Previous Article | Next Article 
Journal of Virology, April 2003, p. 4818-4826, Vol. 77, No. 8
0022-538X/03/$08.00+0 DOI: 10.1128/JVI.77.8.4818-4826.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Interactions between Papillomavirus L1 and L2 Capsid Proteins
Renée L. Finnen,1 Kimberly D. Erickson,1 Xiaojiang S. Chen,2 and Robert L. Garcea1*
Section of Pediatric Hematology/Oncology,1
Department of Biochemistry and Molecular Genetics, University of Colorado School of Medicine, Denver, Colorado 802622
Received 15 November 2002/
Accepted 16 January 2003

ABSTRACT
The human papillomavirus (HPV) capsid consists of 360 copies
of the major capsid protein, L1, arranged as 72 pentamers on
a T=7 icosahedral lattice, with substoichiometric amounts of
the minor capsid protein, L2. In order to understand the arrangement
of L2 within the HPV virion, we have defined and biochemically
characterized a domain of L2 that interacts with L1 pentamers.
We utilized an in vivo binding assay involving the coexpression
of recombinant HPV type 11 (HPV11) L1 and HPV11 glutathione
S-transferase (GST) L2 fusion proteins in
Escherichia coli.
In this system, L1 forms pentamers, GST=L2 associates with these
pentamers, and L1+L2 complexes are subsequently isolated by
using the GST tag on L2. The stoichiometry of L1:L2 in purified
L1+L2 complexes was 5:1, indicating that a single molecule of
L2 interacts with an L1 pentamer. Coexpression of HPV11 L1 with
deletion mutants of HPV11 L2 defined an L1-binding domain contained
within amino acids 396 to 439 near the carboxy terminus of L2.
L2 proteins from eight different human and animal papillomavirus
serotypes were tested for their ability to interact with HPV11
L1. This analysis targeted a hydrophobic region within the L1-binding
domain of L2 as critical for L1 binding. Introduction of negative
charges into this hydrophobic region by site-directed mutagenesis
disrupted L1 binding. L1-L2 interactions were not significantly
disrupted by treatment with high salt concentrations (2 M NaCl),
weak detergents, and urea concentrations of up to 2 M, further
indicating that L1 binding by this domain is mediated by strong
hydrophobic interactions. L1+L2 protein complexes were able
to form virus-like particles in vitro at pH 5.2 and also at
pH 6.8, a pH that is nonpermissive for assembly of L1 protein
alone. Thus, L1/L2 interactions are primarily hydrophobic, encompass
a relatively short stretch of amino acids, and have significant
effects upon in vitro assembly.

INTRODUCTION
Papillomaviruses are small, nonenveloped, double-stranded DNA
viruses. These viruses are pathogens of epithelial surfaces
and cause a variety of proliferating lesions in humans and animals.
Infection by high-risk subtypes of human papillomavirus (HPV)
such as HPV type 16 (HPV16) and HPV18 is directly related to
the subsequent development of cervical cancer (
4,
38,
39). Papillomavirus
capsids are ca. 600 Å in diameter and composed of 72 pentameric
capsomeres arranged in a T=7 icosahedral lattice (
2,
7,
50).
Each capsomere contains five monomers of the 55-kDa major capsid
protein, L1. The capsid also contains ca. 12 copies of the 74-kDa
L2 minor capsid protein, possibly associated with the 12 pentavalent
capsomeres (
13,
50). Expression of recombinant L1 or L1+L2 in
a variety of expression systems results in the self-assembly
of virus-like particles (VLPs) that approximate the structure
of native virions (
22,
30,
31,
44,
46,
55). The structure of
"small," T=1 VLPs assembled from HPV16 L1 expressed in
Escherichia coli (
6) has recently been determined at a 3.5-Å resolution,
providing insights into the conformation of neutralizing epitopes,
potential receptor binding sites, and the nature of intercapsomeric
contacts (
7). This structure has led to an atomic model of full-sized
T=7 papillomavirus capsids (
35) in which L1 pentamers interact
with one another via flexible carboxy-terminal arms in a similar
fashion to that observed for capsomere interactions in polyomaviruses
(
32).
The structural relationship of L2 to L1 within the papillomavirus virion is unknown. Three-dimensional reconstruction of cryoelectron micrographs of bovine papillomavirus (BPV) virions at a 9-Å resolution suggests that L2 associates with the 12 pentavalent capsomeres present on the virion (50). Some researchers have estimated that there are as many as 36 copies of L2 per virion (13). By analogy with the relationship of the polyomavirus minor capsid proteins VP2 and VP3, with the major structural protein, VP1 (8, 21), L2 may interact with residues in the central cavity of an L1 pentamer. The disassembly characteristics of HPV33 VLPs under various salt conditions indicates that L1-L2 interactions are noncovalent and have both salt-dependent and salt-independent contacts (45). Recently, two distinct L1-binding domains have been identified for BPV type 1 (BPV1) L2, both of which are required for encapsidation of the BPV1 genome (37). The involvement of L2 in genome encapsidation coupled with the DNA-binding properties of L2 (14, 34, 54) suggests that, within a virion, L2 forms contacts with the viral genome in addition to contacts with L1 pentamers. Another domain of L2 may be exposed at the virion surface, forming a specific epitope for immune recognition (15, 26, 27, 33). This surface-exposed region of L2 may also interact with a cellular receptor to facilitate uptake of virions (28).
In order to characterize the position of L2 within the papillomavirus capsid, we sought to define the domain(s) on HPV11 L2 that interact with L1 pentamers. We utilized a bacterial coexpression system in which L1+L2 complexes form in the bacteria and are then purified. By analyzing the ability of truncated and mutated forms of L2 to form complexes, we defined an L1-binding domain within a 44-amino-acid region near the carboxy terminus of L2 and identified a hydrophobic region within this domain that facilitated L1 binding. Purified L1+L2 complexes also permitted a biochemical analysis of L1-L2 interactions and investigations into the specific effects of the minor capsid protein on in vitro assembly of VLPs.

MATERIALS AND METHODS
Cloning and construction of deletion and site-directed mutants.
Full-length HPV11 L1 DNA sequence was obtained by PCR amplification
from plasmid pVL11L1 (
44) with the forward primer 5'-GCCGCGAAGCTT
CATATGTGGCGGCCTAGCGCAG,
containing an
NdeI restriction enzyme site at the initiator
methionine codon, and the reverse primer, 5'-GGGCCTGGATCCAGATCTCACAACACACACTGACACAC.
The PCR-amplified fragment was subcloned into a PCR II vector
(Invitrogen) by using manufacturer's protocols. An
NdeI/
BstXI
fragment encompassing the amplified sequences was excised from
this intermediate vector, purified, and then ligated to similarly
digested pET17b vector (Novagen) to generate pET17b-HPV11 L1.
The pXA/BN-based vectors, used for expressing HPV11 GST=L2 fusion
proteins and all other GST=L2 fusion protein derivatives described
here, were engineered from the original pAC vector described
by Chen et al. (
8) to incorporate the multiple cloning site
of pGEX-4T-2 (Pharmacia). Originally, full-length HPV11 L2 DNA
was obtained by PCR amplification from a PCR II vector (Invitrogen)
containing full-length HPV11 L2 DNA (PCRII/L2) with a forward
primer, 5'-GGG
GGATCCATGAAACCTAGGGCACGC, containing a
BamHI restriction
site at the 5' terminus and a reverse primer, 5'-GGG
GCGGCCGCCTAGGCCGCCACATCTG,
containing a
NotI restriction site at the 3' terminus. The PCR-amplified
fragment was subcloned into a PCR II vector, and then a
BamHI/
NotI
fragment excised from this intermediate vector was ligated to
similarly digested pGEX-4T-2. The pGEX-4T-2 vector containing
L2 was used as a source of
BamHI/
NotI fragment to subclone into
pXA/BN to generate pXA/BN-HPV11 L2. A similar strategy was used
to construct the initial deletion mutants of HPV11 L2 encompassing
amino acids 1 to 156, 1 to 309, 157 to 309, 157 to 455, and
313 to 455. The primer pairs used for PCR amplification of these
and subsequent deletion mutants are given in Table
1. For subsequent
deletion mutants, the HPV11 L2 DNA was amplified from pXA/BN-HPV11
L2 and subcloned into pCR2.1-TOPO vector (Invitrogen) according
to the manufacturer's instructions.
BamHI/
NotI fragments encompassing
the amplified sequences were excised from these intermediate
vectors and subcloned into pXA/BN. This strategy was also used
to clone sequences corresponding to the carboxy termini of various
papillomavirus L2s, with the exception of BPV1 L2, which was
cloned as a
BamHI/
XhoI fragment. These full-length L2 sequences
were aligned with the full-length sequence of HPV11 L2 by using
Vector NTI AlignX software (InforMax) to define candidate amino
acids for incorporation into each construct (Table
2). Overlap
extension PCR with paired mutagenic primers (
24,
52) was used
for the site-directed mutagenesis of specific HPV11 L2 amino
acids. The sequence of these mutagenic primers is given in Table
1; the forward and reverse outside primers used to amplify a
fragment containing the mutated sequence were 5'-GGGCTGGCAAGCCACGTTTGGTG
and 5'-AATTCC
AGATCTATACACTCCGCTATCGC, respectively. Cloning
of the amplified sequences into pXA/BN was performed as outlined
above. The sequence of all DNA subjected to PCR amplification
was verified by sequencing.
Expression and purification of L1+L2 complexes.
Plasmid pET17b-HPV11 L1 was cotransformed with the appropriate
pXA/BN-based L2 expression plasmid into the bacterial host BL21(DE3).
Typically, a single isolated colony of cotransformed bacteria
was inoculated into 5 ml of 2
x yeast-tryptone medium supplemented
with ampicillin (100 µg/ml) and chloramphenicol (40 µg/ml)
and grown overnight at 37°C. Fresh medium (5 ml) was inoculated
with 0.1 ml of this overnight culture and allowed to grow 5
to 6 h at 37°C. This culture was used to inoculate larger-scale
cultures (one 5-ml starter culture per liter) which were subsequently
grown at 37°C to an optical density at 600 nm of

0.2. The
cultures were then induced with 0.2 mM IPTG (isopropyl-ß-
D-thiogalactopyranoside)
and grown at 37°C for 5 to 6 h or cooled to 25°C, induced
with 0.2 mM IPTG and grown overnight at 25°C. Cell pellets
were resuspended in lysis buffer (40 mM Tris-Cl [pH 8.0], 0.2
M NaCl, 5% glycerol, 1 mM EDTA, 5 mM dithiothreitol [DTT]) supplemented
with protease inhibitors (5 µg of pepstatin/ml, 2 µg
of leupeptin/ml, 2 mM phenylmethylsulfonyl fluoride). The following
steps were carried out at 4°C. Cells were lysed by the addition
of 0.5 mg of lysozyme/ml, followed by incubation for 20 min,
followed by the addition of 0.1% deoxycholate and incubation
for an additional 10 min. The lysates were then treated with
10 U of DNase I/ml in the presence of 5 mM MgCl
2 for 30 min.
To reduce the viscosity of the DNase-treated lysate, the lysates
were briefly sonicated. The sonicated lysates were then centrifuged
at 17,000
x g for 1 h, and the supernatant was passed over a
10-ml bed volume glutathione-Sepharose column (Pharmacia). The
columns were washed with buffer L (40 mM Tris-Cl [pH 8.0], 0.2
M NaCl, 1 mM EDTA, 2 mM DTT) until no protein was detectable
in the wash (

20 bed volumes). To purify L1+GST=L2 complexes,
bound proteins were eluted with 10 mM reduced gluthathione in
buffer L. To purify L1+L2(313-455) complexes with the GST tag
removed, the columns were washed with 1.5 bed volumes of buffer
L without DTT and then treated with

1 NIH unit of thrombin per
100 µg of protein in 1.5 bed volumes of buffer L without
DTT for at least 1 h at room temperature. Thrombin-treated columns
were then eluted with buffer L without DTT, and the DTT concentration
of the eluate was adjusted to 10 mM by the addition of 1 M DTT.
The eluates were concentrated by using Centriplus concentrators
(Amicon). To further purify L1+L2 complexes from contaminating
bacterial proteins, free L2, and L2 degradation and/or premature
termination products, eluted proteins were subjected to size
exclusion fast-pressure liquid chromatography (FPLC) by using
a HiLoad Superdex 200 gel filtration column (Pharmacia). FPLC
fractions containing L1+L2 complexes were pooled and further
concentrated as outlined above. Protein complexes were analyzed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE), followed by Coomassie blue staining or immunoblotting
(
44). For all coexpressions, samples of the soluble fraction
of the bacterial lysate prior to glutathione-Sepharose chromatography
were verified by immunoblot analysis for the presence of L1.
For densitometric analysis on Coomassie blue-stained gels, images
were captured by using a Fluor-S MultiImager (Bio-Rad) with
Quantity One software (Bio-Rad) and quantitated by using ImageQuant
software (Molecular Dynamics).
Disruption of L1+L2 complexes.
A complex of HPV11 L1 bound to HPV11 GST=L2(313-455) was immobilized on glutathione-Sepharose beads. Equal fractions of these beads were subjected to the buffer treatments described in the legend to Fig. 8 for 1 h at room temperature. Treated beads were then pelleted by centrifugation, and 50-µl samples of the supernatants were analyzed by SDS-PAGE and immunoblotting for the presence of L1. Densitometric analysis on Coomassie blue-stained gels was performed as described above in three independent experiments.
Assembly conditions and electron microscopy.
Purified proteins (100 µg/ml) were dialyzed by microdialysis
into assembly buffer that did not contain disulfide reducing
agents (40 mM HEPES [pH 6.8], 0.5 M NaCl or 40 mM sodium citrate
[pH 5.2], 0.5 M NaCl) at room temperature for 1 h (
6). Samples
were absorbed onto glow-discharged Formvar-carbon-coated 400
mesh copper grids and stained with 2% uranyl acetate. Specimens
were analyzed by transmission electron microscopy by using a
CM10 electron microscope (Phillips Electronic Instruments, Inc.)
operating at 80 kV.

RESULTS
Bacterial coexpression of L1 and L2.
Initially, HPV11 L1-L2 interactions were studied by using an
in vitro binding assay. HPV11 L1 pentamers and HPV11 L2 GST
fusion proteins (GST=L2) were purified after their individual
expression in
E. coli. GST=L2 was immobilized on glutathione-Sepharose,
purified L1 was incubated with the protein bound to the column,
and eluates from the column were analyzed for the presence of
L1. We were unable to detect binding of L1 to GST=L2 with this
assay (data not shown). We considered that (i) GST=L2, though
soluble, was purified in a conformation that impaired its ability
to bind L1, or (ii) L1 pentamers forming in the absence of L2
might adopt a conformation that excludes L2 from subsequent
direct binding.
We then utilized a system in which L1 and L2 were expressed simultaneously. We adapted a bacterial coexpression system previously developed by Chen et al. for studying interactions between the major (VP1) and minor (VP2) structural proteins of mouse polyomavirus. In this system, the capsid proteins are coexpressed in E. coli from compatible plasmids carrying different selectable markers. Protein complexes form in the bacteria and are subsequently purified by glutathione-Sepharose chromatography by using a GST tag on the minor capsid protein (8).
HPV11 L1 and L2 were used as the homologous protein pair for the initial studies. HPV11 L2 was coexpressed as a GST fusion protein with HPV11 L1 in E. coli BL21(DE3). As shown in Fig. 1, HPV11 L1 coeluted with GST=L2 from the glutathione-Sepharose column when coexpressed with GST=L2 but not with GST alone. Samples of the soluble fraction of the bacterial lysate prior to glutathione-Sepharose chromatography (referred to as starting material in Fig. 1) and samples of the last column wash prior to elution were assayed for HPV11 L1. Using this bacterial coexpression system, up to 5 mg of partially purified L1+L2 complexes were obtained per liter of bacterial culture.
Stoichiometry of the HPV11 L1+L2 complex.
Because the ratio of VP1:VP2 in the polyomavirus VP1+VP2 complex
is 5:1, we anticipated that our L1+L2 complex would have a similar
stoichiometry. Densitometric analysis of partially purified
bacterial eluates yielded an L1/L2 ratio of ca. 2:1 (Fig.
2,
lane 1). We reasoned that free GST=L2 present in these partially
purified eluates would skew the L1:L2 stoichiometry. In addition,
partially purified eluates, like those shown in Fig.
2, contain
degradation and/or premature termination products that originate
from the L2 fusion protein (as determined by anti-GST immunoblot
analysis [data not shown]), as well as contaminating bacterial
chaperone proteins GroEL and DnaK (data not shown). To remove
unbound GST=L2 and chaperones, glutathione-Sepharose eluates
of HPV11 L1 bound to HPV11 GST=L2(313-455) (Fig.
3) were subjected
to size exclusion chromatography. The L1/L2 ratio in the resulting
purified complexes was ca. 5:1 (Fig.
2, lane 2). Thus, we conclude
that a single molecule of L2 associates with a pentamer of L1,
a ratio analogous to that observed in polyomavirus VP1-VP2 interactions
(
8). The increased L1/L2 ratio in the FPLC-purified L1+L2 complexes
confirms that unassociated GST=L2 was present in partially purified
eluates. Indeed, a broad eluting peak containing unassociated
GST=L2 was detected in our FPLC analysis (data not shown).
Identification of a carboxy-terminal L1-binding domain.
The interaction of L1 with L2 in
E. coli provides an assay for
detecting domains of L2 affecting L1 binding. A series of deleted
forms of HPV11 L2 (Fig.
3; the L2 amino acids present in each
truncated derivative are designated and identify the construct)
were analyzed by using the bacterial coexpression assay. For
each combination, immunoblot analysis verified the presence
of L1 in the initial bacterial extract. The ability of each
L2 protein to bind HPV11 L1 was determined by the presence or
absence of L1 in the eluate from the glutathione-Sepharose column
(Fig.
4). This assay identified a single domain, contained within
amino acids 396 through 439, near the carboxy terminus of HPV11
L2 that affected HPV11 L1 binding. This binding domain was distinct
from the L2 nuclear localization signal previously identified
between residues 440 and 445 (
49).
L2 residues facilitating L1 binding.
In order to identify specific residues within the 44-amino-acid
domain of L2 affecting L1 binding, we analyzed the ability of
HPV11 L1 to bind L2 proteins from eight different papillomavirus
serotypes (Table
3). An alignment of the putative L1-binding
domains of the L2 proteins used in this analysis is presented
in Fig.
5. The carboxy-terminal third of each L2 was utilized
in coexpression assays (Table
2). For each combination, immunoblot
analysis verified the presence of L1 in the initial bacterial
extract.
HPV11 L1 formed heterologous complexes with L2 proteins from
other genital isolates (HPV6b, HPV16, and HPV33), from skin
isolates (HPV5 and HPV12) and, surprisingly, from a nonhuman
isolate, COPV1 (Fig.
6A, lanes 2 to 4, and Fig.
6B, lanes 6
to 8). HPV11 L1 was unable to form a complex with either HPV1a
L2 or BPV1 L2 despite robust production of the L2 fusion protein
in both cases (Fig.
6, lanes 5 and 9). The stoichiometry between
L1 and the GST=L2 fusion protein (indicated by the asterisks
on Fig.
6A) in the partially purified extracts of heterologous
complexes formed with the genital isolates was greater than
1:1, as was the case for the homologous complex (Fig.
6A, lanes
1 to 4). This stoichiometry was not found in partially purified
extracts of heterologous complexes formed with the skin isolates
or with COPV1. Instead, the L1:L2 stoichiometry observed was
less than 1:1 (Fig.
6A, lanes 6 to 8). One explanation for the
differences in stoichiometry is that binding was weaker in the
case of complexes formed between HPV11 L1 and L2 proteins from
HPV5 and HPV12 and COPV1, and thus more unassociated L2 was
detectable. Accordingly, we classified L1 binding by the genital
isolates as strong, the skin isolates and COPV1 as weak, and
HPV1a and BPV1 as undetectable (Table
3).
Inspection of the alignment in Fig.
5 does not reveal an obvious
primary amino acid sequence unique to those L2 proteins capable
of binding HPV11 L1. Instead, we noted that the sequence segment
bounded by conserved proline residues at 413 and 419 of HPV11
L2 (boxed in Fig.
5) is predominantly hydrophobic without negatively
charged residues in the L2 proteins classified as strong HPV11
L1 binders. In the case of weak binders, at least one negatively
charged amino acid is present and in the case of both HPV1a
and BPV1, where binding was undetectable, two negatively charged
amino acids are present. Based on these observations, we hypothesized
that disruption of this hydrophobic tract with negatively charged
residues would disrupt HPV11 L1 binding. To test this hypothesis,
alanine 417 and leucine 418 of HPV11 L2 were both changed to
glutamines (AL417418EE), and the ability of this mutant L2 protein
to bind L1 was examined in coexpression assays. As shown in
Fig.
7 lane 2, the double mutant L2 protein AL417418EE was weakened
in its ability to bind L1 with an L1/L2 ratio of 1:3 compared
to 2:1 for wild-type L2 protein (lane 1). The A417E mutant L2
protein (lane 3) displayed a slight disruption in L1 binding
(L1/L2 = 1:1), whereas the L418E mutant L2 protein (lane 4)
displayed no disruption in HPV11 L1 binding (L1/L2 = 2:1). These
results support the importance of the hydrophobic tract between
prolines 413 and 419 in HPV11 L1-L2 binding. Specifically, introduction
of two negatively charged residues at positions 417 and 418
decreased L1-L2 binding.
Another feature of the sequence between residues 413 and 419
is the presence of three proline residues. All other L2 proteins
examined in our studies also contain three prolines in this
region with the exception of BPV1 L2, which contains two prolines.
To test the importance of prolines 413, 416, and 419 of HPV11
L2 in L1 binding, each of these prolines was changed individually
to alanine (P413A, P416A, and P419A), and the ability of these
mutant L2 proteins to bind L1 was examined in coexpression assays.
As shown in Fig.
7, lanes 5, 6, and 7, substituting an alanine
for a proline did not change the ratio of L1 to L2 in all three
cases, indicating that these mutations did not disrupt L1 binding.
Biochemical characterization of L1-L2 binding.
Inspection of the carboxy-terminal L1 binding domain of HPV11 L2 (Fig. 5, top sequence) revealed a high percentage of hydrophobic residues (>50%). The results of our mutational analysis suggested that hydrophobic interactions are important in L1+L2 complex formation. To test the importance of hydrophobic interactions, we analyzed the ability of salt, weak detergents, and urea to disrupt the complex. A complex of HPV11 L1 bound to HPV11 GST=L2(313-455) was immobilized on glutathione-Sepharose beads and incubated with a series of buffers. The amount of L1 in each sample was determined by densitometric scanning of Coomassie blue-stained gels relative to samples treated with buffer L alone, representing the background level of L1 liberated from the complex (baseline), and samples treated with SDS-PAGE loading buffer, representing all bound proteins (100%). A typical result is depicted in Fig. 8A. The relative amount of L1 released by each buffer treatment averaged from three independent experiments is shown in Fig. 8B. Treatment with high salt concentrations (1 or 2 M; Fig. 8A, lanes 1 and 2), weak detergents (lanes 3 to 5), and urea (up to 2 M; lanes 6 to 9) did not release significant amounts (>20%) of L1 from the complex. Even treatment with 5 M urea failed to completely disrupt the L1+L2 complex (Fig. 8A, lane 11). Taken together, these results indicate that the L1-L2 binding is strong and likely mediated by hydrophobic interactions. These results parallel the findings for polyomavirus VP1-VP2 binding, for which the atomic structure of the binding interface reveals predominantly hydrophobic interactions (8).
L2 affects in vitro assembly of VLPs.
The ability to purify L1 pentamers bound to L2 permits study of the specific effects of the minor capsid protein on in vitro assembly of VLPs. We examined the in vitro assembly properties of HPV11 L1 alone in comparison to a HPV11 L1+L2 complex. An L1+GST=L2(313-455) complex was treated with thrombin to remove the GST moiety, and the resulting L1+L2(313-455) complex was dialyzed into assembly buffer at pH 5.2 or 6.8 in parallel with purified L1 as described in Materials and Methods. Acidic pH (5.2 to 5.4) was demonstrated previously to yield the most consistent in vitro assembly results in the case of both HPV11 L1 and HPV16 L1 (6). At pH 5.2, L1 alone assembled into either T=1 or T=7 VLPs (6), whereas L1+L2(313-455) assembled into T=1 VLPs (data not shown). At pH 6.8, L1 alone was unable to assemble into VLPs, and free pentamers or aggregated clumps of pentamers were predominantly observed (Fig. 9). In contrast, L1+L2(313-455) assembled into T=1 VLPs at pH 6.8 (Fig. 9). These results suggest that L2 facilitates T=1 VLP assembly at a more physiological pH.

DISCUSSION
We utilized an in vivo bacterial coexpression system developed
to study the VP1-VP2 interactions of mouse polyomavirus in order
to study the intermolecular interactions of L1 and L2 of HPV11.
Using bacterial coexpression, we defined a 44-amino-acid region
near the carboxy terminus of L2 that specifically interacted
with L1 with an estimated stoichiometry of one L2 molecule per
five L1 molecules. L1 binding to this domain is mediated by
strong hydrophobic interactions involving L2 amino acids 413
to 419. The strength of L1 binding by this domain under physiological
salt concentrations implicates it as the principal domain responsible
for anchoring L2 within the papillomavirus virion. Other weaker
interactions with L1, such as those detectable under higher
salt concentrations (
37,
45), may serve to further align L2
within the virion and/or aid in encapsidation of the viral genome
(
37).
A striking feature of the 44-amino-acid L1-binding domain of HPV11 L2 is the presence of a proline at every third residue (PxxP), commencing at proline 410 (see Fig. 5). Proline-rich sequences containing a PxxP motif are commonly involved in protein-protein interactions, for example, in the ligands of proteins with Src homology 3 domains (29). Such an arrangement of prolines would also allow a sharp bending of the polypeptide chain, which may facilitate a short stretch of L2 to enter and exit the central cavity of the L1 pentamer.
The salt concentration used in our purification buffers was 0.2 M NaCl, and thus the domain we identified may correspond to the "salt-independent" L1-binding domain of L2 previously identified by Sapp et al. for HPV33 L1-L2 interactions (45). In these studies, HPV33 L1+L2 VLPs, purified after recombinant capsid protein coexpression in insect cells, were disassembled under low-salt (0.15 M NaCl) and high-salt (0.5 M NaCl) conditions. L1-L2 interactions that were detectable after low-salt disassembly were referred to as salt independent, whereas those that were detectable only after high-salt disassembly were referred to as salt dependent. For BPV1, a single 77-amino-acid L1-binding domain located near the carboxy terminus of L2 was identified by mixing disassembled L1 VLPs with in vitro-translated L2 under low-salt concentrations (37). This domain is analogous to the L1-binding domain identified in our studies with HPV11. An additional L1-binding domain was identified in the central portion of BPV1 L2 by using in vivo coimmunoprecipitation experiments carried out in buffer containing 0.5 M NaCl (37). Thus, this second L1-binding domain may represent a salt-dependent binding domain. A comparable second binding domain was not detected under our assay conditions.
Our initial investigations uncovered a strong influence of L2 on in vitro capsid assembly. When L1 is in complex with the carboxy-terminal 143 amino acids of L2, T=1 VLPs can form at neutral pH. Perhaps the carboxy terminus of L2 neutralizes charges on L1 and/or induces conformational changes in L1, thereby permitting the assembly of T=1 VLPs at neutral pH. The assembly of L1+L2 into full-size T=7 VLPs at neutral pH may require further modification of the in vitro assembly buffer conditions, different lengths of L2 or a combination of L1 and L1+L2 containing capsomeres.
The location of the principal L1-binding site on L2 and the stoichiometry and hydrophobic nature of the L1-L2 interactions have interesting parallels to the mouse polyomavirus VP1-VP2 interface (3, 8). However, although the major protein-minor protein interactions for the two virus families are similar in these respects, a major difference lies in the number of capsomeres occupied by the minor structural protein(s) within the virion. In polyomavirus virions, every capsomere is occupied by either VP2 or VP3, an internally initiated form of VP2 that shares the same carboxy terminus (18, 32). In papillomavirus virions there is a single minor structural protein, and only the pentavalent capsomeres are thought to be occupied by the minor structural protein (50). This difference in virion architecture may reflect the differences in the biology of assembly of these two viruses. Polyomavirus VP1-VP2/3 complexes assemble in the cytoplasm and are translocated together to the nucleus (12, 17, 25). Recent studies indicate that papillomavirus L1 and L2 do not preassemble in the cytoplasm but instead are separately translocated to the nucleus (16). L2 translocates to the nucleus first, localizes to promyelocytic leukemia oncogenic domains, and then recruits L1 pentamers to these domains for subsequent virion assembly (11, 16). These observations are consistent with L2 playing a direct role in facilitating the assembly of L1 pentamers into virions. However, thus far we have been unable to form complexes of L1+L2 in vitro without coexpression, suggesting that other mediating factors exist in vivo.
One practical application of our bacterial coexpression technology is in the improvement of both prophylactic and therapeutic papillomavirus vaccines for controlling cervical cancer. Prophylactic vaccines currently in clinical trials are based upon VLPs assembled from HPV16 L1 (5, 19, 23, 47, 48). Cross-protection against other papillomavirus serotypes may not be adequately provided by these VLPs, since neutralizing immune responses tend to be predominantly type specific (9, 10, 40, 41, 43, 51). L2 has been demonstrated to generate cross-neutralizing antisera (42), and thus inclusion of L2 in a vaccine formulation may provide a broader spectrum of prophylaxis than L1 alone. We have demonstrated in the present study that heterologous L1+L2 complexes can be produced in bacteria. Thus, it may be possible to develop heterologous VLPs or heterologous capsomeres, a promising alternative to VLPs (53), to further improve the spectrum of protection in a prophylactic vaccine. One approach to developing a therapeutic vaccine for treating established cervical carcinomas has been to create VLPs containing an immunotherapeutic protein, typically E7 ("chimeric" VLPs [36]). The L1-binding domain of L2 could be fused to the desired immunotherapeutic protein, thereby allowing its incorporation into a VLP. This approach offers certain advantages over strategies that utilized full-length L2 to incorporate the desired foreign sequence in vivo (20). Since only a portion of L2 need be used (possibly as small as 44 amino acids), longer foreign sequences can be introduced. Also, since every pentamer would have foreign sequence attached, it may be possible to incorporate 72 copies of the foreign sequence into a VLP. These features, coupled with the cost-effectiveness of a bacterial system, make this an appealing technology for chimeric VLP production.

ACKNOWLEDGMENTS
We thank Maolin Li for providing pET17b-HPV11 L1 and Ken Kosten
for providing the original GST=L2 constructs. We thank Cossette
Wheeler, Peter Sehr, and Dick Schlegel for reagents.
R.L.G. was supported by NIH/NCI grant CA37667. K.D.E. was supported by NIH postdoctoral training grant T32 AI07537.

FOOTNOTES
* Corresponding author. Mailing address: Section of Pediatric Hematology/Oncology, University of Colorado School of Medicine, 4200 E. 9th Ave., Denver, CO 80262. Phone: (303) 315-3247. Fax: (303) 315-3244. E-mail:
bob.garcea{at}uchsc.edu.


REFERENCES
1 - Anonymous. 1997. Phylogenetic tree, p. 1-3. In G. Myers, C. Baker, K. Münger, F. Sverdrup, A. McBride, H.-U. Bernard, and J. Meissner (ed.), Human papillomaviruses. Los Alamos National Laboratory Theoretical Biology and Biophysics Group, Los Alamos, N.Mex.
2 - Baker, T. S., W. W. Newcomb, N. H. Olson, L. M. Cowsert, C. Olson, and J. C. Brown. 1991. Structures of bovine and human papillomaviruses: analysis by cryoelectron microscopy and three-dimensional image reconstruction. Biophys. J. 60:1445-1456.[Medline]
3 - Barouch, D. H., and S. C. Harrison. 1994. Interactions among the major and minor coat proteins of polyomavirus. J. Virol. 68:3982-3989.[Abstract/Free Full Text]
4 - Bosch, F. X., M. M. Manos, N. Munoz, M. Sherman, A. M. Jansen, J. Peto, M. H. Schiffman, V. Moreno, R. Kurman, K. V. Shah, et al. 1995. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. J. Natl. Cancer Inst. 87:796-802.[Abstract/Free Full Text]
5 - Cain, J. M., and M. K. Howett. 2000. Preventing cervical cancer. Science 288:1753-1755.[Free Full Text]
6 - Chen, X. S., G. Casini, S. C. Harrison, and R. L. Garcea. 2001. Papillomavirus capsid protein expression in Escherichia coli: purification and assembly of HPV11 and HPV16 L1. J. Mol. Biol. 307:173-182.[CrossRef][Medline]
7 - Chen, X. S., R. L. Garcea, I. Goldberg, G. Casini, and S. C. Harrison. 2000. Structure of small virus-like particles assembled from the L1 protein of human papillomavirus 16. Mol. Cell 5:557-567.[CrossRef][Medline]
8 - Chen, X. S., T. Stehle, and S. C. Harrison. 1998. Interaction of polyomavirus internal protein VP2 with the major capsid protein VP1 and implications for participation of VP2 in viral entry. EMBO J. 17:3233-3240.[CrossRef][Medline]
9 - Christensen, N. D., R. Hopfl, S. L. DiAngelo, N. M. Cladel, S. D. Patrick, P. A. Welsh, L. R. Budgeon, C. A. Reed, and J. W. Kreider. 1994. Assembled baculovirus-expressed human papillomavirus type 11 L1 capsid protein virus-like particles are recognized by neutralizing monoclonal antibodies and induce high titres of neutralizing antibodies. J. Gen. Virol. 75(Pt. 9):2271-2276.[Abstract/Free Full Text]
10 - Christensen, N. D., J. W. Kreider, N. M. Cladel, and D. A. Galloway. 1990. Immunological cross-reactivity to laboratory-produced HPV-11 virions of polysera raised against bacterially derived fusion proteins and synthetic peptides of HPV-6b and HPV-16 capsid proteins. Virology 175:1-9.[CrossRef][Medline]
11 - Day, P. M., R. B. Roden, D. R. Lowy, and J. T. Schiller. 1998. The papillomavirus minor capsid protein, L2, induces localization of the major capsid protein, L1, and the viral transcription/replication protein, E2, to PML oncogenic domains. J. Virol. 72:142-150.[Abstract/Free Full Text]
12 - Delos, S. E., L. Montross, R. B. Moreland, and R. L. Garcea. 1993. Expression of the polyomavirus VP2 and VP3 proteins in insect cells: coexpression with the major capsid protein VP1 alters VP2/VP3 subcellular localization. Virology 194:393-398.[CrossRef][Medline]
13 - Doorbar, J., and P. H. Gallimore. 1987. Identification of proteins encoded by the L1 and L2 open reading frames of human papillomavirus 1a. J. Virol. 61:2793-2799.[Abstract/Free Full Text]
14 - El Mehdaoui, S., A. Touze, S. Laurent, P. Y. Sizaret, D. Rasschaert, and P. Coursaget. 2000. Gene transfer using recombinant rabbit hemorrhagic disease virus capsids with genetically modified DNA encapsidation capacity by addition of packaging sequences from the L1 or L2 protein of human papillomavirus type 16. J. Virol. 74:10332-10340.[Abstract/Free Full Text]
15 - Embers, M. E., L. R. Budgeon, M. Pickel, and N. D. Christensen. 2002. Protective immunity to rabbit oral and cutaneous papillomaviruses by immunization with short peptides of L2, the minor capsid protein. J. Virol. 76:9798-9805.
16 - Florin, L., C. Sapp, R. E. Streeck, and M. Sapp. 2002. Assembly and translocation of papillomavirus capsid proteins. J. Virol. 76:10009-10014.[Abstract/Free Full Text]
17 - Forstova, J., N. Krauzewicz, S. Wallace, A. J. Street, S. M. Dilworth, S. Beard, and B. E. Griffin. 1993. Cooperation of structural proteins during late events in the life cycle of polyomavirus. J. Virol. 67:1405-1413.[Abstract/Free Full Text]
18 - Garcea, R. L., and R. C. Liddington. 1997. Structural biology of polyomaviruses, p. 187-208. In W. Chiu, R. M. Burnett, and R. L. Garcea (ed.), Structural biology of viruses. Oxford University Press, New York, N.Y.
19 - Gissmann, L., W. Osen, M. Muller, and I. Jochmus. 2001. Therapeutic vaccines for human papillomaviruses. Intervirology 44:167-175.[CrossRef][Medline]
20 - Greenstone, H. L., J. D. Nieland, K. E. de Visser, M. L. De Bruijn, R. Kirnbauer, R. B. Roden, D. R. Lowy, W. M. Kast, and J. T. Schiller. 1998. Chimeric papillomavirus virus-like particles elicit antitumor immunity against the E7 oncoprotein in an HPV16 tumor model. Proc. Natl. Acad. Sci. USA 95:1800-1805.[Abstract/Free Full Text]
21 - Griffith, J. P., D. L. Griffith, I. Rayment, W. T. Murakami, and D. L. Caspar. 1992. Inside polyomavirus at 25-Å resolution. Nature 355:652-654.[CrossRef][Medline]
22 - Hagensee, M. E., N. Yaegashi, and D. A. Galloway. 1993. Self-assembly of human papillomavirus type 1 capsids by expression of the L1 protein alone or by coexpression of the L1 and L2 capsid proteins. J. Virol. 67:315-322.[Abstract/Free Full Text]
23 - Harro, C. D., Y. Y. Pang, R. B. Roden, A. Hildesheim, Z. Wang, M. J. Reynolds, T. C. Mast, R. Robinson, B. R. Murphy, R. A. Karron, J. Dillner, J. T. Schiller, and D. R. Lowy. 2001. Safety and immunogenicity trial in adult volunteers of a human papillomavirus 16 L1 virus-like particle vaccine. J. Natl. Cancer Inst. 93:284-292.[Abstract/Free Full Text]
24 - Horton, R. M., Z. L. Cai, S. N. Ho, and L. R. Pease. 1990. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques 8:528-535.[Medline]
25 - Ishii, N., A. Nakanishi, M. Yamada, M. H. Macalalad, and H. Kasamatsu. 1994. Functional complementation of nuclear targeting-defective mutants of simian virus 40 structural proteins. J. Virol. 68:8209-8216.[Abstract/Free Full Text]
26 - Kawana, K., K. Matsumoto, H. Yoshikawa, Y. Taketani, T. Kawana, K. Yoshiike, and T. Kanda. 1998. A surface immunodeterminant of human papillomavirus type 16 minor capsid protein L2. Virology 245:353-359.[CrossRef][Medline]
27 - Kawana, K., H. Yoshikawa, Y. Taketani, K. Yoshiike, and T. Kanda. 1999. Common neutralization epitope in minor capsid protein L2 of human papillomavirus types 16 and 6. J. Virol. 73:6188-6190.[Abstract/Free Full Text]
28 - Kawana, Y., K. Kawana, H. Yoshikawa, Y. Taketani, K. Yoshiike, and T. Kanda. 2001. Human papillomavirus type 16 minor capsid protein l2 N-terminal region containing a common neutralization epitope binds to the cell surface and enters the cytoplasm. J. Virol. 75:2331-2336.[Abstract/Free Full Text]
29 - Kay, B. K., M. P. Williamson, and M. Sudol. 2000. The importance of being proline: the interaction of proline-rich motifs in signaling proteins with their cognate domains. FASEB J. 14:231-241.[Abstract/Free Full Text]
30 - Kirnbauer, R., F. Booy, N. Cheng, D. R. Lowy, and J. T. Schiller. 1992. Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic. Proc. Natl. Acad. Sci. USA 89:12180-12184.[Abstract/Free Full Text]
31 - Kirnbauer, R., J. Taub, H. Greenstone, R. Roden, M. Durst, L. Gissmann, D. R. Lowy, and J. T. Schiller. 1993. Efficient self-assembly of human papillomavirus type 16 L1 and L1-L2 into virus-like particles. J. Virol. 67:6929-6936.[Abstract/Free Full Text]
32 - Liddington, R. C., Y. Yan, J. Moulai, R. Sahli, T. L. Benjamin, and S. C. Harrison. 1991. Structure of simian virus 40 at 3.8-Å resolution. Nature 354:278-284.[CrossRef][Medline]
33 - Liu, W. J., L. Gissmann, X. Y. Sun, A. Kanjanahaluethai, M. Muller, J. Doorbar, and J. Zhou. 1997. Sequence close to the N terminus of L2 protein is displayed on the surface of bovine papillomavirus type 1 virions. Virology 227:474-483.[CrossRef][Medline]
34 - Mallon, R. G., D. Wojciechowicz, and V. Defendi. 1987. DNA-binding activity of papillomavirus proteins. J. Virol. 61:1655-1660.[Abstract/Free Full Text]
35 - Modis, Y., B. L. Trus, and S. C. Harrison. 2002. Atomic model of the papillomavirus capsid. EMBO J. 21:4754-4762.[CrossRef][Medline]
36 - Muller, M., J. Zhou, T. D. Reed, C. Rittmuller, A. Burger, J. Gabelsberger, J. Braspenning, and L. Gissmann. 1997. Chimeric papillomavirus-like particles. Virology 234:93-111.[CrossRef][Medline]
37 - Okun, M. M., P. M. Day, H. L. Greenstone, F. P. Booy, D. R. Lowy, J. T. Schiller, and R. B. Roden. 2001. L1 interaction domains of papillomavirus L2 necessary for viral genome encapsidation. J. Virol. 75:4332-4342.[Abstract/Free Full Text]
38 - Parkin, D. M., F. I. Bray, and S. S. Devesa. 2001. Cancer burden in the year 2000. The global picture. Eur. J. Cancer 37(Suppl. 8):S4-S66.
39 - Pisani, P., D. M. Parkin, and J. Ferlay. 1993. Estimates of the worldwide mortality from eighteen major cancers in 1985. Implications for prevention and projections of future burden. Int. J. Cancer 55:891-903.[Medline]
40 - Roden, R. B., H. L. Greenstone, R. Kirnbauer, F. P. Booy, J. Jessie, D. R. Lowy, and J. T. Schiller. 1996. In vitro generation and type-specific neutralization of a human papillomavirus type 16 virion pseudotype. J. Virol. 70:5875-5883.[Abstract]
41 - Roden, R. B., N. L. Hubbert, R. Kirnbauer, N. D. Christensen, D. R. Lowy, and J. T. Schiller. 1996. Assessment of the serological relatedness of genital human papillomaviruses by hemagglutination inhibition. J. Virol. 70:3298-3301.
42 - Roden, R. B., W. H. t. Yutzy, R. Fallon, S. Inglis, D. R. Lowy, and J. T. Schiller. 2000. Minor capsid protein of human genital papillomaviruses contains subdominant, cross-neutralizing epitopes. Virology 270:254-257.[CrossRef][Medline]
43 - Rose, R. C., W. Bonnez, C. Da Rin, D. J. McCance, and R. C. Reichman. 1994. Serological differentiation of human papillomavirus types 11, 16, and 18 using recombinant virus-like particles. J. Gen. Virol. 75(Pt. 9):2445-2449.[Abstract/Free Full Text]
44 - Rose, R. C., W. Bonnez, R. C. Reichman, and R. L. Garcea. 1993. Expression of human papillomavirus type 11 L1 protein in insect cells: in vivo and in vitro assembly of viruslike particles. J. Virol. 67:1936-1944.[Abstract/Free Full Text]
45 - Sapp, M., C. Volpers, M. Muller, and R. E. Streeck. 1995. Organization of the major and minor capsid proteins in human papillomavirus type 33 virus-like particles. J. Gen. Virol. 76:2407-2412.[Abstract/Free Full Text]
46 - Sasagawa, T., P. Pushko, G. Steers, S. E. Gschmeissner, M. A. Hajibagheri, J. Finch, L. Crawford, and M. Tommasino. 1995. Synthesis and assembly of virus-like particles of human papillomaviruses type 6 and type 16 in fission yeast Schizosaccharomyces pombe. Virology 206:126-135.[CrossRef][Medline]
47 - Schiller, J. T., and A. Hidesheim. 2000. Developing HPV virus-like particle vaccines to prevent cervical cancer: a progress report. J. Clin. Virol. 19:67-74.[CrossRef][Medline]
48 - Schiller, J. T., and D. R. Lowy. 2001. Papillomavirus-like particle based vaccines: cervical cancer and beyond. Expert Opin. Biol. Ther. 1:571-581.[CrossRef][Medline]
49 - Sun, X. Y., I. Frazer, M. Muller, L. Gissmann, and J. Zhou. 1995. Sequences required for the nuclear targeting and accumulation of human papillomavirus type 6B L2 protein. Virology 213:321-327.[CrossRef][Medline]
50 - Trus, B. L., R. B. Roden, H. L. Greenstone, M. Vrhel, J. T. Schiller, and F. P. Booy. 1997. Novel structural features of bovine papillomavirus capsid revealed by a three-dimensional reconstruction to 9 Å resolution. Nat. Struct. Biol. 4:413-420.[CrossRef][Medline]
51 - White, W. I., S. D. Wilson, F. J. Palmer-Hill, R. M. Woods, S. J. Ghim, L. A. Hewitt, D. M. Goldman, S. J. Burke, A. B. Jenson, S. Koenig, and J. A. Suzich. 1999. Characterization of a major neutralizing epitope on human papillomavirus type 16 L1. J. Virol. 73:4882-4889.[Abstract/Free Full Text]
52 - Yon, J., and M. Fried. 1989. Precise gene fusion by PCR. Nucleic Acids Res. 17:4895.[Free Full Text]
53 - Yuan, H., P. A. Estes, Y. Chen, J. Newsome, V. A. Olcese, R. L. Garcea, and R. Schlegel. 2001. Immunization with a pentameric L1 fusion protein protects against papillomavirus infection. J. Virol. 75:7848-7853.[Abstract/Free Full Text]
54 - Zhou, J., X. Y. Sun, K. Louis, and I. H. Frazer. 1994. Interaction of human papillomavirus (HPV) type 16 capsid proteins with HPV DNA requires an intact L2 N-terminal sequence. J. Virol. 68:619-625.[Abstract/Free Full Text]
55 - Zhou, J., X. Y. Sun, D. J. Stenzel, and I. H. Frazer. 1991. Expression of vaccinia recombinant HPV 16 L1 and L2 ORF proteins in epithelial cells is sufficient for assembly of HPV virion-like particles. Virology 185:251-257.[CrossRef][Medline]
Journal of Virology, April 2003, p. 4818-4826, Vol. 77, No. 8
0022-538X/03/$08.00+0 DOI: 10.1128/JVI.77.8.4818-4826.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Conway, M.J., Meyers, C.
(2009). Replication and Assembly of Human Papillomaviruses. JDR
88: 307-317
[Abstract]
[Full Text]
-
Buck, C. B., Cheng, N., Thompson, C. D., Lowy, D. R., Steven, A. C., Schiller, J. T., Trus, B. L.
(2008). Arrangement of L2 within the Papillomavirus Capsid. J. Virol.
82: 5190-5197
[Abstract]
[Full Text]
-
Kawano, M.-a., Inoue, T., Tsukamoto, H., Takaya, T., Enomoto, T., Takahashi, R.-u, Yokoyama, N., Yamamoto, N., Nakanishi, A., Imai, T., Wada, T., Kataoka, K., Handa, H.
(2006). The VP2/VP3 Minor Capsid Protein of Simian Virus 40 Promotes the in Vitro Assembly of the Major Capsid Protein VP1 into Particles. J. Biol. Chem.
281: 10164-10173
[Abstract]
[Full Text]
-
Florin, L., Becker, K. A., Sapp, C., Lambert, C., Sirma, H., Muller, M., Streeck, R. E., Sapp, M.
(2004). Nuclear Translocation of Papillomavirus Minor Capsid Protein L2 Requires Hsc70. J. Virol.
78: 5546-5553
[Abstract]
[Full Text]
-
Becker, K. A., Florin, L., Sapp, C., Maul, G. G., Sapp, M.
(2004). Nuclear Localization but Not PML Protein Is Required for Incorporation of the Papillomavirus Minor Capsid Protein L2 into Virus-Like Particles. J. Virol.
78: 1121-1128
[Abstract]
[Full Text]
-
Chromy, L. R., Pipas, J. M., Garcea, R. L.
(2003). Chaperone-mediated in vitro assembly of Polyomavirus capsids. Proc. Natl. Acad. Sci. USA
100: 10477-10482
[Abstract]
[Full Text]