Previous Article | Next Article ![]()
Journal of Virology, December 2003, p. 13301-13314, Vol. 77, No. 24
0022-538X/03/$08.00+0 DOI: 10.1128/JVI.77.24.13301-13314.2003
Copyright © 2003, American
Society for
Microbiology. All Rights Reserved.
Departments of Stomatology,1 Anatomy,3 Pharmaceutical Chemistry,4 Biomedical Sciences Graduate Program,5 Oral Biology Graduate Program, University of California-San Francisco, San Francisco, California 94143-05122
Received 2 July 2003/ Accepted 3 September 2003
|
|
|---|
|
|
|---|
Placentation is a stepwise process that entails differentiation of cytotrophoblast stem cells along two pathways. In the pathway that gives rise to floating villi, cytotrophoblasts differentiate by fusing into multinucleate syncytiotrophoblasts that cover the villus surface, which is in direct contact with maternal blood (Fig. 1, zone I). This trophoblast population is specially adapted for transporting a wide variety of substances to the fetus, including maternal immunoglobulin G (IgG), via the neonatal Fc receptor (59). In the pathway that gives rise to anchoring villi, which attach the placenta to the uterine wall (Fig. 1, zone II), cytotrophoblasts aggregate into cell columns and invade the maternal decidua and the first third of the myometrium (interstitial invasion). During this process they remodel uterine blood vessels, thereby diverting blood flow to the placenta (endovascular invasion) (Fig. 1, zone III). By midgestation, cytotrophoblasts have completely replaced the endothelial lining and partially replaced the muscular wall of uterine blood vessels. Invasive cytotrophoblasts in anchoring villi express adhesion molecules and proteinases that enable attachment to the uterine wall and immune modulating factors that likely elicit maternal tolerance of the hemiallogeneic fetus (10, 27, 31).
![]() View larger version (60K): [in a new window] |
FIG. 1. Diagram
of the placental (fetal)-decidual (uterine) interface near the end of
the first trimester of human pregnancy (10 weeks of gestational age). A
longitudinal section includes a floating villus and an anchoring
chorionic villus. The anchoring villus (AV) functions as a bridge
between the fetal and maternal (decidual) compartments. The floating
villus (FV), bathed by maternal blood, contains the fetal capillaries.
Cytotrophoblasts in AV (zone I) form cell columns that attach to the
uterine wall (zone II). Cytotrophoblasts then invade the uterine
interstitium, decidua and first third of the myometrium and maternal
vasculature (zone III), thereby anchoring the placenta to the uterus
and gaining access to the maternal circulation. Colors illustrate
different cell types: syncytiotrophoblasts (beige), cytotrophoblast
progenitor cells and invasive cells (light green), decidual cells (dark
green), endothelial cells (yellow), smooth muscle cells (brown),
epithelial cells in endometrial glands (gray); innate immune cells:
DC-SIGN-positive macrophage/dendritic cells (M /DC) (purple),
another dendritic cell type (DC) (pink), neutrophils (PMN) (red), and
natural killer cells (NK) (dark pink). Sites proposed as routes of CMV
infection in utero are numbered 1 to 4 (modified from reference
69).
|
The cellular organization of the decidual-placental interface suggests potential routes by which CMV reaches the placenta (14). Virus might disseminate from infected maternal blood cells to the decidua (Fig. 1, site 1), interstitial and endovascular cytotrophoblasts in the uterine wall (site 2), cytotrophoblast columns of anchoring villi (site 3), and/or floating villi (site 4). An endothelial cell-tropic CMV strain replicates in uterine microvascular endothelial cells and spreads to invasive cytotrophoblasts in vitro (34), suggesting that hematogenous transmission occurs in utero.
Given the importance of understanding how CMV traverses the maternal-fetal interface, we investigated whether the virus was found in isolation or with other pathogens. We determined a role for pathogenic bacteria in viral reactivation in seropositive women and also identified the maternal and fetal cells that are associated with infected foci. Together, the results of this study provide novel information about the cellular mechanisms that allow CMV to reach the placenta, the first step in transmission to the fetus.
|
|
|---|
PCR. Extracted DNA was tested for CMV (33, 43), herpes simplex virus (HSV) (42), Bacteroides (66), Chlamydia (45), Gardnerella (40), Neisseria gonorrhoeae (29), Ureaplasma (32), group B Streptococcus (25), Mycoplasma hominis (32), and Mycoplasma genitalium (CCATGCTGAGAAGTAGAATAGC, TTGACATGCGCTTCCAATAA). An Applied Biosystems 9700HT sequence detection system (Foster City, Calif.) was used for real-time amplification of CMV and HSV sequences according to the manufacturer's instructions. Primers and probes were designed with Primer Express software to amplify fragments of CMV IE1/IE2 (GGAGACCCGCTGTTTCCA, TTGCAATCCTCGGTCACTTG; probe, TTGGCCGAAGAATCCCTCAAAACTTTTG) and UL83 (TGGACCTGCGTACCAACATAGA, TTTCAGGAGAACAAATCTCCGC; probe, CCGGCCCTCGGTTCTCTGCTG) genes, and the HSV DNA polymerase gene (UL30) (TGGATCTGGTGCGCAAAA, CGGATACGGTATCGTCGTAAAAC; probe; CAACCGCACCTCCAGGGCCC). FAM/TAMRA-labeled probes were manufactured by Biosearch Technologies (Novato, Calif.). Analysis of significance (P < 0.05) was determined by Fisher's exact test and McNemar test conducted in Stata (version 7.0) and R (version 1.6.2).
Immunohistochemistry. Tissues were processed for immunohistochemistry as described (14).
Viral proteins. Murine monoclonal antibodies to CMV-infected cell proteins and virion gB were used as described (48, 49). Immunoglobulin G (IgG) was affinity-purified from murine ascites with the ImmunoPure IgG purification kit (Pierce). CMV proteins included an antibody pool to gB (49), gH (CH438, UL75), alkaline nuclease (CH19, UL98/UL99), pp65 (CH65, UL83), IE1/IE2 (CH160, UL122/123), and ICP22 (CH41, US22). Guinea pig antiserum to CMV gB was a gift from Chiron Corp. (Emeryville, Calif.).
Cellular proteins. Purified IgG to cellular proteins was purchased from the following sources: CD45, neutrophils and monocytes (Dako); CD56, natural killer cells (BD PharMingen); DC-SIGN, dendritic cells (BD PharMingen); CD68, macrophage/dendritic cells (Dako); IGFBP-1, decidual cells (goat anti-IGFBP-1, Diagnostic Systems); and vWF, endothelial cells (rabbit anti-human vWF, Novocastra). Anti-human cytokeratin antibody (7D3) was used to stain epithelial cells and cytotrophoblasts (14). Antiserum to neonatal Fc receptor was a gift from Neil Simister (35). Goat anti-human IgG and tetramethyl rhodamine isothiocyanate (TRITC)-conjugated Affini Pure F(ab') fragment were obtained from Jackson ImmunoResearch. Secondary antibodies (Jackson ImmunoResearch) were goat anti-mouse IgG labeled with fluorescein isothiocyanate (FITC) or TRITC; goat anti-rat IgG labeled with TRITC; goat anti-guinea pig IgG labeled with FITC or TRITC; and goat anti-rabbit IgG labeled with TRITC. Nuclei were counterstained with TO-PRO-3 iodide (Molecular Probes). Laser-scanning confocal images were generated with a Bio-Rad MRC1024 confocal Optiphot II Nikon microscope.
Serological assays. IgG was purified from conditioned medium that contained biopsy specimens and residual maternal blood with the ImmunoPure IgG purification kit (Pierce). To assess serological status to CMV, IgG was tested by immunofluorescence with strain Toledo-infected fibroblasts and a commercial enzyme-linked immunosorbent assay (OptiCoat CMV [IgG], Biotecx Laboratories). For neutralization titers, strain Toledo was incubated with 100 µg of purified IgG (60 min) and examined in the rapid infectivity assay (41). Titers, calculated as percent neutralization per microgram of IgG compared with positive control IgG, were defined as low (0 to 39%), moderate (40 to 69%), and high (70 to 98%). Positive (neutralizing control CH177) IgG to gB (100 mg/ml) reduced plaque number (86 to 98%) in three sets of duplicate experiments. Nonneutralizing IgG to gB (CH86) was used as a negative control.
Electron microscopy. Placental biopsy specimens were fixed in 1.5% Karnovsky fixative and postfixed in 1% Palade buffer, dehydrated, and embedded. Sections were stained in uranyl acetate and lead citrate and examined with a JEM-1200EX electron microscope.
Fluorescence in situ hybridization. Frozen sections were fixed and processed prior to overnight hybridization with a fluorescein oligonucleotide cocktail to a CMV early-gene RNA transcript (Novocastra). A negative control probe was included for hybridization with each biopsy section. Positive control samples were provided by the manufacturer. Sections were incubated with biotinylated anti-fluorescence and then with fluorescein avidin DCS (Vector). TO-PRO-3 above (Molecular Probes) was used for nuclear counterstaining.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. PCR
detection of viruses and pathogenic bacteria in early-gestation biopsy
specimensa
|
We also examined the effects of gestational age. A high incidence of CMV DNA with or without other pathogens was detected in 63% of first-trimester placentas and increased to 74% in the second trimester (Table 1). Together, samples with both CMV and bacterial DNA increased from 31% in the first trimester to 44% in the second trimester, whereas CMV alone was reduced in the second trimester. Fewer second-trimester placentas were negative for all pathogens (P = 0.039). Our results suggest that CMV is commonly found together with pathogenic bacteria and tends to increase in the second trimester.
Some serologic evidence suggests that reinfection with new CMV strains in seropositive women might be associated with symptomatic fetal infection (2). Therefore, we investigated whether multiple strains colonize the placental-decidual interface. To identify tissues with more than one strain, we sequenced a region of the gB gene with characteristic nucleotide differences (4). Sequence analysis of seven CMV DNA-positive biopsy pairs (Table 1) revealed that the gB genotypes were similar to three variants as classified by Chou and Dennison (4): group 1 (three strains), group 2 (two strains), and group 3 (one strain). Paired samples from one decidua and adjacent placenta from a seropositive donor without detectable neutralizing antibodies contained a mixture of gB genotypes. Together, these results suggest that different CMV strains are present at the maternal-fetal interface and may be found early in infection.
Development of neutralizing antibodies is delayed when primary CMV infection occurs shortly before or during gestation (1, 16, 30, 52, 62), whereas high titers indicate resolution of acute infection and/or reactivation. To evaluate the antibody response to CMV in the group of donors from whom we obtained paired biopsy specimens (Table 1), we assessed the presence of IgG to viral proteins with serological assays. Twenty-three of these paired biopsy specimens were also examined by immunofluorescence confocal microscopy. With one exception, the donors were seropositive with a range of neutralizing activity, as shown by our evaluation of IgG purified from the conditioned medium of biopsy specimens. Ten women had low neutralizing titers (0 to 32%), nine had moderate titers (43 to 67%), and four had high titers (70 to 98%).
Decidual cells and invasive cytotrophoblasts express CMV proteins in specific patterns. First, we used immunofluorescence confocal microscopy to determine whether the presence of CMV DNA correlated with expression of proteins from infected cells at the decidual-placental interface during the first trimester. Decidual biopsy samples from 23 paired specimens were incubated with a pool of monoclonal antibodies to CMV-infected cell proteins, indicative of viral replication, and with antisera to gB, an abundant virion envelope glycoprotein and neutralization target. Antibodies to cytokeratin (a marker for uterine glandular epithelial cells and invasive placental cytotrophoblasts) and immune cell markers were used for costaining.
Staining revealed islands of infected cells among much larger uninfected areas. Extensive analysis indicated several common staining patterns. For example, we detected CMV-infected cell proteins in the nuclei and cytoplasm in endometrial glandular epithelial cells (Fig. 2A, a to c), endovascular cytotrophoblasts (Fig. 2A, d to f) and resident decidual cells that stained brightly (Fig. 2A, g to i). Endothelial cells in unmodified uterine blood vessels also stained (Fig. 2A, j to l). These data indicate that CMV infects a diverse population of resident maternal cells within the uterine wall and fetal invasive cytotrophoblasts.
![]() ![]() View larger version (186K): [in a new window] |
FIG.2. CMV
replicates in diverse cell types in maternal uterine decidua.
(A) CMV infects endometrial glands (GLD), uterine blood
vessels (BV), resident decidual cells (DecC) and cytotrophoblasts (CTB)
in the decidua. a to c, Decidual biopsy specimens stained for
CMV-infected cell proteins (ICP, green) and cytokeratin (CK, red) in
epithelial cells (EpC). d to i, CMV-infected interstitial and
endovascular CTB and DecC. j to l, Endothelial cells (EnC) and smooth
muscle cells (SMC) of uterine blood vessels (BV) are infected. Merged,
colocalized proteins (yellow). Large arrowheads, insets. (B)
Abundant innate immune cells infiltrating the decidua contain CMV
proteins. a to c, CMV gB (green), macrophages (M /DC, CD68,
red). d to f, DC-SIGN-positive (green) macrophage/dendritic cells
(M /DC) take up CMV gB (red). g and h, CD56-positive (green)
natural killer (NK) cells each target infection sites. i,
DC-SIGN-positive cells containing gB. j to l, Neutrophils (PMN) with
phagocytosed proteins from virus-infected cells and endothelial cells
(EnC) positive for von Willebrand factor (vWF) in blood vessels (BV).
Merged, colocalized proteins (yellow). Large arrowheads,
insets.
|
/DC) also stained for
dendritic cell ICAM-3-grabbing nonintegrin (DC-SIGN)
(24,
61) and contained
gB-positive cytoplasmic vesicles (Fig.
2B, d to f). In contrast
to CD68 staining, DC-SIGN and gB did not colocalize, suggesting they
were in different compartments (Fig.
2B, f). Natural killer
(NK) cells (CD56+) were often dispersed among
M
/DC that were filled with gB-positive vesicles (Fig.
2B, g). Occasionally,
striking numbers of NK cells and M
/DC were found together
(Fig. 2B, h and i).
Additionally, neutrophils were associated with uterine blood vessels
located near endothelial cells positive for von Willebrand factor (vWF)
and decidual cells that expressed CMV-infected cell proteins,
suggesting phagocytosis (Fig.
2B, j to
l). Patterns of CMV-infected cell proteins in decidual samples, mirrored in adjacent placentas. Next, we analyzed CMV proteins in paired decidual and placental biopsy specimens and found three staining patterns. In the first, islands in both decidual and placental compartments stained strongly for expression of CMV-infected cell proteins. This pattern predominated in samples from five donors with low neutralizing titers and one with intermediate neutralizing titer, three of which contained other pathogens. In the decidua, cytokeratin-positive glandular epithelial cells (Fig. 3A, a to c), endovascular cytotrophoblasts in remodeled uterine blood vessels, and interstitial cytotrophoblasts were sometimes positive (Fig. 3A, d to f). Strikingly, IGFBP-1-positive resident decidual cells strongly stained for viral proteins, suggesting that these cells were permissive for viral replication (Fig. 3A, g to i).
![]() ![]() ![]() View larger version (251K): [in a new window] |
FIG. 3. Extensive
CMV replication in maternal decidua correlates with transmission of
infection to the placenta. (A) a to c, CMV-infected cell
proteins (green) expressed in cytokeratin (CK, red)-stained epithelial
cells (EpC) in endometrial glands (GLD). d to f, CK-stained
endovascular cytotrophoblasts (CTB) in blood vessels (BV) and
interstitial CTB infiltrating the decidua (insets). g to i, Decidual
cells (DecC) expressing IGFBP-1 (red). Merged, colocalized proteins
(yellow). Large arrowheads, insets. (B) a to c,
Syncytiotrophoblasts (STB) and cytotrophoblast (CTB) stem cells
expressing CMV-infected cell proteins (ICP, green) and abundant
gB-containing vesicles (red) on the villus surface. d to f, Infected
endothelial cells (EnC) in fetal capillaries (FCap) and fibroblasts in
the villus core (VC). g to i, CMV proteins expressed in
differentiating/invasive cytotrophoblast cell columns (CC). Macrophages
contain cytoplasmic vesicles with infected cell membranes (arrows).
Large arrowheads, insets. (C) Schematic that illustrates and
summarizes the pattern of CMV protein expression in the decidua that
was associated with transmission of infection to the placenta.
CMV-infected cells (red) and gB-containing vesicles (red) in
M /DC at the placental-decidual interface. Islands of infected
cells were present in endometrial glands, uterine blood vessels and
invasive cytotrophoblasts, suggesting extensive decidual infection. CMV
infection was transmitted to portions of the adjacent placenta, as
indicated by widespread expression of replication proteins by
trophoblasts and fetal capillaries. Some M /DC contained
cytoplasmic vesicles with these proteins, suggesting phagocytosis
without productive
infection.
|
/DC (Hofbauer cells) within the villus stromal cores
contained infected cell proteins in cytoplasmic vesicles but not in the
nuclei, suggesting phagocytosis. Figure
3C illustrates and
summarizes the pattern of CMV protein expression in the decidua that
was associated with transmission of infection to the placenta in these
cases.
In the second group of paired biopsy specimens, the number
of cells that stained for CMV-infected cell proteins was reduced in the
decidua, and occasional focal infection was found in the placenta. This
pattern predominated in samples from seven donors with low to
intermediate neutralizing titers, five of which contained other
pathogens. In the decidua, we detected CMV replication in some
glandular epithelial cells and decidual cells (Fig.
4A, a to f). In the interstitium, M
/DC were abundant throughout,
especially near infected glands and blood vessels, and contained
gB-positive cytoplasmic vesicles but were not infected (Fig.
4A, d to i). Three of the
adjacent placentas contained small clusters of cytotrophoblast
progenitor cells underlying syncytiotrophoblasts that expressed
CMV-infected cell proteins (Fig.
4A, j to l). Isolated
gB-containing vesicles were present in syncytiotrophoblasts (Fig.
4A, j to l). In the villus
core, M
/DC containing CMV gB-positive vesicles were often
observed (Fig. 4A, j to
l). In other placental biopsies, only gB-containing vesicles were
detected in syncytiotrophoblasts and villus core M
/DC without
infection.
![]() ![]() ![]() View larger version (260K): [in a new window] |
FIG.4. Moderate
CMV infection in the decidua is mirrored by the adjacent placenta and
often associated with the presence of bacteria in women with moderate
neutralizing titers. (A) a to c, CMV-infected cell proteins
expressed in decidual cells. d to f, Selected glandular epithelial
cells are infected, and M /DC internalize CMV gB. g to i,
Uninfected M /DC accumulate CMV gB-positive vesicles. j to l,
Placental specimen containing a focus of cytotrophoblast (CTB)
progenitor cells expressing infected cell proteins. Uninfected
M /DC with phagocytosed virion protein are present in the
villus core adjacent to a large, uninfected fetal capillary (FCap).
Large white and black arrowheads, insets. B, a to c, Placenta that
contains many gB-staining vesicles in syncytiotrophoblasts but does not
contain cells that express virus-infected cell proteins. g to i, CMV
gB-staining vesicles at the apical membrane of STB overlying
CK-positive CTB progenitor cells. Villus core M /DC contain
gB-positive vesicles. d to f, CMV gB in vesicles that costain with
maternal IgG. Selected villus core M /DC take up IgG and gB in
some costaining vesicles. (C) Schematic that illustrates and
summarizes moderate infection at the placental-decidual interface:
CMV-infected cells (red) and gB-containing vesicles (red) in
M /DC.
|
/DC, gB accumulated in large cytoplasmic vesicles (Fig.
4B, b and c). When
placentas were stained for IgG, many positive vesicles were found in
syncytiotrophoblasts (Fig.
4B, g to i). Close
inspection revealed that gB colocalized with a small subset of
IgG-positive vesicles (Fig.
4B, g to i, inset). In
villus core M
/DC, some gB-staining vesicles colocalized with
the more abundant IgG-positive vesicles. We also found neonatal Fc
receptor-positive vesicles at the apical and basolateral membranes,
suggesting IgG transcytosis in first-trimester syncytiotrophoblasts
(not shown) (58). Figure
4C illustrates and
summarizes the focal pattern of reduced and/or suppressed CMV infection
found at the placental-decidual interface.
Biopsy specimens with
different staining patterns were also examined by with electron
microscopy and fluorescence in situ hybridization (Fig.
5). In decidual samples with reduced infection, neutrophils that stained
for CMV proteins were present (Fig.
5, a). In the adjacent
placenta, vesicular gB staining was found in syncytiotrophoblasts and
uninfected villus core M
/DC (Fig.
5, b). In five placental
biopsy specimens with this pattern, viral nucleocapsids were found in
syncytiotrophoblasts (Fig.
5, c and d). In three
decidual biopsies with islands expressing CMV-infected cell proteins
(Fig. 5, e) and the
adjacent placenta (Fig. 5,
f), in situ hybridization confirmed the presence of early CMV
transcripts in cytotrophoblast progenitor cells and villus core
fibroblasts and M
/DC (Fig.
5, g). A positive control
showed similar hybridization (not shown), whereas a negative control
probe failed to react (Fig.
5, h). These results
suggest that placentas with gB-staining vesicles in
syncytiotrophoblasts also contain nucleocapsids and that viral
transcripts are present in placentas that express infected cell
proteins.
![]() View larger version (76K): [in a new window] |
FIG. 5. CMV
virion uptake and replication in the placenta. a, Decidua expressing
CMV-infected cell proteins (ICP). b, Adjoining placenta with CMV
gB-stained vesicles in syncytiotrophoblasts (STB) and M /DC in
the villus core. c and d, Electron micrographs of placenta showing CMV
virion capsids clustered near the apical (AP) surface of the STB
membrane. e, Decidua expressing CMV proteins in decidual cells and
uterine blood vessels (BV). f, Placenta contains infected CTB
progenitor cells and infected fetal capillaries (FCap). g and h,
Fluorescence in situ hybridization showing CMV-specific probe and
negative control in reactions with CMV early RNA transcripts in
trophoblast layers of the placenta surface and M /DC in the
villus core. White arrowheads,
inset.
|
|
|
|---|
/DC in different organs, suggesting that
cells that clear infection could be associated with pathogenesis
(7,
20,
21). We showed that CMV
and bacterial pathogens are commonly present at the maternal-fetal
interface, one possible explanation for why pregnant women shed virus
from the cervix (5,
56,
62). Bacteria were often
found in donors with intermediate to high neutralizing titers whose
uninfected placentas contained virion proteins; this suggests that
limited CMV replication in the decidua could create a
reservoir.
Reactivation from decidual M
/DC might occur
as a consequence of inflammatory responses to bacteria and could depend
on the number of latently infected M
/DC infiltrating the
uterus. Placentas from healthy pregnant donors contained isolated areas
of infection that were a small part of the whole tissue. Since these
pregnancies were normal, placental infection that leads to transmission
likely involves the decidual and placental components that stained for
infected cell proteins, i.e., an exacerbation of the situation found in
those donors with the lowest neutralizing titers and some with
intermediate titers and bacterial pathogens at the uterine-placental
interface.
Coordinated innate and adaptive immune responses suppressed CMV infection of the placenta in women with intermediate to high neutralizing titers, one explanation for a correlation between high-avidity IgG and protection against vertical transmission (1, 52). The most remarkable result is that healthy women with uncomplicated pregnancies may have infected decidual cells. Virion-IgG complexes may be transported to the placenta without infection, a process that demonstrates the efficacy of innate and adaptive immunity. CMV infection of the decidua is a novel paradigm and further illustrates how this virus utilizes host immunity (39) by exploiting maternal hyporesponsiveness.
Pathogen-associated pattern
receptors on innate immune cells could recognize diverse pathogens at
the maternal-fetal interface. M
/DC attracted to the decidua by
the specialized environment created by hormonal changes
(11,
24,
50,
64) might carry pathogens
from the infected genital and cervical mucosa
(8,
47,
68). Like the capture of
human immunodeficiency virus by DC-SIGN-positive DC
(17), CMV virions are
internalized via DC-SIGN interaction with gB
(19). The striking
concentration of CMV gB in endocytic vesicles and strong DC-SIGN
expression by M
/DC indicate a central role in virion clearance
at the placental-decidual interface.
Recently we discovered that
villus core M
/DC take up CMV virions within 60 min after
infection in vitro (unpublished observation). This extraordinary
process could occur in utero and involve sampling of virions and/or
IgG-virion complexes across tight junctions of cytotrophoblast
progenitor cells, comparable to DC penetration of gut epithelial cell
monolayers to sample bacteria
(51). Like bacteria, CMV
virions may interact with Toll-like receptors that initiate
inflammatory responses to invading pathogens via the interferon
(IFN)-
/ß pathways
(6,
22,
23). Moreover, HSV binds
the mannose receptor that upregulates IFN-
produced
by plasmacytoid dendritic cells
(38,
55,
57). Finally, ligation of
IgG-virion complexes to the Fc-gamma I receptor on M
could remove opsonized virions, suppress proinflammatory
responses and reduce the spread of infection
(65).
In healthy
adults, CMV reactivation is controlled predominantly by T cells
(12), which are
underrepresented in the decidual leukocyte population in pregnant women
(11,
54,
64). The cytokine milieu
also diminishes adaptive responses to pathogens, presenting an
opportunity for viral infection and/or bacterial colonization
(53). In the present
study, M
/DC contained virion proteins, suggesting that they
were in an immature state characterized by antigen uptake
(3)-one reason why
CMV replication that occurs in mature M
/DC was not detected
(18,
60). Regardless, CMV can
infect decidual cells of immune women, suggesting that interruption of
IFN-
signal transduction pathways can occur under certain
conditions (37).
Understanding the molecular mechanisms that repress infection in the
microenvironment at the maternal-fetal interface could generate novel
antiviral therapies for pregnancy and organ
transplantation.
FIG. 2.FIG. 2Continued.
This work was supported by Public Health Service grants AI46657, AI53782 (L.P. and S.F.), EY13683 (L.P.), and HD30367 (S.F.) from the National Institutes of Health, grants from the March of Dimes Birth Defects Foundation and the University of California Academic Senate (L.P. and S.F.), and a gift from GlaxoSmithKline.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»