Previous Article | Next Article ![]()
Journal of Virology, July 2004, p. 6818-6826, Vol. 78, No. 13
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.13.6818-6826.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Howard Hughes Medical Institute and Department of Microbiology, University of California Medical Center, San Francisco, California 94143-0414
Received 17 December 2003/ Accepted 4 March 2004
|
|
|---|
|
|
|---|
B- and AP-1-dependent proinflammatory cytokines (IL-6, IL-1ß, tumor necrosis factor alpha, RANTES, etc), basic fibroblast growth factor, and vascular endothelial growth factor (VEGF) (3, 9, 49, 53, 57). Overexpression of vGPCR in NIH 3T3 cells (3) has been shown to induce cell transformation and angiogenesis, and its expression in primary endothelial cells (4) can cause cellular immortalization and spindle shape conversion. Several transgenic mouse lines expressing vGPCR in either hematopoietic cells (mainly T and NK cells) (70), endothelial cells (39), or many other tissues (under simian virus 40 [SV40] early promoter-enhancer control) (23) have been established. These mice develop KS-like angioproliferative lesions composed of spindle-shaped endothelial cells, vascular structures, and infiltrating inflammatory cells in some models (23, 39, 70). Extensive studies have focused on how vGPCR triggers signal transduction pathways to enhance the expression of genes that mediate these effects. However, regulation of vGPCR gene expression is still unclear. While a monocistronic transcript of vGPCR was detected in one study, its expression level is extremely low (44). A K14/vGPCR bicistronic transcript, however, has been identified by several groups and may be the predominant messenger for vGPCR (16, 32, 44). This transcript also encodes another viral signaling molecule, K14, at its 5' end. In contrast to its cellular homolog OX2, K14 was found to activate myeloid-lineage cells to produce inflammatory cytokines; thus, it might be involved in recruiting lymphocytes for virus dissemination and in promoting the cytokine-mediated proliferation of KSHV-infected cells (17). This K14/vGPCR bicistronic transcript is strongly induced during early KSHV lytic reactivation (16, 32, 44), suggesting that it may be a target of the viral lytic switch protein RTA (replication and transcription activator).
Expression of RTA is necessary and sufficient to induce lytic reactivation of KSHV (21, 37, 38, 62). RTA is an effective transcription activator with DNA-binding and dimerization domains at the N terminus and a strong activation domain at the C terminus (37, 54). Although RTA is able to bind with high affinity to its own response element for activation of some target genes, such as kaposin and the noncoding polyadenylated nuclear (PAN) RNA (12, 58, 60), the complexity of its response elements in other target promoters suggests the existence of an additional mechanism(s) of activation (8, 12, 14, 36, 59, 60, 64). Indeed, we have previously shown that RTA can be directed to target promoters through interaction with a cellular transcription factor, RBP-J, that recognizes the specific sequence GTGGGAA (34). Other identified cellular DNA-binding protein partners of RTA include STAT3 and CCAAT/enhancer-binding protein
(24, 67). Given the large number of RTA target genes, additional cellular protein partners (66) or alternative DNA-binding sites for RTA might still exist. By exploring the transcriptional regulation of K14/vGPCR by RTA, we hope not only to understand the regulation of K14 and vGPCR gene expression but also to advance our knowledge of RTA activation mechanisms.
Using a transient-reporter assay, we first mapped three regions in the K14/vGPCR promoter that are important for RTA activation. By scanning mutagenesis, we then identified three potential RTA response elements (A, B, and C) and studied their roles in RTA activation through genetic and biochemical analyses. Two sites (A and C) were found to be binding sites for RBP-J, which was found to play a central role in mediating RTA-induced activation of the promoter. The third site binds an as-yet-unrecognized cellular DNA-binding protein that appears to play a demonstrable but subsidiary role in RTA-dependent activation of the locus.
|
|
|---|
Plasmids. To create the reporter construct of the K14/vGPCR promoter, pGL3-1257, a 1.3-kb DNA fragment upstream of the ATG codon of the K14 gene (corresponding to the 1,257 nucleotides [nt] upstream of the transcription start site) was PCR amplified from KSHV genomic DNA and cloned immediately upstream of the ATG codon of the luciferase gene in pGL3-basic at Bgl II and NcoI sites (the NcoI site on the vector was eliminated). Further deletions from the 5' end of pGL3-1257 were made by either restriction enzyme digestion or PCR amplification (Fig. 1A). The large fragment recovered from SmaI-cleaved pGL3-1257 was recircularized to create pGL3-562. Likewise, pGL3-242 was constructed after XhoI and NcoI digestion of pGL3-1257. Constructs pGL3-222, pGL3-184, pGL3-130, and pGL3-98 were created by amplifying the corresponding fragments upstream of the ATG codon of the K14 gene and cloning the fragments into pGL3-basic by using XhoI and NcoI sites, respectively (the NcoI site on the vector was destroyed). The sequences of the oligonucleotides used in PCRs are available upon request. For luciferase reporter constructs containing tandem repeats, synthesized oligonucleotides of complementary sequence were annealed to form a 5'-end BglII overhang and a 3'-end BamHI overhang, followed by ligation and BglII digestion and finally ligation with a BglII-digested pGL3 promoter. The number of tandem repeats was detected by PCR amplification followed by separation on polyacrylamide gels. To make the pGST-RTA fusion construct, a 1.5-kb fragment encoding amino acids 1 to 530 of RTA was amplified from pcDNA3-ORF50 and inserted into pGEX-4T-1 at EcoRI and SalI sites. All constructs were verified by direct sequencing. pGST-RBPJ was described before (34).
![]() View larger version (21K): [in a new window] |
FIG. 1. Mapping of RTA response elements in the K14/vGPCR promoter. (A) Schematic representation of serial deletions of the putative K14/vGPCR promoter. A 1.3-kb fragment upstream of the K14 ATG codon (corresponding to nt 1257 upstream of the RNA initiation site [32]) was cloned in front of a reporter gene. Serial deletions were made on the 1.3-kb fragment from the 5' end, with the number indicating the nucleotide position upstream of the RNA initiation site. The mapped mRNA initiation site is shown by the arrow. (B) RTA activation of K14/vGPCR promoters with serial deletions. Reporter constructs with the indicated promoter deletions (0.3 µg) were used to transfect 293T cells with either empty vector or RTA expression vector (0.6 µg). The fold induction of each construct by RTA was plotted, with the error bars representing standard deviations of the results from at least two independent experiments.
|
Purification of GST fusion proteins. BL21 cells transformed with pGST, pGST-RTA, or pGST-RBPJ plasmid DNA were grown to exponential phase at 37°C before induction with 0.2 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) for 2 to 3 h. Cell pellets were harvested and lysed by repeated freeze-thawing and sonication. The cleared lysate was incubated at 4°C with glutathione-Sepharose beads (Amersham Pharmacia), which were then washed four times with NETN buffer (20 mM Tris [pH 8] 100 mM NaCl, 1 mM EDTA, and 0.5% NP-40) and resuspended in NETN buffer. Glutathione S-transferase (GST) proteins were eluted from the beads by incubation with glutathione at a concentration of 1.1 g/ml overnight at 4°C, and aliquots were stored at 80°C. The purified proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie blue staining.
EMSA. Electrophoretic mobility shift assay (EMSA) was performed essentially as described previously (34). Purified GST fusion proteins were prepared as described above. Nuclear extracts were prepared according to the protocol of the manufacturer (Active Motif, Carlsbad, Calif.). The 32P-labeled oligonucleotides were incubated with either purified proteins or nuclear extracts for 30 min at room temperature, in the presence or absence of unlabeled competitor oligonucleotides, in a total volume of 20 µl of binding buffer (20 mM HEPES [pH 7.4], 50 mM KCl, 1 mM EDTA, 1 mM MgCl2, 10 mM dithiothreitol; 250 ng of dI-dC, 8.5% glycerol). Complexes were resolved on a 4% native polyacrylamide gel in 0.5x Tris-borate-EDTA. The gel was dried and exposed on autoradiographic film.
|
|
|---|
110-fold, a significant decrease compared to the construct pGL3-222 (
360-fold). Further deletion to the construct pGL3-130 led to even lower RTA activation (18-fold). Moreover, RTA activated the construct pGL3-98 by only threefold, a sixfold difference from the construct pGL3-130. The assays were repeated with SLK human endothelial cells, CV1 simian kidney cells, and mouse embryonic fibroblasts with similar results (data not shown). Taken together, these data suggest that the K14/vGPCR promoter contained three major RTA-responsive elements, putatively located between positions 222 and 184, between positions 184 and 130, and between positions 130 and 98. To identify the exact sequences important for RTA activation, point substitution mutations were created across the region in the construct pGL3-222, pGL3-184, or pGL3-130 (Fig. 2A). The m6 mutation of the construct pGL3-222 was activated by RTA at the same level as the deletion mutant pGL3-184 (Fig. 2B), suggesting that the sequence GTGAGA is one of the RTA-responsive elements, which hereafter is called site A. Scanning mutations in the construct pGL3-184 revealed two consecutive mutants, m15 and m16, that showed a defect in RTA activation similar to that for the construct pGL3-130 (Fig. 2C), suggesting another RTA-responsive site (site B). As determined by sequence comparison analysis, a potential RBP-J-binding site (TTCCCAC) exists between nucleotides 130 and 98. We have previously shown that RTA can activate through an RBP-J-binding site via interaction with the RBP-J protein. Indeed, mutations (130m) introduced into the construct pGL3-130 at the putative RBP-J-binding site significantly lowered the RTA activation level to one similar to that for the deletion mutant pGL3-98 (Fig. 2D), suggesting that this RBP-J-binding site is the third RTA-responsive element (site C).
![]() View larger version (30K): [in a new window] |
FIG. 2. Scanning mutations reveal three major RTA response elements in the K14/vGPCR promoter. (A) Nucleotide sequences from nt 222 to 98 nt of the transcription initiation site. Sites A, B, and C, are in boldface. The position of each mutation is shown by underlining. The predicted RBP-J-binding site is boxed. (B) Scanning mutations between nt 222 and 184 revealed site A (defined by m6), which is important for RTA activation. Luciferase assay was performed with 293T cells as described for Fig. 1B. (C) Scanning mutations between nt 184 and 130 suggest that site B (defined by m15 and m16) is important for RTA activation. (D) The predicted RBP-J-binding site between nt 130 and 98 is the third RTA response element, site C (also defined by mutant 130m). Error bars indicate standard deviations.
|
![]() View larger version (45K): [in a new window] |
FIG. 3. Sites A, B, and C do not bind to RTA efficiently in vitro. (A) Sequences from nt 222 to 98 upstream of the transcription site, with sites A, B, and C in boldface. Positions of all oligonucleotides (A, B, BL, C, and BC) used in this study are indicated underneath the corresponding sequences. (B) GST and GST-RTA proteins purified from E. coli lysates. A truncated RTA (amino acids 1 to 530) was fused to the N-terminal GST to create GST-RTA fusion protein. Both GST and GST-RTA fusion proteins were purified as described in Materials and Methods and analyzed in an SDS-polyacrylamide gel. The sizes of the molecular mass markers are indicated at the left. (C) In gel shift assay, a 32P-labeled PAN RRE (GATCCTTCCAAAAATGGGTGGCTAACCTGTCCAAAATATGGGAA) probe (lane 1) was incubated with either purified GST (lane 2) or GST-RTA fusion protein (lanes 3 to 11). Different competitor oligonucleotides were included in the probe-RTA incubation reaction: PAN RRE (20- and 400-fold excesses over probe) (lanes 4 and 5, respectively), kaposin RRE (GATCCCGGGAAATGGGTGGCTAACCCCTACATAAGCAGTTTGA) (20- and 400-fold) (lanes 6 and 7, respectively), oligonucleotide A (400-fold) (lane 8), oligonucleotide B (400-fold) (lane 9), oligonucleotide C (400-fold) (lane 10), or oligonucleotide BC (400-fold) (lane 11). G, GST protein; R, GST-RTA STAD protein. (D) RTA does not form a stable complex with oligonucleotide A, B, or C. Oligonucleotide A (lanes 1 and 2), B (lanes 3 and 4), or C (lanes 5 and 6) was incubated with either purified GST protein (lanes 1, 3, and 5) or GST-RTA fusion protein (lanes 2, 4 and 6) and separated on a native polyacrylamide gel.
|
Sites A and C contain functional RBP-J-binding sites and mediate RTA activation in a heterogeneous promoter. To determine whether any cellular factor(s) binds to site A, we performed EMSA on oligonucleotide A with nuclear extracts of the 293T cells. We noticed that oligonucleotide A produced a strong and specific band of the same size as oligonucleotide C, which represents the conventional RBP-J-binding site (data not shown), suggesting that oligonucleotide A may contain an RBP-J-binding site. Using the purified GST-RBP-J fusion protein in a gel shift assay (Fig. 4A), we showed that oligonucleotide A indeed bound directly to RBP-J. The 32P-labeled oligonucleotide A (lane 1) formed a strong complex with RBP-J protein (lane 3) but not with GST alone (lane 2). This complex can be efficiently competed by WT (lanes 4 and 5) but not mutant (lanes 6 and 7) RBP-J oligonucleotide. Similar results were obtained for the control oligonucleotide C (lanes 8 to 12).
![]() View larger version (36K): [in a new window] |
FIG. 4. Oligonucleotide A or C can form a functional complex with RBP-J protein. (A) Gel shift assay of oligonucleotide A or C with purified GST-RBPJ protein. Labeled oligonucleotide A (lanes 1 to 7) or C (lanes 8 to 12) was incubated with either GST (lane 2) or GST-RBP-J (lanes 3 to 12) protein, in the absence of RBP-J oligonucleotide (lanes 3 and 8) or in the presence of unlabeled WT (10- and 40-fold) (lanes 4 and 5 and lanes 9 and 10) or mutant (10- and 40-fold) (lanes 6 and 7 and lanes 11 and 12) RBP-J oligonucleotide. G, GST protein; RP, GST-RBP-J protein. (B) Repeats of oligonucleotide A or C mediate RTA activation in a heterogeneous promoter. Oligonucleotide A or C (WT or mutant) was inserted in tandem repeats (the number of repeats is indicated) into the SV40 minimal promoter in the pGL3 promoter to drive the expression of reporter gene luciferase. The individual reporter construct was cotransfected into 293T cells with either empty vector or RTA expression vector. The fold induction by RTA was plotted, with the error bars representing standard deviations of the results from at least two independent experiments. A, WT oligonucleotide A; Am, mutant oligonucleotide A; C; WT oligonucleotide C; Cm, mutant oligonucleotide C.
|
10- to 20-fold. RTA activated the promoters containing WT oligonucleotide A as well, and the activation increased with increasing number of repeats. In contrast, RTA failed to activate those containing mutant oligonucleotide A. Likewise, WT but not mutant oligonucleotide C repeats efficiently mediated RTA activation in the SV40 minimal promoter in a repeat number-dependent manner (Fig. 4B).
These data clearly supported the idea that both A and C contain RBP-J-binding sites, which can mediate RTA activation through RTA-RBP-J protein interaction. While site C contains a predicted RBP-J-binding site, site A (GTGAGAA) contains a G
A change (underlined) in the conventional RBP-J-binding site (GTGGGAA). Although RBP-J has been reported to be able to bind to the sequence 5'-GTGGGAA specifically (63), alternative RBP-J-binding sequences (5'-TGGGAAA and 5'-TGGGAAAGAA) have also been reported (18, 30). The GTGAGAA sequence of site A reported here thus represents a novel alternative RBP-J-binding site.
Site B contains a binding site(s) for an additional cellular factor(s). In a gel shift assay using nuclear extracts prepared from 293T cells, the 32P-labeled oligonucleotide B formed two specific complexes (Fig. 5A, lane 2), which can be efficiently competed by unlabeled WT oligonucleotide B (lanes 3 and 4). Mutant oligonucleotide 1 (mut-1), carrying the same mutation as m15 described above, served as a much weaker competitor than the WT oligonucleotide (compare lanes 5 and 3 and lanes 7 and 4). Mutant oligonucleotide 2 (mut-2), carrying the same mutation as m16, failed to compete the two specific bands even at a 200-fold molar excess (lanes 7 and 8). Thus, the interactions of this factor with site B are consistent with the above genetic analysis, in which m16 showed a more severe defect than m15 (Fig. 2C). These data strongly suggest that the site B-interacting host factor plays a role in facilitating RTA-mediated transactivation in vivo. However, it does not allow determination of the mechanism by which it may do so.
![]() View larger version (35K): [in a new window] |
FIG. 5. Oligonucleotide B is bound by a cellular factor(s) but functions poorly in heterologous contexts. (A) Oligonucleotide B forms specific complexes with 293T cell nuclear extracts. Labeled oligonucleotide B (lane 1) was incubated with 293T cell nuclear extracts (lanes 2 to 8) in the absence of competitor oligonucleotide (lane 2) or in the presence of the following unlabeled competitor oligonucleotides: WT oligonucleotide B (20- and 200-fold) (lanes 3 and 4, respectively), mutant oligonucleotide 1 (20- and 200-fold) (lanes 5 and 6, respectively), and mutant oligonucleotide 2 (20- and 200-fold) (lanes 7 and 8, respectively). The specific shifted bands are shown by arrows. WT-B, WT oligonucleotide B; mut-1, mutant oligonucleotide 1; mut-2, mutant oligonucleotide 2. (B) Repeats of oligonucleotide B mediate RTA activation poorly in a heterogeneous promoter. Oligonucleotide B or a long oligonucleotide spanning site B (oligonucleotide BL) (both illustrated in Fig. 3A) was inserted in tandem repeats (with the number of repeats as shown) into the SV40 minimal promoter in the pGL3 promoter, which drives the expression of luciferase. Individual reporter constructs were cotransfected into 293T cells with either empty vector or RTA expression vector, and the fold induction by RTA was calculated; the error bars represent standard deviations of the results from at least two independent experiments.
|
RBP-J plays an essential role in RTA activation of the K14/vGPCR promoters. In the experiments described above, we identified three sites (A, B, and C) that are important for RTA activation of the K14/vGPCR promoter and studied them individually in terms of RTA binding and activation. We next asked how each site contributes to the overall RTA activation of the intact K14/vGPCR promoter. To do this, we used construct pGL3-222, which contains all three sites in their native context and mediates efficient RTA activation. Single or double mutations were introduced into the A, B, or C site in construct pGL3-222, and their effects on RTA activation were examined by luciferase reporter assay (Fig. 6A). This revealed that the A and C elements are critical, since mutation of either site caused a 70% loss of RTA activation and mutation of both almost completely abolished RTA activation. These data strongly suggested that RBP-J binding plays a central role in RTA-mediated activation of the K14/vGPCR promoter. To further validate this, we examined the ability of this promoter to be activated in cells derived from mice in which the RBP-J gene has been inactivated by homologous recombination. We observed a near-total loss of RTA activation of the full-length promoter pGL3-222 in RBP-J/ OT11cells (7.5-fold) compared to the isogenic RBP-J+/+ OT13 cells (283-fold) (Fig. 6B). In contrast, RTA activation of pGL3-222(Am+Cm), which contained mutations in both RBP-J sites, was significantly lower in OT13 cells (13.4-fold), which was a similarly low level as in OT11 cells (6.8-fold) (Fig. 6B). Moreover, introduction of RBP-J protein into OT11 cells by cotransfection of an RBP-J expression vector partially restored RTA activation of pGL3-222 (46-fold) but not that of the mutant promoter (5.3-fold) (Fig. 6B). Correspondingly, the construct pGL3-184 (with a deletion of site A) was activated only 25-fold by RTA in WT cells, considerably lower than the construct pGL3-222 (280-fold), and the construct pGL3-98 (with the deletion of both sites A and C) had a nearly no responsiveness (2.4-fold) to RTA (Fig. 6B), further confirming that RTA activation of the K14/vGPCR promoter is mainly RBP-J dependent and through sites A and C.
![]() View larger version (14K): [in a new window] |
FIG. 6. RBP-J plays a central role in RTA-mediated activation of the K14/vGPCR promoter. (A) Reporter construct pGL3-222 contains all three major RTA response elements, A, B, and C. Single mutation of site A, B, or C is indicated by Am, Bm, and Cm, respectively; corresponding double mutants are indicated by Am+Bm, Am+Cm, and Bm+Cm. The fold activation by RTA on each mutant was determined, normalized against that for the WT construct pGL3-222, and plotted as percent activation. The error bars represent standard deviations of the results from at least two independent experiments. (B) Comparison of RTA activation of the K14/vGPCR promoter constructs in OT13 (WT) and OT11 (RBP-J/) cells. OT13 or OT11 cells were transfected with 0.6 µg of individual K14/vGPCR reporter constructs [pGL3-222, pGL3-222(Am+Cm), pGL3-184, pGL3-130, or pGL3-98], 0 to 0.6 µg of RTA expression vector, and 0 to 0.6 µg of RBP-J expression vector (in OT11 cells only). pcDNA3.1-lacZ was included in each transfection as an internal control, and total DNA was normalized to 2 µg with vector pcDNA3.1. The fold induction by RTA was plotted, with the error bars representing standard deviations of the results from at least two independent experiments.
|
|
|
|---|
RBP-J is a downstream target of the Notch pathway, a conserved signal transduction pathway that is important in development and cell fate determination (43). The intracellular domain (ICD) of activated Notch is released from the membrane through proteolytic cleavage and is translocated to the nucleus, where it is directed to target promoters through interaction with RBP-J (47, 68). RBP-J is a repressor in the ground state; its interaction with Notch ICD relieves this repression and turns on target genes. Interestingly, KSHV is not the only virus that has parasitized this pathway. Several viral transcription factors, e.g., EBNA2 and EBNA3 of Epstein-Barr virus and the 13S isoform of adenovirus E1A, are known to bind and activate target genes via RBP-J interactions (1, 22, 25, 26, 29). In all cases, the viral proteins target the same (central repressive) domain of RBP-J that is targeted by Notch, although KSHV RTA is capable of interactions with an additional region of RBP-J in vitro (33).
The expression of vGPCR has been prominently linked to phenotypic changes that suggest important roles in KS pathogenesis. Not only does the protein trigger cell-autonomous proliferation, but it also can induce the expression of the proangiogenic molecule VEGF (3, 4). However, both of these activities are expected to be curtailed in the environment of lytic replication: cell proliferation is limited by virus-induced cytopathology, and VEGF expression is reduced by a virus-induced shutoff of host mRNA accumulation (B. Glaunsinger and D. Ganem, unpublished data). One way to resolve this conundrum is to imagine that vGPCR, which is not part of the standard latency program of KSHV, can be expressed outside the lytic program under certain conditions. Our finding of two functional RBP-J sites in the K14/vGPCR promoter suggests a potential role for Notch signaling in the induction of K14/vGPCR gene expression in the absence of RTA induction. That is, the activated Notch ICD molecule might also be able to utilize the same RBP-J-binding sites to activate vGPCR expression from latent viral genomes. Different Notch molecules (mammalian cells contain four Notch molecules, Notch-1 to -4) and their ligands (Jagged-1 and -2 and Delta-1, -3, and -4) are expressed in diverse cell types, including endothelial cells (55, 65) and B cells (6, 48), the two host cells for KSHV infection. Studies have suggested that Notch signals are involved in endothelial cell differentiation and B-cell development (5, 28, 48, 50). Therefore, it is possible that the Notch molecules in these cells can be activated by local signals and thus induce the expression of the K14/vGPCR transcript. Since the activated Notch-1 molecule has been shown not to induce the whole lytic cycle of KSHV (34), vGPCR would be free to function without the constraints of host shutoff and cell injury imposed by lytic growth. Further studies are now under way to explore this hypothesis.
D.G. is an investigator of the Howard Hughes Medical Institute.
|
|
|---|
B by the human herpesvirus 8 chemokine receptor ORF74: evidence for a paracrine model of Kaposi's sarcoma pathogenesis. J. Virol. 75:8660-8673.
) in activation of the Kaposi's sarcoma-associated herpesvirus (KSHV) lytic-cycle replication-associated protein (RAP) promoter in cooperation with the KSHV replication and transcription activator (RTA) and RAP. J. Virol. 77:600-623.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»