elucidate the mode of HIV-2 RT inhibition by MSK-076 in comparison with HIV-1 RT inhibition, showed that MSK-076 behaves noncompetitively with respect to both the substrate dGTP and the template-primer poly(rC)·oligo(dG). This indicates that MSK-076 does not interfere with HIV-2 RT by binding at the dNTP site or at the DNA-binding site but binds at another allosteric site of the enzyme. These data also reveal that MSK-076 competes neither with the dNTP substrate nor with the template-primer, making it likely that MSK-076 interacts with a presumable NNRTI pocket in HIV-2 RT similar to or closely resembling the NNRTI-binding site in HIV-1 RT.

Fourth, another important observation that points to RT as the target for the inhibitory effect of MSK-076 is the selection of an A (GCC)-to-P (CCC) mutation at residue 101 and a G (GGG)-to-D (GAG) mutation at residue 112 in the RT gene of HIV-2(ROD) under MSK-076 pressure. In fact, in HIV-1-infected cell cultures, MSK-076 selects for an amino acid mutation at position 101 (K to E) but also at positions 181 (Y to C) and 190 (G to R). The latter amino acid mutations have already been described as appearing in the presence of NNRTIs (7, 32). Interestingly, in HIV-1 RT, K101 plays an important role in the binding of PETT derivatives through a hydrogen bond between the peptide main chain in the NNRTI pocket and the thiourea moiety of PETT (28). The emergence of this homologous amino acid mutation in HIV-2 RT may indicate that this amino acid may affect the binding of MSK-076 in HIV-2 RT as well. However, it should be noted that the amino acid at position 101 in HIV-2 RT (A) is different from the corresponding amino acid in HIV-1 RT (K) and that mutation to a proline, as seen in HIV-2 RT, has never been observed in HIV-1 RT at this amino acid site. Proline at residue 101 in HIV-2 RT may give rise to a more profound structural effect on the putative NNRTI pocket than the more classical mutations at residue 101 found in HIV-1 RT (i.e., E, I, or Q), due to lower conformational flexibility and the replacement of the main-chain NH by an NC link. Indeed, it is likely that P101 can distort the key hydrogen-bonding interaction from the inhibitor to the main-chain carbonyl observed for many NNRTIs in HIV-1 RT, including PETT-2.

The G112E mutation, on the other hand, also found to appear under MSK-076 pressure in HIV-2 RT, has never been previously described in relation to NNRTI resistance in HIV-1 RT (including PETT analogues). The location of this mutation is adjacent to the dNTP binding site in the RT (D110, D185, D186). Indeed, it is interesting that the introduction of a bulky negatively charged side chain can be tolerated at a position that is relatively close to the key catalytic machinery of the polymerase active site. Kinetic data indicate that MSK-076 is not competing at the dNTP site; thus, the occurrence of G112E as a resistance mutation is somewhat surprising given that this mutation is distal to the putative NNRTI site. Generally, mutations conferring resistance to NNRTIs are in direct contact with the inhibitor in HIV-1 RT. There are exceptions, however, such as K103N and V108I, which do not necessarily interact directly with the NNRTIs but nevertheless are still situated close to the inhibitor binding site. The kinetic data and the presence of the A101P mutation are consistent with MSK-076 binding to HIV-2 RT at the site equivalent to the HIV-1 RT NNRTI-binding site; however, the possibility of a different additional binding site for this inhibitor cannot be discounted. However, although RNase H binding, or both DNA polymerase and RNase H binding, as for the compounds described by Borkow et al. (10), cannot be excluded, such a site of drug interaction may be unlikely due to the fact that resistance mutations in the RT of MSK-076-resistant virus strains are at a marked distance from the RNase H binding site. The structural basis for the mechanism of resistance to MSK-076 induced by G112E is not clear. It is known that the inhibition of NNRTIs in HIV-1 RT occurs via a distortion of the active-site aspartates (14). It is conceivable that displacement of the active-site aspartates, presumed to be caused by the NNRTI binding to HIV-2 RT, can be prevented by the G112E mutation. However, another role of G112E in the resistance to MSK-076 cannot be excluded.

When we compared the speed of selection of resistant viruses between HIV-1 and HIV-2 in the presence of MSK-076, we observed a faster emergence of MSK-076-resistant virus in HIV-2, compared to the much slower breakthrough of drug-resistant virus for HIV-1 under MSK-076 pressure. In this respect, it should also be noted that the Ki of MSK-076 and its EC50 for HIV-1 in cell culture are close (0.0052 and 0.0018 µM, respectively), while the Ki of MSK-076 for HIV-2 RT and its EC50 for HIV-2 in cell culture differ ~20-fold (14.6 and 0.63 µM, respectively). It has previously been observed for a number of NNRTIs that RT enzyme inhibition values (IC50s) can be considerably higher than the corresponding EC50s in cell culture. This phenomenon has been ascribed to the rather artificial testing conditions in the enzyme assays (i.e., use of a homopolymeric template-primer). Such a difference between Ki values and EC50s is usually less pronounced for expanded-spectrum NNRTIs.

In conclusion, despite its inhibitory activity against HIV-2 RT, MSK-076 represents another member of the NNRTI class of compounds that act noncompetitively at a specific site in both HIV-1 and HIV-2 RTs. We can now show that the specificity of NNRTIs (including most PETT compounds) for inhibition of HIV-1 RT may be broadened to a significant inhibition of HIV-2 (and HIV-2 RT) as well. Our kinetic, mutational, and structural analyses revealed that the mode of binding of MSK-076 to HIV-2 RT might be comparable to that for HIV-1 RT. These observations may have important implications for the further development of novel NNRTIs with activity against HIV-2 because of the increasing prevalence and incidence of HIV-2 infections in developing countries. Furthermore, the rational design of potent drugs with a broad activity spectrum against a wider range of lentiviruses can be important for the treatment of (drug-resistant) HIV strains. The availability of the crystallographic HIV-2 RT structure coordinates may become instrumental in the design of more potent NNRTI (i.e., PETT) inhibitors.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants from the European Commission (René Descartes Prize 2001 [HPAW-2002-90001] and QLRT-2000-00291)and the Geconcerteerde Onderzoeksacties—Vlaanderen (GOA, Krediet no. 00/12). J.A. acknowledges a fellowship from the Flemish Institute supporting Scientific Technological Research in Industry (IWT).

We thank Ann Absillis and Lizette van Berckelaer for excellent technical assistance and C. Callebaut for dedicated editorial help.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Rega Institute for Medical Research, Minderbroedersstraat 10, B-3000 Leuven, Belgium. Phone: 32-16-337352. Fax: 32-16-337340. E-mail: jan.balzarini{at}rega.kuleuven.ac.be. Back

{dagger} Present address: Department of Nephrology-Hypertension, University of Antwerp, 2610 Antwerp, Belgium. Back


arrow
REFERENCES
 
    1
  1. Ahgren, C., K. Backbro, F. W. Bell, A. S. Cantrell, M. Clemens, J. M. Colacino, J. B. Deeter, J. A. Engelhardt, M. Hogberg, S. R. Jaskunas, N. G. Johansson, C. L. Jordan, J. S. Kasher, M. D. Kinnick, P. Lind, C. Lopez, J. M. Morin, Jr., M. A. Muesing, R. Noreen, B. Öberg, C. J. Paget, J. A. Palkowitz, C. A. Parrish, P. Pranc, M. K. Rippy, C. Rydergard, C. Sahlberg, S. Swanson, R. J. Ternansky, T. Unge, R. T. Vasileff, L. Vrang, S. J. West, H. Zhang, and X. X. Zhou. 1995. The PETT series, a new class of potent nonnucleoside inhibitors of human immunodeficiency virus type 1 reverse transcriptase. Antimicrob. Agents Chemother. 39:1329-1335.[Abstract]
  2. 2
  3. Baba, M., H. Tanaka, E. De Clercq, R. Pauwels, J. Balzarini, D. Schols, H. Nakashima, C. F. Perno, R. T. Walker, and T. Miyasaka. 1989. Highly specific inhibition of human immunodeficiency virus type 1 by a novel 6-substituted acyclouridine derivative. Biochem. Biophys. Res. Commun. 165:1375-1381.[CrossRef][Medline]
  4. 3
  5. Baba, M., M. Okamoto, M. Kawamura, M. Makino, T. Higashida, T. Takashi, Y. Kimura, T. Ikeuchi, T. Tetsuka, and T. Okamoto. 1998. Inhibition of human immunodeficiency virus type 1 replication and cytokine production by fluoroquinoline derivatives. Mol. Pharmacol. 53:1097-1103.[Abstract/Free Full Text]
  6. 4
  7. Bacolla, A., C. K. Shih, J. M. Rose, G. Piras, T. C. Warren, C. A. Grygon, R. H. Ingraham, R. C. Cousins, D. J. Greenwood, D. Richman, Y.-C. Cheng, and J. A. Griffin. 1993. Amino acid substitutions in HIV-1 reverse transcriptase with corresponding residues from HIV-2. Effect on kinetic constants and inhibition by non-nucleoside analogs. J. Biol. Chem. 268:16571-16577.[Abstract/Free Full Text]
  8. 5
  9. Balzarini, J., M. J. Péréz-Péréz, A. San-Félix, M. J. Camarasa, I. C. Bathurst, P. J. Barr, and E. De Clercq. 1992. Kinetics of inhibition of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase by the novel HIV-1-specific nucleoside analogue [2',5'-bis-O-(tert-butyldimethylsilyl)-ß-D-ribofuranosyl]-3'-spiro-5"-(4"-amino-1",2"-oxathiole-2",2"-dioxide) thymine (TSAO-T). J. Biol. Chem. 267:11831-11838.[Abstract/Free Full Text]
  10. 6
  11. Balzarini, J., A. Karlsson, V. V. Sardana, E. A. Emini, M. J. Camarasa, and E. De Clercq. 1994. Human immunodeficiency virus 1 (HIV-1)-specific reverse transcriptase (RT) inhibitors may suppress the replication of specific drug-resistant (E138K)RT HIV-1 mutants or select for highly resistant (Y181C->C181I)RT HIV-1 mutants. Proc, Natl. Acad. Sci. USA 91:6599-6603.[Abstract/Free Full Text]
  12. 7
  13. Balzarini, J. 1999. Suppression of resistance to drugs targeted to human immunodeficiency virus reverse transcriptase by combination therapy. Biochem. Pharmacol. 58:1-27.[CrossRef][Medline]
  14. 8
  15. Bell, F. W., A. S. Cantrell, M. Hogberg, S. R. Jaskunas, N. G. Johansson, C. L. Jordan, M. D. Kinnick, P. Lind, J. M. Morin, Jr., R. Noréen, B. Öberg, J. A. Palkowitz, C. A. Parrish, P. Pranc, C. Sahlberg, R. J. Ternansky, R. T. Vasileff, L. Vrang, S. J. West, H. Zhang, and X. X. Zhou. 1995. Phenethylthiazolethiourea (PETT) compounds, a new class of HIV-1 reverse transcriptase inhibitors. 1. Synthesis and basic structure-activity relationship studies of PETT analogs. J. Med. Chem. 38:4929-4936.[CrossRef][Medline]
  16. 9
  17. Bird, L. E., P. P. Chamberlain, G. B. Stewart-Jones, J. Ren, D. I. Stuart, and D. K. Stammers. 2003. Cloning, expression, purification, and crystallisation of HIV-2 reverse transcriptase. Protein Expr. Purif. 27:12-18.[CrossRef][Medline]
  18. 10
  19. Borkow, G., R. S. Fletcher, J. Barnard, D. Arion, D. Motakis, G. I. Dmitrienko, and M. A. Parniak. 1997. Inhibition of the ribonuclease H and DNA polymerase activities of HIV-1 reverse transcriptase by N-(4-tert-butylbenzoyl)-2-hydroxy-1-naphthaldehyde hydrazone. Biochemistry 36:3179-3185.[CrossRef][Medline]
  20. 11
  21. Cantrell, A. S., P. Engelhardt, M. Hogberg, S. R. Jaskunas, N. G. Johansson, C. L. Jordan, J. Kangasmetsa, M. D. Kinnick, P. Lind, J. M. Morin, Jr., M. A. Muesing, R. Noreen, B. Öberg, P. Pranc, C. Sahlberg, R. J. Ternansky, R. T. Vasileff, L. Vrang, S. J. West, and H. Zhang. 1996. Phenethylthiazolylthiourea (PETT) compounds as a new class of HIV-1 reverse transcriptase inhibitors. 2. Synthesis and further structure-activity relationship studies of PETT analogs. J. Med. Chem. 39:4261-4274.[CrossRef][Medline]
  22. 12
  23. Condra, J. H., E. A. Emini, L. Gotlib, D. J. Graham, A. J. Schlabach, J. A. Wolfgang, R. J. Colonno, and V. V. Sardana. 1992. Identification of the human immunodeficiency virus reverse transcriptase residues that contribute to the activity of diverse nonnucleoside inhibitors. Antimicrob. Agents Chemother. 36:1441-1446.[Abstract/Free Full Text]
  24. 13
  25. Debyser, Z., K. De Vreese, R. Pauwels, N. Yamamoto, J. Anné, E. De Clercq, and J. Desmyter. 1992. Differential inhibitory effects of TIBO derivatives on different strains of simian immunodeficiency virus. J. Gen. Virol. 73:1799-1804.[Abstract/Free Full Text]
  26. 14
  27. Esnouf, R., J. Ren, C. Ross, Y. Jones, D. Stammers, and D. Stuart. 1995. Mechanism of inhibition of HIV-1 reverse transcriptase by non-nucleoside inhibitors. Nat. Struct. Biol. 2:303-308.[CrossRef][Medline]
  28. 15
  29. Hizi, A., R. Tal, M. Shaharabany, and S. Loya. 1991. Catalytic properties of the reverse transcriptases of human immunodeficiency viruses type 1 and type 2. J. Biol. Chem. 266:6230-6239.[Abstract/Free Full Text]
  30. 16
  31. Hizi, A., R. Tal, M. Shaharabany, M. J. Currens, M. R. Boyd, S. H. Hughes, and J. B. McMahon. 1993. Specific inhibition of the reverse transcriptase of human immunodeficiency virus type 1 and the chimeric enzymes of human immunodeficiency virus type 1 and type 2 by nonnucleoside inhibitors. Antimicrob. Agents Chemother. 37:1037-1042.[Abstract/Free Full Text]
  32. 17
  33. Hogberg, M., C. Sahlberg, P. Engelhardt, R. Noreen, J. Kangasmetsa, N. G. Johansson, B. Öberg, L. Vrang, H. Zhang, B. L. Sahlberg, T. Unge, S. Lovgren, K. Fridborg, and K. Backbro. 1999. Urea-PETT compounds as a new class of HIV-1 reverse transcriptase inhibitors. 3. Synthesis and further structure-activity relationship studies of PETT analogues. J. Med. Chem. 42:4150-4160.[CrossRef][Medline]
  34. 18
  35. Hu, W., D. J. Timmons, and M. P. Doyle. 2002. In search of high stereocontrol for the construction of cis-disubstituted cyclopropane compounds. Total synthesis of a cyclopropane-configured urea-PETT analogue that is a HIV-1 reverse transcriptase inhibitor. Org. Lett. 4:901-904.[CrossRef][Medline]
  36. 19
  37. Huang, H., R. Chopra, G. L. Verdine, and S. C. Harrison. 1998. Structure of a covalently trapped catalytic complex of HIV-1 reverse transcriptase: implications for drug resistance. Science 282:1669-1675.[Abstract/Free Full Text]
  38. 20
  39. Isaka, Y., S. Miki, S. Kawauchi, A. Suyama, H. Sugimoto, A. Adachi, T. Miura, M. Hayami, O. Yoshie, T. Fujiwara, and A. Sato. 2001. A single amino acid change at Leu-188 in the reverse transcriptase of HIV-2 and SIV renders them sensitive to non-nucleoside reverse transcriptase inhibitors. Arch. Virol. 146:743-755.[CrossRef][Medline]
  40. 21
  41. Ludovici, D. W., M. J. Kukla, P. G. Grous, S. Krishnan, K. Andries, M. P. de Béthune, H. Azijn, R. Pauwels, E. De Clercq, E. Arnold, and P. A. Janssen. 2001. Evolution of anti-HIV drug candidates. Part 1. From alpha-anilinophenylacetamide ({alpha}-APA) to imidoyl thiourea (ITU). Bioorg. Med. Chem. Lett. 11:2225-2228.[CrossRef][Medline]
  42. 22
  43. Mao, C., R. Vig, T. K. Venkatachalam, E. A. Sudbeck, and F. M. Uckun. 1998. Structure-based design of N-[2-(1-piperidinylethyl)]-N'-[2-(5-bromopyridyl)]-thiourea and N-[2-(1-piperazinylethyl)]-N'-[2-(5-bromopyridyl)]-thiourea as potent non-nucleoside inhibitors of HIV-1 reverse transcriptase. Bioorg. Med. Chem. Lett. 8:2213-2218.[CrossRef][Medline]
  44. 23
  45. Miyasaka, T., H. Tanaka, M. Baba, H. Hayakawa, R. T. Walker, J. Balzarini, and E. De Clercq. 1989. A novel lead for specific anti-HIV-1 agents: 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)thymine. J. Med. Chem. 32:2507-2509.[CrossRef][Medline]
  46. 24
  47. Pauwels, R., K. Andries, J. Desmyter, D. Schols, M. J. Kukla, H. J. Breslin, A. Raeymaeckers, J. Van Gelder, R. Woestenborghs, J. Heykants, K. Schellekens, M. A. C. Janssen, E. De Clercq, and P. A. J. Janssen. 1990. Potent and selective inhibition of HIV-1 replication in vitro by a novel series of TIBO derivatives. Nature 343:470-474.[CrossRef][Medline]
  48. 25
  49. Pelemans, H., R. M. Esnouf, H. Jonckheere, E. De Clercq, and J. Balzarini. 1998. Mutational analysis of Tyr-318 within the non-nucleoside reverse transcriptase inhibitor binding pocket of human immunodeficiency virus type I reverse transcriptase. J. Biol. Chem. 273:34234-34239.[Abstract/Free Full Text]
  50. 26
  51. Ranise, A., A. Spallarossa, S. Schenone, O. Bruno, F. Bondavalli, L. Vargiu, T. Marceddu, M. Mura, P. La Colla, and A. Pani. 2003. Design, synthesis, SAR, and molecular modeling studies of acylthiocarbamates: a novel series of potent non-nucleoside HIV-1 reverse transcriptase inhibitors structurally related to phenethylthiazolylthiourea derivatives. J. Med. Chem. 46:768-781.[CrossRef][Medline]
  52. 27
  53. Ren, J., R. Esnouf, E. Garman, D. Somers, C. Ross, I. Kirby, J. Keeling, G. Darby, Y. Jones, D. Stuart, and D. Stammers. 1995. High resolution structures of HIV-1 RT from four RT-inhibitor complexes. Nat. Struct. Biol. 2:293-302.[CrossRef][Medline]
  54. 28
  55. Ren, J., J. Diprose, J. Warren, R. M. Esnouf, L. E. Bird, S. Ikemizu, M. Slater, J. Milton, J. Balzarini, D. I. Stuart, and D. K. Stammers. 2000. Phenylethylthiazolylthiourea (PETT) non-nucleoside inhibitors of HIV-1 and HIV-2 reverse transcriptases. Structural and biochemical analyses. J. Biol. Chem. 275:5633-5639.[Abstract/Free Full Text]
  56. 29
  57. Ren, J., C. Nichols, L. Bird, P. Chamberlain, K. Weaver, S. Short, D. I. Stuart, and D. K. Stammers. 2001. Structural mechanisms of drug resistance for mutations at codons 181 and 188 in HIV-1 reverse transcriptase and the improved resilience of second generation non-nucleoside inhibitors. J. Mol. Biol. 312:795-805.[CrossRef][Medline]
  58. 30
  59. Ren, J., L. E. Bird, P. P. Chamberlain, G. B. Stewart-Jones, D. I. Stuart, and D. K. Stammers. 2002. Structure of HIV-2 reverse transcriptase at 2.35-Å resolution and the mechanism of resistance to non-nucleoside inhibitors. Proc. Natl. Acad. Sci. USA 99:14410-14415.[Abstract/Free Full Text]
  60. 31
  61. Sahlberg, C., R. Noreen, P. Engelhardt, M. Hogberg, J. Kangasmetsa, L. Vrang, and H. Zhang. 1998. Synthesis and anti-HIV activities of urea-PETT analogs belonging to a new class of potent non-nucleoside HIV-1 reverse transcriptase inhibitors. Bioorg. Med. Chem. Lett. 8:1511-1516.[CrossRef][Medline]
  62. 32
  63. Schinazi, R. F., B. A. Larder, and J. N. Mellors. 2000. Mutations in retroviral genes associated with drug resistance: 2000-2001 update. Int. Antivir. News 8:65-91.
  64. 33
  65. Shih, C. K., J. M. Rose, G. L. Hansen, J. C. Wu, A. Bacolla, and J. A. Griffin. 1991. Chimeric human immunodeficiency virus type 1/type 2 reverse tran-scriptases display reversed sensitivity to nonnucleoside analog inhibitors. Proc. Natl. Acad. Sci. USA 88:9878-9882.[Abstract/Free Full Text]
  66. 34
  67. Vig, R., C. Mao, T. K. Venkatachalam, L. Tuel-Ahlgren, E. A. Sudbeck, and F. M. Uckun. 1998. Rational design and synthesis of phenethyl-5-bromopyridyl thiourea derivatives as potent non-nucleoside inhibitors of HIV reserve transcriptase. Bioorg. Med. Chem. 6:1789-1797.[CrossRef][Medline]
  68. 35
  69. Witvrouw, M., C. Pannecouque, K. Van Laethem, J. Desmyter, E. De Clercq, and A.-M. Vandamme. 1999. Activity of non-nucleoside reverse transcriptase inhibitors against HIV-2 and SIV. AIDS 13:1477-1483.[CrossRef][Medline]
  70. 36
  71. Yang, G., Q. Song, M. Charles, W. C. Drosopoulos, E. Arnold, and V. R. Prasad. 1996. Use of chimeric human immunodeficiency virus types 1 and 2 reverse transcriptases for structure-function analysis and for mapping susceptibility to nonnucleoside inhibitors. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 11:326-333.[Medline]


Journal of Virology, July 2004, p. 7427-7437, Vol. 78, No. 14
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.14.7427-7437.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Zhang, Z., Walker, M., Xu, W., Shim, J. H., Girardet, J.-L., Hamatake, R. K., Hong, Z. (2006). Novel nonnucleoside inhibitors that select nucleoside inhibitor resistance mutations in human immunodeficiency virus type 1 reverse transcriptase.. Antimicrob. Agents Chemother. 50: 2772-2781 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Auwerx, J.
Right arrow Articles by Balzarini, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Auwerx, J.
Right arrow Articles by Balzarini, J.