Previous Article | Next Article 
Journal of Virology, February 2003, p. 2631-2639, Vol. 77, No. 4
0022-538X/03/$08.00+0 DOI: 10.1128/JVI.77.4.2631-2639.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Kaposi's Sarcoma-Like Tumors in a Human Herpesvirus 8 ORF74 Transgenic Mouse
Hong-Guang Guo,1 Mariola Sadowska,1 William Reid,1 Erwin Tschachler,2 Gary Hayward,3 and Marvin Reitz1*
Institute of Human Virology, University of Maryland Biotechnology Institute, Baltimore, Maryland 21201,1
Viral Oncology Program, Department of Oncology, Johns Hopkins School of Medicine, Baltimore, Maryland 21231; and Department of Dermatology, University of Vienna Medical School,3
Ludwig Boltzmann Institute for Studies of Venero-Dermatological Infectious Diseases, Vienna A1090, Austria2
Received 1 July 2002/
Accepted 18 November 2002

ABSTRACT
The product of human herpesvirus 8 (HHV-8) open reading frame
74 (ORF74) is related structurally and functionally to cellular
chemokine receptors. ORF74 activates several cellular signaling
pathways in the absence of added ligands, and NIH 3T3 cells
expressing ORF74 are tumorigenic in nude mice. We have generated
a line of transgenic (Tg) mice with ORF74 driven by the simian
virus 40 early promoter. A minority (approximately 30%) of the
Tg mice, including the founder, developed tumors resembling
Kaposi's sarcoma (KS) lesions, which occurred most typically
on the tail or legs. The tumors were highly vascularized, had
a spindle cell component, expressed VEGF-C mRNA, and contained
a majority of CD31
+ cells. CD31 and VEGF-C are typically expressed
in KS. Tumors generally (but not always) occurred at single
sites and most were relatively indolent, although several mice
developed large visceral tumors. ORF74 was expressed in a minority
of cells in the Tg tumors and in a few other tissues of mice
with tumors; mice without tumors did not express detectable
ORF74 in any tissues tested. Cell lines established from tumors
expressed ORF74 in a majority of cells, expressed VEGF-C mRNA,
and were tumorigenic in nude mice. The resultant tumors grew
rapidly, metastasized, and continued to express ORF74. Cell
lines established from these secondary tumors also expressed
ORF74 and were tumorigenic. These data strongly suggest that
ORF74 plays a role in the pathology of KS and confirm and extend
previous findings on the tumorigenic potential of ORF74.

INTRODUCTION
Human herpesvirus 8 (HHV-8), also known as Kaposi's sarcoma
(KS) herpesvirus, is the most recently identified human herpesvirus
(
7). Extensive epidemiological evidence points to a necessary
role for HHV-8 in the etiology of KS (
7,
14,
22,
26,
33,
34,
44,
51). KS is an angioproliferative disease, and KS lesions
are rather complex; they contain spindle cells, which are thought
to be of endothelial origin (
23,
24), and infiltrating inflammatory
cells surrounding vascular spaces. HHV-8 is found in most of
the spindle cells in mature KS lesions (
12,
49), and infection
with HHV-8 precedes and predicts the onset of KS (
14,
26,
34,
42,
51). HHV-8 is also implicated in the etiology of several
lymphoproliferative diseases, including primary effusion lymphomas
and multicentric Castleman's disease (
6,
37).
Although infection with HHV-8 is clearly necessary for development of KS, the mechanisms of HHV-8 pathogenesis are not well understood. HHV-8 appears to be a very inefficient pathogen; many more people are infected than develop KS (1, 2, 15, 29). In early-stage KS lesions, only a small fraction of the cells are infected (5, 12), and in late stages only a small minority of the spindle cells undergo lytic phase viral gene expression, even though most are infected (8, 10, 12, 48, 49). Infiltrating lymphocytes and monocytes can also be infected (5). Several lines of evidence suggest that HHV-8 pathogenesis in KS is mediated indirectly by paracrine factors produced by cells that undergo lytic phase viral replication but that act on uninfected or latently infected cells. Treatment with drugs that target lytic replication has been reported to result in regression of KS (19, 27, 30), although this has not been a universal finding. Cultured primary endothelial cells can be transformed and converted into spindle cells by infection with HHV-8 (9, 13, 35). Following transformation of dermal microvascular endothelial cells, all cells express the latency nuclear antigen LANA1 and a small minority of the cells spontaneously enters the lytic cycle (9). Interestingly, after transformation of bone marrow endothelial cells, only a small minority of the cells is infected at any given time (13), suggesting a paracrine mechanism of transformation.
If HHV-8 paracrine factors indeed play a role in KS pathogenesis, two groups of viral gene products may be involved. HHV-8 encodes several gene products related to secreted cellular proteins, including a homologue of interleukin-6 and three homologues of the ß-chemokine macrophage inflammatory protein 1 (32, 38), which could act on uninfected or latently infected cells. The virus also encodes gene products with homology to cellular signal transduction proteins; these might induce expression of a variety of cytokines and related molecules. One of the latter gene products is related to the cellular chemokine receptor CXCR2 and is encoded by open reading frame 74 (ORF74) (3, 20). Indeed, ORF74 has been shown to spontaneously activate several intracellular signaling pathways, including phospholipase C-PI 3-kinase-AP1 and PI 3-kinase-Akt-NF
B (3, 4, 31, 36, 39, 46), to induce the synthesis of proinflammatory cytokines and chemokines (4, 39, 47) and to elicit chemotaxis of monocytes and lymphocytes (39). ORF74-transfected NIH 3T3 cells form fibrosarcomas when injected into nude mice (4). Transgenic (Tg) mice with an ORF74 transgene regulated by the human CD2 promoter develop tumors closely resembling KS lesions (52). Interestingly, ORF74 expression in these Tg mice is restricted to T cells and NK cells and occurs in only a minority of cells in the tumors, indicating that tumorigenesis is likely caused by paracrine mechanisms. We describe a line of Tg mice in which ORF74 is expressed from the simian virus 40 (SV40) early promoter-enhancer and characterize the tumors observed in these mice, confirming and extending the results of Yang et al. (52). We also describe a tumorigenic cell line derived from one of the tumors.

MATERIALS AND METHODS
Mice.
The ORF74 coding region was amplified by PCR from an

14-kbp
fragment of the HHV-8 genome contained in

EMBL3 (
20) by using
primers ORF74s1 (5'-cgcat
gaattccttgttattgtagc
atggcgg-3') and
ORF74a1 (5'-cgatg
agatctgggctacgtggtggcg-3'). The primers introduced
cleavage sites for
EcoRI and
BglII (underlined) at the 5' and
3' ends, respectively, of the coding region. The initiator codon
for ORF74 is shown in bold letters. The PCR fragment was digested
with
EcoRI and
BglII and cloned into the cognate sites of the
expression vector pSG5 (Stratagene, La Jolla, Calif.), which
contains an SV40 early promoter-enhancer and poly(A) signal
and the second intron of rabbit ß-globin. After amplification
in
Escherichia coli, the majority of bacterial plasmid sequences
were removed by digestion with
XbaI and
NdeI and the 2.9-kbp
insert containing ORF74 was gel purified and microinjected into
fertilized one-cell C57BL/6J eggs as described by Lacy et al.
(
25). The experimental protocol was approved by the University
of Maryland Biotechnology Institute Institutional Animal Care
and Use Committee. Several weeks after pups were born, DNA was
purified from 1- to 1.5-cm tail snips by overnight digestion
at 55°C with proteinase K-sodium dodecyl sulfate, followed
by phenol and phenol-chloroform extraction and ethanol precipitation.
The presence of the transgene was investigated by PCR amplification
using primers ORF74s1 and ORF74a1 and verified by Southern blotting
using the full-length insert labeled with
32P by nick translation.
Mouse ß-globin primers SF144 (5'-ccaatctgctcacacaggatagagagggcagg-3')
and SF145 (5'-ccttgaggctgtccaagtgattcaggccatcg-3') were used
in PCRs to verify DNA integrity. Two males testing positive
for transgenicity were obtained out of one litter and bred with
normal C57BL/6J females to obtain F
1 transgenic mice.
Athymic nude mice or non-Tg control littermates were used for tumor transplantation studies. Cells (generally 5 x 106) were injected intradermally into the side. In some experiments, naked DNA (10 µg) was injected intramuscularly in 0.2 ml of sterile phosphate-buffered saline (PBS) in a 25-gauge needle.
Expression of the transgene.
RNA was purified from mice with RNAzol (Tel-Test, Friendswood, Tex.). Solid tissue was snap frozen in liquid N2 and ground in a mortar and pestle prior to RNA extraction. Transgene RNA expression was assayed by reverse transcription-PCR (RT-PCR) with primers 334 (5'-aagctggatcgatcctgagaact-3') and 332 (5'-gtgcagcggatgtcagtacc-3'), which span a ß-globin intron in the pSG5 vector. Consequently, they generate a PCR product of 628 bp from RNA, compared with a 1.2-kbp product from DNA. The size of the products on gels thus indicates whether amplification is from DNA or RNA. RNA was reverse transcribed into cDNA with Superscript II RNase H- reverse transcriptase (Invitrogen, Carlsbad, Calif.) by using the antisense primer. PCR (35 cycles) was performed with Bio-X-Act DNA polymerase (Bioline, Canton, Mass.). The amplified products were directly visualized by staining with ethidium bromide, and their identities were verified by Southern blotting, using a 32P-labeled insert from ORF74/pSG5 as a hybridization probe. Mouse primers to detect VEGF-C were 5'-tgaacaccagcacaggttac-3' (sense) and 5'-tcttgttagctgcctgacac-3' (antisense), which yield an RT-PCR product of 204 bp. Mouse primers to detect VEGF-A were 5'-ccaagatccgcagacgtgta-3' (sense) and 5'-gatgatggcatggtggtgac-3' (antisense), which yield an RT-PCR product of 205 bp. Both sets of VEGF primers were designed to cross introns so that DNA would not be amplified. Universal 18S rRNA primers (Ambion, Austin, Tex.) were used to verify the quality of the RNA samples. Where indicated, positive results were verified by Northern blotting. Real-time RT-PCR was used to compare expression levels of VEGF-A and VEGF-C mRNA. The cDNA was generated with Superscript II RNase H- reverse transcriptase (Invitrogen) by using random hexamers (Applied Biosystems, Foster City, Calif.). VEGF-A, VEGF-C, and 18S cDNA (as a reference) were amplified, and the product was detected with a QuantiTect SYBR Green PCR kit (QIAGEN GmbH, Hilden, Germany) in a GenAmp 5700 sequence detection system (Applied Biosystems). The relative amounts of VEGF-A and VEGF-C mRNA were calculated by methods described in the manual for the SYBR Green PCR kit (Applied Biosystems).
Immunocytochemistry.
For detection of ORF74 protein, 10% formalin-fixed paraffin-embedded tissues were deparaffinized in xylene, incubated in citrate buffer (10 mM, pH 6.0) for antigen retrieval by microwaving, preblocked with 10% normal goat serum-1% bovine serum albumin (BSA)-0.05% Tween 20 in PBS for 30 min, and probed with a 1:1,000 dilution of rabbit antipeptide polyclonal antiserum against a KS herpesvirus ORF74 epitope between amino acids 4 and 16 [(Y)EDFLTIFLDDDES(SC)] (8). Detection was with a biotinylated goat anti-rabbit immunoglobulin (Ig) antibody followed by a streptavidin-biotin complex and peroxidase system with diaminobenzidine chromagen development and a hematoxylin counterstain, as previously described (8). ORF74 expression was detected, using the same antibody, with adherent cells grown directly on microwell slides and suspension cells grown on polylysine-coated microscope slides and fixed in absolute methanol (8). CD31 surface antigen expression was analyzed by staining 4-µm slices from snap-frozen tumor sections (50). Sections were subjected to reactions with a mouse monoclonal antibody to CD31 (clone JC 70A; Dako, Glostrup, Denmark) or an irrelevant antibody as an isotype control, labeled with Texas red-conjugated goat anti-mouse IgG, and examined in an Axiophot microscope.
Cell lines.
Cell lines were developed from tumors or from tail tissue from a normal mouse by explanting unminced pieces of skin or tumor tissue into PBS under sterile conditions. After three washes in PBS, the tissue was transferred to a 25-cm2 tissue culture flask and maintained for 30 days in Dulbecco's modified Eagle's medium with 10% heat-inactivated fetal bovine serum and 10 U of penicillin-streptomycin/ml at 37°C in 5% CO2. The medium was changed every 3 days. Cells migrating from the tissue and adhering to the plastic were collected by trypsinization (0.025% trypsin, 0.1 mM EDTA) and centrifugation. After two washes with PBS, the cells were suspended in medium at 5 cells/ml and 200-µl aliquots were transferred into U-bottomed microtiter plates. Wells with single cells were selected and cultured for 8 to 10 days, at which point the cells (now numbering
30/well) were cultured in 25-cm2 tissue culture flasks.

RESULTS
Identification and characterization of ORF74 Tg mice.
Following microinjection of purified insert DNA into eggs and
implantation into pseudopregnant females, seven pups were born
from a single mother. Of the seven, two males (animals 383 and
379) tested positive for the presence of the transgene, as determined
by PCR amplification of tail snip DNA. This was confirmed by
Southern blotting (Fig.
1) after digestion with
EcoRI, which
cuts within the transgene once. The presence of a fragment of
the same apparent size (2.9 kbp) as the insert DNA suggests
that the integrated transgene consisted of several tandem copies.
The larger fragment (5.1 kbp) likely includes the junction of
the transgene with the host genome. By 7 months of age, mouse
383 developed tumors on the tail and on the foot (Fig.
2A and
B). Animal 379 did not develop detectable tumors and died of
apparently unrelated causes at the age of 19 months.
Both mice were bred with normal females to produce F
1 transgenic
animals. Out of a total of 58 offspring from animal 383, 20
tested positive by PCR and Southern blotting or by PCR alone.
Five of the transgene-positive animals developed tumors like
those of the founder on their tails or feet, generally at more
than 1 year of age (although one occurred at 5 months). Two
of these animals also had internal tumors in the abdominal cavity.
One animal without any external tumors also developed a similar
internal tumor at more than a year of age. One of the animals
(animal 116) with a tail tumor was mated to produce an F
2 generation.
Of 15 pups, 5 tested positive for the presence of the transgene.
One developed two tumors on the tail and a large tumor behind
the ear at 7 months of age. Another developed a tumor on the
foot and an internal abdominal tumor at 1 year of age. This
animal (mouse 2840) was mated and produced three Tg pups out
of a total of nine. One of these developed an internal tumor
at the age of 6 months; the other two remained free of tumors
at 9 months. Of 18 offspring from animal 379, 7 tested positive
for the presence of the transgene. None developed the characteristic
tail and foot tumors seen with animals from the 383 line. These
data are summarized in Table
1.
The violaceous nodular tumors on the tail (Fig.
2A) and foot
(Fig.
2B) were firm and about 0.5 to 1 cm in diameter and were
reminiscent of KS in humans. The black spot on the tumor surface
in Fig.
2A corresponds to a hemorrhagic crust over an ulceration.
Histological examination revealed that cells within the tumors
were arranged in a cord-like pattern and were partly spindle
shaped (Fig.
2D). The vast majority of these cells tested positive
by immunofluorescent staining for the presence of CD31 (Fig.
2E), an endothelial cell marker that is expressed on spindle
cells in human KS lesions (
45,
50).
Expression of ORF74 in Tg tumors.
RNA was purified from tumors and other tissues from Tg mice and RT-PCR was used to detect expression of transcripts from the ORF74 transgene, using the primers described in Materials and Methods. These primers bind on opposite sides of the ß-globin intron of the transgene, as illustrated by the arrowheads in Fig. 1B; consequently, DNA is amplified as a 1.2-kbp fragment that can be discriminated from the 628-bp fragment generated from RNA. As shown in Fig. 3A, lane 1, a 628-bp fragment was readily detected in tumor tissue from mouse 470 as well as in tumors from five of five other mice (data not shown). No 1.2-kbp fragment was evident, indicating that the DNA corresponding to that fragment size was not present. When the RT step was omitted, there were no detectable products (data not shown), further establishing that the detected signals were from RNA. ORF74 RNA was also detected in apparently normal tissue (leg) of mouse 470 (Fig. 3A, lane 2) but was undetectable in three other tissue samples (Fig. 3A, lanes 3 to 5). In another Tg mouse with tumors (animal 2840), ORF74 RNA was detected in three of three apparently normal tissue samples (data not shown). In contrast, ORF74 transcripts were not detectable in four of four tissue samples from a Tg mouse with no tumors (animal 2830) (Fig. 3A, lanes 6 to 9) or in leg muscle tissue from three other Tg mice without tumors (data not shown). The lower bands in Fig. 3A are from RT-PCRs with 18S RNA primers that were preloaded onto the gel as a control for RNA integrity.
Expression of ORF74 protein was clearly evident in a minority
of the cells in tumors. Figure
4 shows relatively high levels
of expression in a few cells in an external tumor from behind
the ear, as detected by immunostaining. Other cells expressed
lower levels of ORF74, while many cells tested negative. As
can be seen, the tumor contained areas composed of spindle cells
mixed with areas that did not contain spindle cells. Figure
4A shows expression of ORF74 protein in cells both within the
spindle cell areas and outside them. Figure
4B, taken at a higher
magnification, shows expression of ORF74 in the cytoplasm of
spindle cells. Figure
4C, taken at the same magnification, shows
expression in the cytoplasm of nonspindle cells.
VEGF-C mRNA was expressed in tumor tissues (Fig.
3B, lanes 1
and 2) and in apparently normal tissues expressing ORF74 from
a Tg mouse with a tumor (Fig.
3B, lane 3), which is consistent
with an earlier report that HHV-8 infection of endothelial cells
induces VEGF-C protein expression (
28) and modestly upregulates
VEGF-C mRNA expression in endothelial cells (
40). VEGF-C RNA
was not detected in other tissues not expressing ORF74 from
the same Tg mouse (Fig.
3B, lane 5), tissue from a Tg mouse
with no tumors (Fig.
3B, lane 4), or tissue from a normal mouse
(Fig.
3B, lane 6). Transfection of mouse fibroblasts with ORF74
did not induce expression of VEGF-C mRNA (data not shown), indicating
that expression of VEGF-C may be secondary to tumorigenesis
in the mouse rather than directly induced by ORF74. VEGF-A protein
expression is also induced by infection with HHV-8 (
28). VEGF-A
mRNA was detected in samples of tissues expressing ORF74 but
was also detectable in other samples not expressing ORF74 (data
not shown). RNA quality was verified for all tested samples
by amplification with 18S RNA primers.
Establishment of tumorigenic cell lines from Tg mice.
Clonal cell lines were developed from a tumor from ORF74 Tg mouse 116 (GR1 cell line) and from tail tissue of a normal (non-Tg) mouse (GR5) (Table 2) as described in Materials and Methods. The tumorigenic potential of the Tg tumor-derived cell line, GR1, was evaluated by injecting 5 x 106 cells into 10 nude mice, all of which rapidly developed tumors. As shown in Fig. 2C, aggressive tumors appeared within 3 weeks of inoculation. The tumors showed extensive ulceration with a darkened appearance. The tumors in nude mice tended to metastasize to other sites and rapidly killed the animals. As with the primary tumors in the Tg mice, ORF74 and VEGF-C mRNA were expressed at the primary site of inoculation as well as in a few other tissues (data not shown). GR1 cells were also moderately tumorigenic in immunocompetent mice; one of four non-Tg normal littermates developed a rapidly growing tumor within 2 weeks after similar injections. No tumors were obtained by similar inoculation of the control cell line, GR5, into 10 nude mice. However, GR5 cells transfected with ORF/pSG5 caused tumors within 10 days. A cell line derived from this tumor, GR6, was also tumorigenic in nude mice (Table 2).
Cell lines were derived from the tumors originating from transplanted
GR1 cells. These were serially passaged as tumors through nude
mice 2362, 2363, and 2364, from which cells lines GR2, GR3,
and GR4, respectively, were derived (Table
2). All four cell
lines retained tumorigenicity in nude mice. Southern blots of
EcoRI digests of DNA from cell lines GR1, GR3, and GR4 showed
the same pattern of hybridization to an ORF74 probe as did a
digest of DNA from the founder mouse (Fig.
1; compare lane a
with lanes d, e, and f), indicating that the transgene remained
grossly intact. These data are summarized in Table
2. A PCR
product from the transgene from one of the cell lines was sequenced
and found to be identical to the original insert used for the
transgene.
ORF74 mRNA was expressed in the GR1 cell line, as shown by RT-PCR (Fig. 3A, lanes 10 and 11) and Northern blotting (not shown). ORF74 protein was detected by immunostaining in the majority of cells in the cell lines (Fig. 5C) but not in normal controls (Fig. 5B). Uninduced BCBL-1 cells are shown for comparison (Fig. 5A); a few BCBL-1 cells, presumably undergoing spontaneous lytic phase viral replication, gave highly positive results, while the majority of cells gave slightly positive or negative results. Tumor cell lines GR1 and GR3 but not the normal GR5 cell line tested positive for VEGF-C mRNA by RT-PCR (Fig. 3B, lanes 7 to 9). VEGF-C mRNA levels in GR3 cells were almost 10-fold higher than in GR5 cells, as judged by real time RT-PCR, whereas VEGF-A mRNA levels were approximately the same (Fig. 5D).

DISCUSSION
We have constructed a Tg mouse in which ORF74, a chemokine receptor
homologue encoded by HHV-8, is expressed from an SV40 early
promoter. One of two founder animals developed tumors on the
tail and foot. A minority of second- and third-generation animals
developed similar tumors, generally (but not always) at more
than 1 year of age. In some cases, internal tumors associated
with viscera also occurred in the abdominal cavity. Similar
tumors have been reported in Tg mice in which ORF74 expression
is regulated by a T-cell-specific promoter (
52). The tumors
were highly angiogenic and tested positive for the presence
of CD31, an endothelial cell-specific marker typically present
on spindle cells in KS lesions in humans (
45,
50). Tumors also
tested positive for the presence of VEGF-C, which is expressed
in KS lesions (
45), although the expression was likely characteristic
of the tumor type rather than directly induced by ORF74.
The pattern of transgene expression is interesting. We did not detect ORF74 mRNA in tissues from transgenic animals without tumors. We infer that the SV40 promoter is generally silenced in these animals. This would be expected if expression of the transgene in utero were lethal. A protein such as ORF74, capable of constitutively activating multiple signaling pathways, would be likely to interfere with embryogenesis, and transgenic embryos would reach term only if expression were repressed. In the case of transgenic animals with tumors, ORF74 transcripts were readily detected in the tumors and in some tissues without tumors. However, they were not detectable in other tissues even by relatively sensitive RT-PCR. How ORF74 expression becomes activated is not clear, but infrequent stochastic events may lead to activation of the promoter. Cells that express ORF74 and survive may become tumorigenic following further events or may be able to cause tumors directly. Alternatively, tumorigenesis may follow the generation of a critical mass of cells expressing ORF74. Expression of ORF74 RNA in apparently normal tissue may represent activation of expression in normal cells that in time would result in tumor formation or it may represent cells that are metastatic from the primary tumor but have not yet formed tumors. There appears to be some advantage for the generation of tumors on the extremities (tail, leg), although such an advantage appears not to be absolute.
Only a small minority of cells expresses ORF74 in the KS-like tumors in Tg mice reported by Yang et al. (52). Expression in these Tg mice was limited to T cells, suggesting that T cells were driving tumorigenesis by paracrine mechanisms affecting endothelial cells not expressing the transgene. We also find that ORF74 is highly expressed in a small minority of tumor cells, as evidenced by immunohistochemistry. Our interpretation regarding transgene expression in our mice is that random activation and persistent expression led to the proliferation of some of these cells and subsequently to formation of tumors, either by further proliferation of the cells expressing ORF74 or by a paracrine effect on other cells. The scattered pattern of expression of ORF74 in the tumor suggests that the latter interpretation is more likely to be correct.
Clonal cell lines from these tumors were highly tumorigenic in nude mice and to a lesser degree in normal mice. ORF74 was expressed in the majority of cells in these clonal lines, suggesting that some of the tumor cells expressing ORF74 maintain stable expression. The transplant tumors could be serially transplanted without loss of malignancy and often metastasized to distant sites, suggesting that they evolved to a more malignant phenotype than the primary tumors. This may be comparable to the course of KS in humans, in which KS lesions begin as sites of inflammatory hyperproliferation but in some cases appear to progress to clonal malignancies (11, 18, 41).
What is the mechanism of tumorigenesis caused by ORF74? Bais et al. and others have shown that ORF74 induces the expression of proinflammatory cytokines and chemokines (4, 39, 47) and cell adhesion molecules (39) secondary to its activation of transcriptional factor signaling pathways such as NF
B. Furthermore, supernatants from endothelial cells expressing ORF74 activate NF
B in endothelial cells not expressing ORF74 (39), suggesting that its effects may be amplified in vivo by paracrine mechanisms. A recent study by Holst et al. (21) showed that transgenic mice expressing ORF74 mutants that fail to signal constitutively do not develop KS-like lesions. ORF74 signaling is modulated by several chemokines (16, 17, 43), most notably Gro
(an agonist) and IP-10 (an inverse agonist). Interestingly, mice that are transgenic for ORF74 mutants that can signal constitutively but are refractory to regulation by exogenous chemokines also generally fail to develop KS-like lesions (21). This suggests that cellular factors, whose expression may be dysregulated by ORF74, play an important role in KS pathogenesis.

ACKNOWLEDGMENTS
This work was supported by NCI grants P01 CA78817 from the National
Cancer Institute to M.R. and PO1 CA81400 from the National Cancer
Institute to G.H.
We gratefully acknowledge the editorial assistance of Paula Dean. We thank Qizhi Zheng for performing the immunohistochemistry experiments.

FOOTNOTES
* Corresponding author. Mailing address: Institute for Human Virology, University of Maryland Biotechnology Institute, 725 W. Lombard St., Baltimore, MD 21201. Phone: (410) 706-4679. Fax: (410) 706-4694. E-mail:
reitz{at}umbi.umd.edu.


REFERENCES
1 - Ablashi, D., L. Chatlynne, H. Cooper, D. Thomas, M. Yadav, A. W. Norhanom, A. K. Chandana, V. Churdboonchart, S. A. R. Kulpradist, M. Patnaik, K. Liegmann, R. Masood, M. Reitz, F. Cleghorn, A. Manns, P. H. Levine, C. Rabkin, R. Biggar, F. Jensen, P. Gill, N. Jack, J. Edwards, J. Whitman, and C. Boshoff. 1999. Seroprevalence of human herpesvirus-8 (HHV-8) in countries of Southeast Asia compared to the USA, the Caribbean and Africa. Br. J. Cancer 81:893-897.[CrossRef][Medline]
2 - Ariyoshi, K., M. S. van der Loeff, P. Cook, D. Whitby, T. Corrah, S. Jaffar, F. Cham, S. Sabally, D. O'Donovan, R. A. Weiss, T. F. Schulz, and H. Whittle. 1998. Kaposi's sarcoma in the Gambia, West Africa is less frequent in human immunodeficiency virus type 2 than in human immunodeficiency virus type 1 infection despite a high prevalence of human herpesvirus 8. J. Hum. Virol. 1:193-199.[Medline]
3 - Arvanitakis, L., E. Geras-Raaka, A. Varma, M. C. Gershengorn, and E. Cesarman. 1997. Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation. Nature 385:347-350.[CrossRef][Medline]
4 - Bais, C., B. Santomasso, O. Coso, L. Arvanitakis, E. G. Raaka, J. S. Gutkind, A. S. Asch, E. Cesarman, M. C. Gershengorn, and E. A. Mesri. 1998. G-protein-coupled receptor of Kaposi's sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator. Nature 391:86-89.[CrossRef][Medline]
5 - Blasig, C., C. Zietz, B. Haar, F. Neipel, S. Esser, N. H. Brockmeyer, E. Tschachler, S. Colombini, B. Ensoli, and M. Sturzl. 1997. Monocytes in Kaposi's sarcoma lesions are productively infected by human herpesvirus 8. J. Virol. 71:7963-7968.[Abstract]
6 - Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N. Engl. J. Med. 332:1186-1191.[Abstract/Free Full Text]
7 - Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1869.[Abstract/Free Full Text]
8 - Chiou, C. J., L. J. Poole, P. S. Kim, D. M. Ciufo, J. S. Cannon, C. M. ap Rhys, D. J. Alcendor, J. C. Zong, R. F. Ambinder, and G. S. Hayward. 2002. Patterns of gene expression and a transactivation function exhibited by the vGCR (ORF74) chemokine receptor protein of Kaposi's sarcoma-associated herpesvirus. J. Virol. 76:3421-3439.[Abstract/Free Full Text]
9 - Ciufo, D. M., J. S. Cannon, L. J. Poole, F. Y. Wu, P. Murray, R. F. Ambinder, and G. S. Hayward. 2001. Spindle cell conversion by Kaposi's sarcoma-associated herpesvirus: formation of colonies and plaques with mixed lytic and latent gene expression in infected primary dermal microvascular endothelial cell cultures. J. Virol. 75:5614-5626.[Abstract/Free Full Text]
10 - Davis, M. A., M. Sturzl, C. Blasig, A. Schreier, H. G. Guo, M. S. Reitz, S. R. Opalenik, and P. J. Browning. 1997. Expression of human herpesvirus 8-encoded cyclin D in Kaposi's sarcoma spindle cells. J. Natl. Cancer Inst. 89:1868-1874.[Abstract/Free Full Text]
11 - Delabesse, E., E. Oksenhendler, C. Lebbe, O. Verola, B. Varet, and A. G. Turhan. 1997. Molecular analysis of clonality in Kaposi's sarcoma. J. Clin. Pathol. 50:664-668.[Abstract/Free Full Text]
12 - Dupin, N., C. Fisher, P. Kellam, S. Ariad, M. Tulliez, N. Franck, E. van Marck, D. Salmon, I. Gorin, J. P. Escande, R. A. Weiss, K. Alitalo, and C. Boshoff. 1999. Distribution of human herpesvirus-8 latently infected cells in Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma. Proc. Natl. Acad. Sci. USA 96:4546-4551.[Abstract/Free Full Text]
13 - Flore, O., S. Rafii, S. Ely, J. J. O'Leary, E. M. Hyjek, and E. Cesarman. 1998. Transformation of primary human endothelial cells by Kaposi's sarcoma-associated herpesvirus. Nature 394:588-592.[CrossRef][Medline]
14 - Gao, S. J., L. Kingsley, D. R. Hoover, T. J. Spira, C. R. Rinaldo, A. Saah, J. Phair, R. Detels, P. Parry, Y. Chang, and P. S. Moore. 1996. Seroconversion to antibodies against Kaposi's sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposi's sarcoma. N. Engl. J. Med. 335:233-241.[Abstract/Free Full Text]
15 - Gao, S. J., L. Kingsley, M. Li, W. Zheng, C. Parravicini, J. Ziegler, R. Newton, C. R. Rinaldo, A. Saah, J. Phair, R. Detels, Y. Chang, and P. S. Moore. 1996. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat. Med. 2:925-928.[CrossRef][Medline]
16 - Geras-Raaka, E., A. Varma, H. Ho, I. Clark-Lewis, and M. C. Gershengorn. 1998. Human interferon-gamma-inducible protein 10 (IP-10) inhibits constitutive signaling of Kaposi's sarcoma-associated herpesvirus G protein-coupled receptor. J. Exp. Med. 188:405-408.[Abstract/Free Full Text]
17 - Gershengorn, M. C., E. Geras-Raaka, A. Varma, and I. Clark-Lewis. 1998. Chemokines activate Kaposi's sarcoma-associated herpesvirus G protein-coupled receptor in mammalian cells in culture. J. Clin. Investig. 102:1469-1472.[Medline]
18 - Gill, P. S., Y. C. Tsai, A. P. Rao, C. H. Spruck III, T. Zheng, W. A. Harrington, Jr., T. Cheung, B. Nathwani, and P. A. Jones. 1998. Evidence for multiclonality in multicentric Kaposi's sarcoma. Proc. Natl. Acad. Sci. USA 95:8257-8261.[Abstract/Free Full Text]
19 - Glesby, M. J., D. R. Hoover, S. Weng, N. M. Graham, J. P. Phair, R. Detels, M. Ho, and A. J. Saah. 1996. Use of antiherpes drugs and the risk of Kaposi's sarcoma: data from the Multicenter AIDS Cohort Study. J. Infect. Dis. 173:1477-1480.[Medline]
20 - Guo, H.-G., P. Browning, J. Nicholas, G. S. Hayward, E. Tschachler, Y. W. Jiang, M. Sadowska, M. Raffeld, S. Colombini, R. C. Gallo, and M. S. Reitz. 1997. Characterization of a chemokine receptor-related gene in human herpesvirus 8 and its expression in Kaposi's sarcoma. Virology 228:371-378.[CrossRef][Medline]
21 - Holst, P. J., M. M. Rosenkilde, D. Manfra, S. C. Chen, M. T. Wiekowski, B. Holst, F. Cifire, M. Lipp, T. W. Schwartz, and S. A. Lira. 2001. Tumorigenesis induced by the HHV8-encoded chemokine receptor requires ligand modulation of high constitutive activity. J. Clin. Investig. 108:1789-1796.[CrossRef][Medline]
22 - Huang, Y. Q., J. J. Li, M. H. Kaplan, B. Poiesz, E. Katabira, W. C. Zhang, D. Feiner, and A. E. Friedman-Kien. 1995. Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma. Lancet 345:759-761.[CrossRef][Medline]
23 - Kaaya, E. E., C. Parravicini, C. Ordonez, R. Gendelman, E. Berti, R. C. Gallo, and P. Biberfeld. 1995. Heterogeneity of spindle cells in Kaposi's sarcoma: comparison of cells in lesions and in culture. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 10:295-305.[Medline]
24 - Karasek, M. A. 1994. Origin of spindle-shaped cells in Kaposi sarcoma. Lymphology 27:41-44.[Medline]
25 - Lacy, E., F. Costantini, R. Beddington, and B. Hogan. 1994. Manipulating the mouse embryo. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
26 - Lefrere, J. J., M. C. Meyohas, M. Mariotti, J. L. Meynard, M. Thauvin, and J. Frottier. 1996. Detection of human herpesvirus 8 DNA sequences before the appearance of Kaposi's sarcoma in human immunodeficiency virus (HIV)-positive subjects with a known date of HIV seroconversion. J. Infect. Dis. 174:283-287.[Medline]
27 - Martin, D. F., B. D. Kuppermann, R. A. Wolitz, A. G. Palestine, H. Li, C. A. Robinson, et al. 1999. Oral ganciclovir for patients with cytomegalovirus retinitis treated with a ganciclovir implant. N. Engl. J. Med. 340:1063-1070.[Abstract/Free Full Text]
28 - Masood, R., E. Cesarman, D. L. Smith, P. S. Gill, and O. Flore. 2002. Human herpesvirus-8-transformed endothelial cells have functionally activated vascular endothelial growth factor/vascular endothelial growth factor receptor. Am. J. Pathol. 160:23-29.[Abstract/Free Full Text]
29 - Mayama, S., L. E. Cuevas, J. Sheldon, O. H. Omar, D. H. Smith, P. Okong, B. Silvel, C. A. Hart, and T. F. Schulz. 1998. Prevalence and transmission of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in Ugandan children and adolescents. Int. J. Cancer 77:817-820.[CrossRef][Medline]
30 - Mocroft, A., M. Youle, B. Gazzard, J. Morcinek, R. Halai, A. N. Phillips, et al. 1996. Anti-herpesvirus treatment and risk of Kaposi's sarcoma in HIV infection. AIDS 10:1101-1105.[Medline]
31 - Montaner, S., A. Sodhi, S. Pece, E. A. Mesri, and J. S. Gutkind. 2001. The Kaposi's sarcoma-associated herpesvirus G protein-coupled receptor promotes endothelial cell survival through the activation of Akt/protein kinase B. Cancer Res. 61:2641-2648.[Abstract/Free Full Text]
32 - Moore, P. S., C. Boshoff, R. A. Weiss, and Y. Chang. 1996. Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV. Science 274:1739-1744.[Abstract/Free Full Text]
33 - Moore, P. S., and Y. Chang. 1995. Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection. N. Engl. J. Med. 332:1181-1185.[Abstract/Free Full Text]
34 - Moore, P. S., L. A. Kingsley, S. D. Holmberg, T. J. Spira, P. Gupta, D. R. Hoover, J. P. Parry, L. J. Conley, H. W. Jaffe, and Y. Chang. 1996. Kaposi's sarcoma-associated herpesvirus infection prior to onset of Kaposi's sarcoma. AIDS 10:175-180.[Medline]
35 - Moses, A. V., K. N. Fish, R. Ruhl, P. P. Smith, J. G. Strussenberg, L. Zhu, B. Chandran, and J. A. Nelson. 1999. Long-term infection and transformation of dermal microvascular endothelial cells by human herpesvirus 8. J. Virol. 73:6892-6902.[Abstract/Free Full Text]
36 - Munshi, N., R. K. Ganju, S. Avraham, E. A. Mesri, and J. E. Groopman. 1999. Kaposi's sarcoma-associated herpesvirus-encoded G protein-coupled receptor activation of c-jun amino-terminal kinase/stress-activated protein kinase and lyn kinase is mediated by related adhesion focal tyrosine kinase/proline-rich tyrosine kinase 2. J. Biol. Chem. 274:31863-31867.[Abstract/Free Full Text]
37 - Nador, R. G., E. Cesarman, A. Chadburn, D. B. Dawson, M. Q. Ansari, J. Sald, and D. Knowles. 1996. Primary effusion lymphoma: a distinct clinicopathologic entity associated with the Kaposi's sarcoma-associated herpes virus. Blood 88:645-656.[Abstract/Free Full Text]
38 - Nicholas, J., V. Ruvolo, W. H. Burns, G. Sandford, X. Wan, D. Ciufo, S. B. Hendrickson, H.-G. Guo, G. S. Hayward, and M. S. Reitz. 1997. Kaposi's sarcoma-associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6. Nat. Med. 3:287-292.[CrossRef][Medline]
39 - Pati, S., M. Cavrois, H. G. Guo, J. S. Foulke, Jr., J. Kim, R. A. Feldman, and M. Reitz. 2001. Activation of NF-
B by the human herpesvirus 8 chemokine receptor ORF74: evidence for a paracrine model of Kaposi's sarcoma pathogenesis. J. Virol. 75:8660-8673.[Abstract/Free Full Text]
40 - Polson, A. G., D. Wang, J. DeRisi, and D. Ganem. 2002. Modulation of host gene expression by the constitutively active G protein-coupled receptor of kaposi's sarcoma-associated herpesvirus. Cancer Res. 62:4525-4530.[Abstract/Free Full Text]
41 - Rabkin, C. S., S. Janz, A. Lash, A. E. Coleman, E. Musaba, L. Liotta, R. J. Biggar, and Z. Zhuang. 1997. Monoclonal origin of multicentric Kaposi's sarcoma lesions. N. Engl. J. Med. 336:988-993.[Abstract/Free Full Text]
42 - Renwick, N., T. Halaby, G. J. Weverling, N. H. Dukers, G. R. Simpson, R. A. Coutinho, J. M. Lange, T. F. Schulz, and J. Goudsmit. 1998. Seroconversion for human herpesvirus 8 during HIV infection is highly predictive of Kaposi's sarcoma. AIDS 12:2481-2488.[CrossRef][Medline]
43 - Rosenkilde, M. M., T. N. Kledal, H. Brauner-Osborne, and T. W. Schwartz. 1999. Agonists and inverse agonists for the herpesvirus 8-encoded constitutively active seven-transmembrane oncogene product, ORF-74. J. Biol. Chem. 274:956-961.[Abstract/Free Full Text]
44 - Simpson, G. R., T. F. Schulz, D. Whitby, P. M. Cook, C. Boshoff, L. Rainbow, M. R. Howard, S. J. Gao, R. A. Bohenzky, P. Simmonds, C. Lee, A. de Ruiter, A. Hatzakis, R. S. Tedder, I. V. Weller, R. A. Weiss, and P. S. Moore. 1996. Prevalence of Kaposi's sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen. Lancet 348:1133-1138.[CrossRef][Medline]
45 - Skobe, M., L. F. Brown, K. Tognazzi, R. K. Ganju, B. J. Dezube, K. Alitalo, and M. Detmar. 1999. Vascular endothelial growth factor-C (VEGF-C) and its receptors KDR and flt-4 are expressed in AIDS-associated Kaposi's sarcoma. J. Investig. Dermatol. 113:1047-1053.[CrossRef][Medline]
46 - Smit, M. J., D. Verzijl, P. Casarosa, M. Navis, H. Timmerman, and R. Leurs. 2002. Kaposi's Sarcoma-associated herpesvirus-encoded G protein-coupled receptor ORF74 constitutively activates p44/p42 MAPK and Akt via Gei and phospholipase C-dependent signaling pathways. J. Virol. 76:1744-1752.[Abstract/Free Full Text]
47 - Sodhi, A., S. Montaner, V. Patel, M. Zohar, C. Bais, E. A. Mesri, and J. S. Gutkind. 2000. The Kaposi's sarcoma-associated herpes virus G protein-coupled receptor up-regulates vascular endothelial growth factor expression and secretion through mitogen-activated protein kinase and p38 pathways acting on hypoxia-inducible factor 1
. Cancer Res. 60:4873-4880.[Abstract/Free Full Text]
48 - Staskus, K. A., R. Sun, G. Miller, P. Racz, A. Jaslowski, C. Metroka, H. Brett-Smith, and A. T. Haase. 1999. Cellular tropism and viral interleukin-6 expression distinguish human herpesvirus 8 involvement in Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. J. Virol. 73:4181-4187.[Abstract/Free Full Text]
49 - Staskus, K. A., W. Zhong, K. Gebhard, B. Herndier, H. Wang, R. Renne, J. Beneke, J. Pudney, D. J. Anderson, D. Ganem, and A. T. Haase. 1997. Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells. J. Virol. 71:715-719.[Abstract]
50 - Weninger, W., T. A. Partanen, S. Breiteneder-Geleff, C. Mayer, H. Kowalski, M. Mildner, J. Pammer, M. Sturzl, D. Kerjaschki, K. Alitalo, and E. Tschachler. 1999. Expression of vascular endothelial growth factor receptor-3 and podoplanin suggests a lymphatic endothelial cell origin of Kaposi's sarcoma tumor cells. Lab. Investig. 79:243-251.[Medline]
51 - Whitby, D., M. R. Howard, M. Tenant-Flowers, N. S. Brink, A. Copas, C. Boshoff, T. Hatzioannou, F. E. Suggett, D. M. Aldam, and A. S. Denton. 1995. Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi's sarcoma. Lancet 346:799-802.[CrossRef][Medline]
52 - Yang, B. T., S. C. Chen, M. W. Leach, D. Manfra, B. Homey, M. Wiekowski, L. Sullivan, C. H. Jenh, S. K. Narula, S. W. Chensue, and S. A. Lira. 2000. Transgenic expression of the chemokine receptor encoded by human herpesvirus 8 induces an angioproliferative disease resembling Kaposi's sarcoma. J. Exp. Med. 191:445-454.[Abstract/Free Full Text]
Journal of Virology, February 2003, p. 2631-2639, Vol. 77, No. 4
0022-538X/03/$08.00+0 DOI: 10.1128/JVI.77.4.2631-2639.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Chaisuparat, R., Hu, J., Jham, B. C., Knight, Z. A., Shokat, K. M., Montaner, S.
(2008). Dual Inhibition of PI3K{alpha} and mTOR as an Alternative Treatment for Kaposi's Sarcoma. Cancer Res.
68: 8361-8368
[Abstract]
[Full Text]
-
Tarakanova, V. L., Kreisel, F., White, D. W., Virgin, H. W. IV
(2008). Murine Gammaherpesvirus 68 Genes both Induce and Suppress Lymphoproliferative Disease. J. Virol.
82: 1034-1039
[Abstract]
[Full Text]
-
Lubyova, B., Kellum, M. J., Frisancho, J. A., Pitha, P. M.
(2007). Stimulation of c-Myc Transcriptional Activity by vIRF-3 of Kaposi Sarcoma-associated Herpesvirus. J. Biol. Chem.
282: 31944-31953
[Abstract]
[Full Text]
-
Marinissen, M. J., Tanos, T., Bolos, M., de Sagarra, M. R., Coso, O. A., Cuadrado, A.
(2006). Inhibition of Heme Oxygenase-1 Interferes with the Transforming Activity of the Kaposi Sarcoma Herpesvirusencoded G Protein-coupled Receptor. J. Biol. Chem.
281: 11332-11346
[Abstract]
[Full Text]
-
Cannon, M., Cesarman, E., Boshoff, C.
(2006). KSHV G protein-coupled receptor inhibits lytic gene transcription in primary-effusion lymphoma cells via p21-mediated inhibition of Cdk2. Blood
107: 277-284
[Abstract]
[Full Text]
-
Jensen, K. K., Manfra, D. J., Grisotto, M. G., Martin, A. P., Vassileva, G., Kelley, K., Schwartz, T. W., Lira, S. A.
(2005). The Human Herpes Virus 8-Encoded Chemokine Receptor Is Required for Angioproliferation in a Murine Model of Kaposi's Sarcoma. J. Immunol.
174: 3686-3694
[Abstract]
[Full Text]
-
Beisser, P. S., Verzijl, D., Gruijthuijsen, Y. K., Beuken, E., Smit, M. J., Leurs, R., Bruggeman, C. A., Vink, C.
(2005). The Epstein-Barr Virus BILF1 Gene Encodes a G Protein-Coupled Receptor That Inhibits Phosphorylation of RNA-Dependent Protein Kinase. J. Virol.
79: 441-449
[Abstract]
[Full Text]
-
Paulsen, S. J., Rosenkilde, M. M., Eugen-Olsen, J., Kledal, T. N.
(2005). Epstein-Barr Virus-Encoded BILF1 Is a Constitutively Active G Protein-Coupled Receptor. J. Virol.
79: 536-546
[Abstract]
[Full Text]
-
Stedman, W., Deng, Z., Lu, F., Lieberman, P. M.
(2004). ORC, MCM, and Histone Hyperacetylation at the Kaposi's Sarcoma-Associated Herpesvirus Latent Replication Origin. J. Virol.
78: 12566-12575
[Abstract]
[Full Text]
-
Montaner, S., Sodhi, A., Servitja, J.-M., Ramsdell, A. K., Barac, A., Sawai, E. T., Gutkind, J. S.
(2004). The small GTPase Rac1 links the Kaposi sarcoma-associated herpesvirus vGPCR to cytokine secretion and paracrine neoplasia. Blood
104: 2903-2911
[Abstract]
[Full Text]
-
Guo, H.-G., Pati, S., Sadowska, M., Charurat, M., Reitz, M.
(2004). Tumorigenesis by Human Herpesvirus 8 vGPCR Is Accelerated by Human Immuodeficiency Virus Type 1 Tat. J. Virol.
78: 9336-9342
[Abstract]
[Full Text]
-
Liang, Y., Ganem, D.
(2004). RBP-J (CSL) Is Essential for Activation of the K14/vGPCR Promoter of Kaposi's Sarcoma-Associated Herpesvirus by the Lytic Switch Protein RTA. J. Virol.
78: 6818-6826
[Abstract]
[Full Text]
-
Sodhi, A., Montaner, S., Patel, V., Gomez-Roman, J. J., Li, Y., Sausville, E. A., Sawai, E. T., Gutkind, J. S.
(2004). Akt plays a central role in sarcomagenesis induced by Kaposi's sarcoma herpesvirus-encoded G protein-coupled receptor. Proc. Natl. Acad. Sci. USA
101: 4821-4826
[Abstract]
[Full Text]
-
Verzijl, D., Fitzsimons, C. P., van Dijk, M., Stewart, J. P., Timmerman, H., Smit, M. J., Leurs, R.
(2004). Differential Activation of Murine Herpesvirus 68- and Kaposi's Sarcoma-Associated Herpesvirus-Encoded ORF74 G Protein-Coupled Receptors by Human and Murine Chemokines. J. Virol.
78: 3343-3351
[Abstract]
[Full Text]
-
Liu, C., Sandford, G., Fei, G., Nicholas, J.
(2004). G{alpha} Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor. J. Virol.
78: 2460-2471
[Abstract]
[Full Text]
-
SODHI, A., MONTANER, S., GUTKIND, J. S.
(2004). Does dysregulated expression of a deregulated viral GPCR trigger Kaposi's sarcomagenesis?. FASEB J.
18: 422-427
[Abstract]
[Full Text]
-
Milligan, G.
(2003). Constitutive Activity and Inverse Agonists of G Protein-Coupled Receptors: a Current Perspective. Mol. Pharmacol.
64: 1271-1276
[Abstract]
[Full Text]
-
Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., Lieberman, P. M.
(2003). Chromatin Remodeling of the Kaposi's Sarcoma-Associated Herpesvirus ORF50 Promoter Correlates with Reactivation from Latency. J. Virol.
77: 11425-11435
[Abstract]
[Full Text]
-
Pati, S., Foulke, J. S. Jr., Barabitskaya, O., Kim, J., Nair, B. C., Hone, D., Smart, J., Feldman, R. A., Reitz, M.
(2003). Human Herpesvirus 8-Encoded vGPCR Activates Nuclear Factor of Activated T Cells and Collaborates with Human Immunodeficiency Virus Type 1 Tat. J. Virol.
77: 5759-5773
[Abstract]
[Full Text]