Previous Article | Next Article ![]()
Journal of Virology, December 2003, p. 13433-13438, Vol. 77, No. 24
0022-538X/03/$08.00+0 DOI: 10.1128/JVI.77.24.13433-13438.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Department of Microbiology,1 Abramson Family Cancer Research Institute, University of Pennsylvania, School of Medicine, Philadelphia, Pennsylvania 19104-60762
Received 28 March 2003/ Accepted 11 September 2003
|
|
|---|
) has been described as a factor involved in
mediating Ebola virus entry into cells
(6). Furthermore, it was
suggested that interaction with FR
results in internalization
and subsequent viral ingress into the cytoplasm via caveolae
(9). Descriptions of
cellular receptors for Ebola virus and its entry mechanisms are of
fundamental importance, particularly with the advent of vectors bearing
Ebola virus glycoprotein (GP) being utilized for gene transfer into
cell types such as airway epithelial cells. Thus, the ability of
FR
to mediate efficient entry of viral pseudotypes carrying GP
was investigated. We identified cell lines and primary cell types such
as macrophages that were readily infected by GP pseudotypes despite
lacking detectable surface FR
, indicating that this receptor
is not essential for Ebola virus infection. Furthermore, we find that
T-cell lines stably expressing FR
are not infectible,
suggesting that FR
is also not sufficient to mediate entry.
T-cell lines lack caveolae, the predominant route of
FR
-mediated folate metabolism. However, the coexpression of
FR
with caveolin-1, the major structural protein of caveolae,
was not able to rescue infectivity in a T-cell line. In addition, other
cell types lacking caveolae are fully infectible by GP pseudotypes.
Finally, a panel of ligands to and soluble analogues of FR
were unable to inhibit infection on a range of cell lines, questioning
the role of FR
as an important factor for Ebola virus
entry. |
|
|---|
Chan and colleagues recently used a
retrovirus-based selection protocol to identify cDNAs able to confer
susceptibility to Jurkat T-cells by pseudotypes bearing Ebola virus or
Marburg virus GP (6).
Using this method, a number of cDNAs were isolated from a HeLa cell
cDNA library with identity to folate receptor alpha (FR
) were
identified. FR
is an attractive candidate as a filovirus
receptor as it is widely expressed but is not detectable on lymphocytes
(12) and is highly
conserved between different species. The initial cDNA isolated from the
tranduced Jurkat cells, however, lacked the 5' coding sequence
of FR
and initiated translation from an internal in-frame ATG
(Met92) (6). This clone of
FR
thus lacks an N-terminal signal peptide sequence to target
it to the lumen of the endoplasmic reticulum, making it
highly unlikely that it is expressed at the cell surface. This
inconsistency, together with the fact that a number of cell lines
readily infectible by Ebola virus pseudotypes appear to lack
FR
, led us to reexamine the role of FR
in Ebola virus
infection.
FR
expression on susceptible
and nonsusceptible cells.
Widespread expression in different cell
lines appears to support the hypothesis that FR
acts as a cell
surface receptor for Ebola virus. However, the published literature
indicates that a number of cell types are FR
negative. For
example, A549 cells (a human lung carcinoma cell line) lack the ability
to bind and internalize folate
(36), due to a lack of
FR
(21). This
was confirmed by both flow cytometry using a mouse monoclonal antibody
(LK26) to human FR
(Fig.
1A) and reverse transcription (RT)-PCR (data not shown). A549
cells were 3- to 10-fold more infectible by LacZ-encoding human
immunodeficiency virus (HIV) pseudotypes bearing Ebola virus GP (Zaire
Mayinga strain) than HeLa or Cos-7 cells, which express substantial
levels of FR
(Fig.
1), (7.3 x
105 compared to 5.6 x 104 and 2.7
x 105 focus-forming units [FFU] per ml,
respectively). In confirmation of previous findings
(7,
37), HeLa cells were also
approximately 20-fold-less infectible than 293 cells (1.2 x
106 FFU/ml), which express low levels of FR
(Fig.
1). Thus, FR
is
not absolutely required for efficient viral entry mediated by Ebola
virus GP, and levels of FR
expression do not appear to
correlate with infectivity. Importantly, primary macrophages, the major
initial in vivo target for Ebola virus replication in primate animal
models (13,
16,
29,
34), were found to
express a very small amount of FR
mRNA, with a set of internal
nested primers required for detection by RT-PCR (Fig.
1B). No detectable surface
expression of FR
on primary macrophages was seen by flow
cytometry following 3 to 8 days of culture (Fig.
1A and data not shown).
Low levels of FR
message in macrophages may potentially be
sufficient to mediate efficient Ebola virus infection, though the lack
of detectable surface expression suggests that receptors other than
FR
are responsible for infection of this important cell
type.
![]() View larger version (51K): [in a new window] |
FIG. 1. FR
expression on common cell lines and primary macrophages. (A)
Surface levels of FR on five cell lines and day 6 primary
macrophages were determined by standard flow cytometry
(33) with a murine
monoclonal antibody directed against human FR (LK26; Signet)
(open histograms) and an isotype control (immunoglobulin G2a; Sigma,
St. Louis, Mo.) (filled histograms). Macrophages were isolated from
human leukocytes by plastic adherence, as previously described
(32). (B)
Levels of cellular mRNA for FR and human ß-actin were
evaluated by RT-PCR, using an Express direct mRNA capture and RT system
(Pierce, Rockford, Ill.). mRNA was extracted and cDNA synthesis was
performed in the same well containing serial 10-fold dilutions of each
cell type. PCR was performed with 16.5 µl of cDNA by using the
conditions 95°C for 30 s followed by 30 cycles of
95°C for 30 s, 58°C for 30 s, and
72°C for 40 s for FR (forward primer,
TGGGTGGCTGTAGTAGGGGAG; reverse primer,
CAGGGGCACGTTCAGTACC) and ß-actin (forward
primer, CTGGCACCACACCTTCTACAATG; reverse primer,
AATGTCACGCACGATTTCCCGC), resulting in 359- and
381-bp products, respectively. Primers were designed so that products
spanned intron and exon boundaries, such that the predicted products
derived from genomic DNAs were 3,440 and 822 bp for FR and
ß-actin, respectively. For cell types negative for FR
in the first round of PCR (macrophages [Macs] and the T-cell
line, Jurkat), 5 µl was transferred to new tubes and nested PCR
was performed with the same conditions as those described above and the
following set of nested primers: forward primer
GCCAAGCACCACAAGGAAAAG and reverse primer
CCTGGATGAAATGCCGTTTG. This resulted in a 189-bp
product with a 3,118-bp predicted genomic DNA product. Both first-round
and nested primers recognized all seven isoforms of FR
(8). Gaps between each
sample represent controls for which the whole mRNA extraction and
RT-PCR procedure was carried out on empty wells (a total of seven
controls for the nested PCR). Control experiments with the same
reaction mixtures performed on mRNA from each cell line in the absence
of reverse transcriptase were all negative (data not
shown).
|
on
FR
-negative cells does not enhance infection.
Lentiviral vectors expressing
full-length FR
or the human chemokine receptor CCR5 as a
control were used to transduce A549 cells, leading to FR
expression on these otherwise FR
-negative cells (Fig.
2A). No discernible differences in levels of either Ebola virus GP or
vesicular stomatitis virus G protein (VSV-G) pseudotype
infection was seen in mock-transduced or FR
- or
CCR5-expressing A549 cells (Fig.
2C). Thus, FR
is
not required for and does not enhance infection of A549 cells,
suggesting that alternative receptors are sufficient to give maximal
infectivity of this cell type.
![]() View larger version (22K): [in a new window] |
FIG. 2. Expression
of FR and Cav-1 in cell lines does not enhance Ebola virus
pseudotype infection. (A) Surface levels of FR were
assessed as described in the legend to Fig.
1 for A549 cells (left
panel) transduced with lentiviral vectors (for protocols, see
reference 31) expressing
a control of CCR5 (filled histogram) or FR (open histogram)
and for CEMss cells (right panel, filled histogram) or CEM cells stably
expressing FR (open histogram). (B) Total protein
levels of Cav-1 were assessed by Western blotting using a directly
horseradish peroxidase-conjugated polyclonal rabbit antibody raised
against the N terminus of Cav-1 (N-20; Santa Cruz Biotechnology, Santa
Cruz, Calif.). Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis was performed on cell lysates from 106
cells. CEMss cells were transduced with MLV amphotropic envelope
pseudotyped MLV particles carrying the MIGR1 packaging vector encoding
human CD8 (27) or MLV
MIGR1 encoding human Cav-1. Cos and 293 cells were also tested to
determine endogenous levels of Cav-1. (C) Mock-transduced and
CCR5- or FR -transduced A549 cells (left panel) or CEMss and
CEM/FR cells transduced with control or Cav-1-encoding MLV
pseudovirions (right panel) were challenged with HIV-based
pseudovirions encoding LacZ
(18) pseudotyped with
Ebola virus GP, VSV-G, or HIV gp160 (HXB2 strain). Two days
postchallenge, cells were lysed and soluble ß-galactosidase
(ß-gal) levels were measured with a chemiluminescence kit
(Galactostar; Tropix) as per the manufacturer's instructions.
Similar results were gained by using pseudovirions encoding luciferase
as a reporter gene (data not shown). (D) Vero cells, but not
Jurkat cells stably expressing ecotropic MLV receptor or previously
described derivates expressing FR
(6), were transducible
with VLPs bearing Ebola virus GP. VLPs were made by
cotransfecting293T cells with eqimolar
amounts of a Bla-VP40 fusion protein and GP, VSV-G, or empty vector.
Forty-eight hours posttransfection, filtered supernatant was collected
and diluted. Cells (5 x 105) were spin infected at
2,500 rpm for 2 h at 4°C and then incubated for
4 h at 37°C to allow entry. Cells were then labeled
with CCF2-AM (Invitrogen, Carlsbad, Calif.) as per the
manufacturer's instructions, washed, transferred to
clear-bottomed, black-walled microtiter plates, and incubated overnight
at room temperature to allow the enzymatic reaction to occur. The
following morning, plates were read at 460 and 530 nm (Cytofluor 4000;
Applied Biosystems, Foster City, Calif.). Background fluorescence from
unlabeled cells was subtracted, and the ratio of fluorescence at 460 nm
to that at 530 nm (460/530) was calculated for each well. Means and
standard deviations shown are calculated from the results of four
replicates, and the results presented are representative of three
independent
experiments.
|
expression confers Ebola virus susceptibility to lymphoid
cells, a stable population of CEMss cells, a human
CD4+-T-cell line, expressing high levels of
full-length FR
was generated by transfection and drug
selection (termed CEM/FR
). Expression of FR
was
demonstrated by fluorescence-activated cell sorting analysis (Fig.
2A), and these cells were
challenged with lentiviral vector pseudotypes carrying either Ebola
virus GP or, as a control, HIV Env. By both a sensitive
chemiluminescent assay for soluble ß-galactosidase (Tropix,
Bedford, Mass.) (Fig. 2C)
and single-cell quantification by ß-galactosidase staining,
both the FR
-expressing cells and the parental CEMss were
resistant to infection by pseudotypes bearing Ebola virus GP (titers of
<12 FFU/ml for both parental CEMss and CEM/FR
cells
were found by using a viral stock with a titer of 5.0 x
106 FFU/ml on 293 cells). Levels of infectivity were
unchanged regardless of whether the infections were carried out in RPMI
or M199 medium, which lacks folic acid (see below). Thus, FR
expression on a nonpermissive lymphoid cell line does not confer
susceptibility to Ebola virus GP pseudotypes. A small but reproducible
increase in infection mediated by HIV Env derived from the CXCR4-tropic
strain HXB2 was observed. It is likely that this increase was due
merely to the random selection of a slightly more susceptible
subpopulation during the cloning process. Importantly, the Jurkat
T-cell lines F10 and A9, which contain FR
cDNA as described by
Chan et al. (6), were also
found not to be infectible by either lacZ or luciferase
reporter pseudotypes bearing Ebola virus GP (data not
shown).
Although extensive analysis(7,
37,
38) has yet to identify
any differences in viral entry between infectious Ebola virus and
retroviral pseudotypes bearing Ebola virus GP, it has been suggested
that the lack of similarity between long, filamentous Ebola virus
particles and small, spherical retroviral particles may give rise to
artifactual results. To address this concern, a unique assay to
determine the entry of filamentous Ebola virus-like particle (VLP) has
been developed (G. Simmons and P. Bates, unpublished data). This assay
relies on the published observation that expression of Ebola virus VP40
matrix protein leads to budding of VLPs in the absence of any other
viral proteins (15).
Furthermore, these VLPs are filamentous and closely resemble infectious
Ebola virus particles by electron microscopy
(15). Coexpression of
Ebola virus GP with VP40 gives rise to VLPs studded with GP on their
surfaces (2,
25). To monitor the
cellular entry of these VLPs, a chimeric ß-lactamase
(Bla)-VP40 protein was produced. We have found that N-terminal
tagging of VP40 with Bla does not adversely effect budding but rather
produces particles able to deliver Bla enzymatic activity to target
cells, such as Vero cells, upon membrane fusion (Fig.
2D). Bla-VP40 particles
budding from transfected 293T cells in the presence or absence of GP
formed long, filamentous particles as judged by electron microscopy
(data not shown) and closely resembled previously described particles
(2,
25). GP-mediated transfer
of functional Bla enzymatic activity to the cytoplasm of target cells
is measured by labeling these cells with CCF2-AM, a substrate capable
of fluorescing at a wavelength of 530 nm when excited at 409 nm.
Hydrolysis of a ß-lactam ring in CCF2 by Bla creates a product
that, when excited at 409 nm, fluoresces at a lower emission wavelength
of 460 nm (4,
19). Thus, the degree of
Bla enzymatic activity can be ascertained by plotting a ratio of the
fluorescence at 460 nm to that at 530 nm (Fig.
2D). Vero cells were
efficiently transduced by Bla+ VLPs bearing either
Ebola virus GP or VSV-G but not by particles containing no envelope
(Fig. 2D). VLP
transduction of Bla mediated by Ebola virus GP, as in wild-type Ebola
virus infection, is pH dependent and can be inhibited by neutralizing
anti-Ebola virus GP sera (Simmons and Bates, unpublished). In
accordance with the results of the Ebola virus GP pseudovirion
experiments described above, neither parental Jurkat cells expressing
the ectotropic murine leukemia virus (MLV) receptor (Jurkat
EctR cells) nor derivatives expressing FR
(Jurkat A7 and F10
cells) (6) were transduced
above background levels by Bla+ VLPs bearing Ebola
virus GP. For both the Vero and Jurkat cell lines, background levels of
Bla+ VLPs with no envelope proteins were similar to
those of CCF2-AM-labeled cells with no particles added (data not
shown). In contrast to the Ebola virus GP results, VLPs bearing VSV-G
exhibited levels of entry into all of the Jurkat cell lines that were
similar to levels of entry into Vero cells (Fig.
2D). Overall, these
experiments with filamentous particles confirm the pseudovirion
results, demonstrating that FR
does not affect T-cell
susceptibility to Ebola virus GP-mediated
entry.
Caveolin-1 expression does not
enhance lymphocyte infection.
FR
either inhabits or is
induced by folate or antibody binding to cluster into cholesterol-rich,
flask-like invaginations in the plasma membrane termed caveolae
(3). Upon binding with
folate, FR
's internalization of the caveolae occurs as
part of a process termed potocytosis. An
H+-pump-mediated decrease in vesicular pH then leads
to folate release, and FR
is trafficked back to the cell
surface (17). Ebola
virus, a pH-dependent virus
(37), likely requires
endocytosis and trafficking to low-pH vesicles in order to efficiently
infect cells. Therefore, if FR
does function as a receptor for
Ebola virus, then a pathway similar to that utilized for folic acid
metabolism may be employed by the virus for entry. This hypothesis is
supported by the finding that caveolin-1, the key structural component
of caveolae, appears to colocalize with internalized Ebola virus GP,
but not VSV-G, pseudotypes following infection
(9). Lymphocytes,
including T-cell lines such as CEMss (Fig.
2B), lack expression of
caveolin-1 (Cav-1) and hence fail to form caveolae
(10,
11), although
introduction of Cav-1 into lymphocytes establishes caveolae formation
in these cells (10).
Thus, Chan and colleagues argue that the failure of Ebola virus GP
pseudotypes to efficiently infect T-cells expressing FR
may be
due to the lack of caveolae in such cells
(6,
9). Other cell types, such
as a number of rat thyroid epithelial cell lines (including FRT, WRT,
and PCC13 cells), however, are also devoid of caveolae
(20,
23,
39; data not shown). To
address whether caveolae are essential for infection, these cell lines
were analyzed for infection by Ebola virus pseudotypes and found to be
susceptible (titers of 1.5 x 105, 2.8 x
105, and 3.5 x 105 FFU/ml on FRT, WRT,
and PCC13 cells, respectively). FRT cells stably expressing Cav-1
efficiently form caveolae
(23). To further assess
the role of caveolae in Ebola virus entry, parental FRT cells and cells
expressing Cav-1 were challenged with Ebola virus GP pseudotypes. A
roughly twofold increase in infection by Ebola virus GP pseudotypes was
seen in the cells expressing Cav-1 (1.5 x 105 and
3.1 x 105 FFU/ml for FRT and FRT/Cav-1 cells,
respectively). Pseudotypes bearing VSV-G, however, showed similar
increases on these cells (1.3 x 107 and 2.7
x 107 FFU/ml for FRT and FRT/Cav-1 cells,
respectively), suggesting that the observed increase may be due to
selection of a subpopulation which is more permissive for expression of
the HIV vector.
While caveolae are clearly not necessary for
efficient infection in these cell types, it is possible that caveolae
represent only one of a number of potential routes of cellular entry.
Therefore, as Cav-1 expression in lymphocytes reconstitutes caveolae
formation (10), CEMss and
CEM/FR
cells were transduced with MLV pseudotypes encoding
human Cav-1. SDS-PAGE analysis of transduced CEMss cells demonstrated
Cav-1 expression at levels similar to endogenous Cav-1 seen in 293T
cells (Fig. 2B and data
not shown). Only a slight increase in Ebola virus-GP-mediated infection
of both CEMss and CEM/FR
cells transduced with Cav-1 compared
to cells transduced with empty vector was noted (Fig.
2C). CEM/FR
cells
expressing Cav-1 were no more infectible by Ebola virus-GP pseudotypes
than parental CEMss with Cav-1 (Fig.
2C). Thus, caveolae
formation does not facilitate FR
-mediated infection of T-cell
lines, suggesting that lack of caveolae is not the reason for
inefficient Ebola virus-GP pseudotype infection in T-cell lines
expressing FR
, but rather either other missing components are
required for viral entry or FR
does not function as an
efficient mediator of entry for Ebola virus.
Viral pseudotypes
expressing a membrane-bound form of protein A can bind to cell surface
molecules via captured monoclonal antibodies
(26). A mutant form of
influenza virus hemagglutinin (HA) functional for membrane
fusion but not sialic acid binding
(22) can then be
coincorporated into these viral pseudotypes and used to mediate viral
entry (N. Chai and P. Bates, unpublished results). In this manner,
lentiviral particles targeted to FR
with an anti-FR
monoclonal antibody (LK26; Signet, Dedham, Mass.) were able to infect
the FR
-positive cell lines 293T and CEM/FR
(7.3
x 105 and 2.1 x 102 FFU/ml,
respectively) but not CEMss cells (<12 FFU/ml). Thus,
FR
on T cells is able to internalize and direct virus to
suitable low-pH endosomes for triggering of HA. Complementation of
Ebola virus GP with coincorporated HA, however, did not lead to either
CEMss nor CEM/FR
cell infection (<12 FFU/ml for both
cell lines compared to 5.6 x 106 on 293T cells),
suggesting a lack of sufficient interactions between GP and FR
to allow viral internalization.
Folic acid
fails to inhibit Ebola virus pseudotype infection.
Folic acid, the natural ligand for
FR
, was tested for the ability to inhibit Ebola virus GP
bearing pseudotype infection of GHOST cells. GHOST cells are a
derivative of HOS, a human osteosarcoma cell line, that contain green
fluorescent protein (GFP) under the control of an HIV long terminal
repeat (LTR). Thus, upon infection by HIV pseudotypes, GFP expression
is activated by Tat protein(5). Many formulations of
growth media, such as Dulbecco's modified Eagle's medium
(DMEM), contain higher levels of folic acid than that
reported by Chan et al. to give a 90% reduction in infection on
HOS cells (6). Thus, M199
medium, together with charcoal-stripped fetal bovine serum, was used
due to its low folic acid content. No differences in Ebola virus GP
pseudotype titers were observed in GHOST cells, regardless of whether
infections were carried out in M199 medium or in DMEM (data not shown),
suggesting that the high levels of folate in DMEM do not affect basal
levels of Ebola virus GP pseudotype infection. M199 medium supplemented
with concentrations of folic acid up to 2.2 mM also had no effect on
Ebola virus pseudotype infection (Fig.
3A). Due to the use of sodium hydroxide for complete solubility of folic
acid, the medium-alone controls were adjusted to the same pH (8.5).
This adjustment caused a small decrease in levels of infection for both
Ebola virus GP and VSV-G pseudotypes compared to levels in neutral-pH
M199 medium (data not shown). Thus, contrary to the findings published
by Chan et al. (6), folic
acid did not significantly reduce Ebola virus GP-mediated entry into a
cell line derived from HOS cells. Similar findings with LacZ-encoding
pseudotypes were also found in Vero cells (Fig.
3B). In addition,
5-methyltetrahydrofolic acid, an analogue of folic acid that is readily
soluble in water and thus can be used at neutral pH, also showed no
specific inhibition of Ebola virus GP pseudotype infection of GHOST or
Vero cells at concentrations up to 5 mM (Fig.
3B and data not shown).
Similarly, a number of polyclonal and monoclonal antibodies directed
against FR
(LK26 [Signet], polyclonal rabbit
anti-bovine folate binding protein [Biogenesis, Brentwood,
N.H.], and goat anti-bovine folate binding protein [Rockland,
Gilbertsville, Pa.]), as well as soluble versions of folate
binding protein (purified bovine folate binding protein
[Biogenesis]), failed to specifically inhibit Ebola virus
pseudotype infection in HOS and HeLa cells (data not shown). It is
possible that neither folic acid nor the antibodies and other ligands
tested utilize the same binding sites as Ebola virus GP on FR
;
however, some of these same reagents were reported previously to
inhibit infection on HOS and Vero cells
(6). The inhibitory
effects of cholesterol depletion on Ebola virus infection
(2,
9) suggest a role for
lipid rafts in viral entry. It is possible that in experiments by
others, ligands to glycosylphosphatidylinositol-anchoredproteins (such as FR
) that cluster in rafts may give weak,
nonspecific inhibition of viral entry. Monoclonal antibodies to at
least three separate GPI-anchored, lipid raft-specific proteins are
able to relatively weakly inhibit human T-cell leukemia virus type 1
infection (24). It is
unlikely that all of these proteins play a direct role in human T-cell
leukemia virus type 1 entry, suggesting that, indeed, viral entry
through lipid rafts may be adversely affected nonspecifically by
ligands to raft-associated proteins.
![]() View larger version (19K): [in a new window] |
FIG. 3. Inhibition
of Ebola virus pseudotype infection of GHOST cells by folic acid.
(A) GHOST cells were incubated at 4°C for 30 min with
M199 medium containing 5% charcoal-stripped fetal bovine serum
alone (approximate basal folic acid concentration in M199 medium is
0.02 mM) or supplemented with various concentrations of folic acid
dissolved in sodium hydroxide (1 M). The pH of all solutions was
adjusted to 8.5. An equal volume of HIV-based pseudovirions encoding
GFP pseudotyped with Ebola virus GP or VSV-G was then added to give
final concentrations of folic acid of 0.02, 0.22, 0.73, and 2.2 mM.
Cells were incubated for 6 h, the medium was replaced, and
the cells were incubated for a further 48 h. GFP expression
was then analyzed by flow cytometry, and results are displayed as
percentages of the expression in the control (M199 medium alone
[pH 8.5], i.e., 0.02 mM folic acid). The results of the
experiment shown are representative of three independent experiments.
Error bars represent standard deviations of results from three
replicates. (B) Vero cells were incubated as described above
with M199 medium supplemented with folic acid (broken lines) or
5-methyltetrafolic acid (solid lines). An equal volume of HIV-based
pseudovirions encoding LacZ pseudotyped with Ebola virus GP (squares)
or MLV amphotropic envelope (circles) was then added to give the
plotted concentrations. Cells were incubated for 6 h, the
medium was replaced, and the cells were incubated for a further
48 h. lacZ expression was then analyzed by
quantification of X-galactosidase-stained cells as previously described
(32), and results are
displayed as percentages of the expression level in the
control.
|
as a major component in
Ebola virus GP-mediated cell entry. While it is clear that a number of
cell types, including primary macrophages, lack FR
and thus
must require other molecules for efficient entry, it is more difficult
to definitively rule out a role for FR
in all cell types.
However, a number of ligands to FR
, including folic acid and
antibodies previously reported to inhibit Ebola virus GP pseudotype
infection (6), were not
found to significantly affect infection on the cell lines tested. As
demonstrated with FR
-deficient A549 cells, receptors other
than FR
that are capable of mediating efficient infection of
Ebola virus exist. It is possible that these receptors are also present
on the cell lines used to analyze FR
ligand inhibition and
thus allow continued efficient infection even in the presence of
complete FR
occlusion. The fact that expression of
FR
, even in the presence of Cav-1, was unable to mediate
infection of a T-cell line, however, questions the role that
FR
plays in Ebola virus infection. Thus, we believe that the
receptor(s) for filoviruses remains to be elucidated. Ebola virus GP
pseudotyped retroviruses have been used to efficiently transduce cell
types, such as airway epithelial cells, that are refractory to the more
commonly used glycoprotein from VSV
(18). Thus, Ebola virus
GP may be utilized as an alternative for gene transfer protocols and
highlights the need for a clearer understanding of the mechanisms of
Ebola virus entry. In addition, the description of Ebola virus-specific
receptors will facilitate the design and testing of inhibitors of Ebola
virus infection as potential therapeutics.
This work was supported by grant RO1 AI43455 from the NIH. G.S. was supported by a long-term EMBO fellowship.
* Mailing address for Paul Bates: Department of Microbiology, School of
Medicine, University of Pennsylvania, 303A Johnson Pavilion, 3610
Hamilton Walk, Philadelphia, PA 19104-6076. Phone: (215) 573-3508. Fax:
(215) 573-9069. E-mail:
pbates{at}mail.med.upenn.edu. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»