JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trego, K. S.
Right arrow Articles by Parris, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trego, K. S.
Right arrow Articles by Parris, D. S.
Journal of Virology, December 2003, p. 12646-12659, Vol. 77, No. 23
0022-538X/03/$08.00+0     DOI: 10.1128/JVI.77.23.12646-12659.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Functional Interaction between the Herpes Simplex Virus Type 1 Polymerase Processivity Factor and Origin-Binding Proteins: Enhancement of UL9 Helicase Activity

Kelly S. Trego1 and Deborah S. Parris1,2*

Department of Molecular Genetics,1 Department of Molecular Virology, Immunology, and Medical Genetics, Ohio State University, Columbus, Ohio 432102

Received 17 April 2003/ Accepted 25 August 2003


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The origin (ori)-binding protein of herpes simplex virus type 1 (HSV-1), encoded by the UL9 open reading frame, has been shown to physically interact with a number of cellular and viral proteins, including three HSV-1 proteins (ICP8, UL42, and UL8) essential for ori-dependent DNA replication. In this report, it is demonstrated for the first time that the DNA polymerase processivity factor, UL42 protein, provides accessory function to the UL9 protein by enhancing the 3'-to-5' helicase activity of UL9 on partially duplex nonspecific DNA substrates. UL42 fails to enhance the unwinding activity of a noncognate helicase, suggesting that enhancement of unwinding requires the physical interaction between UL42 and UL9. UL42 increases the steady-state rate for unwinding a 23/38-mer by UL9, but only at limiting UL9 concentrations, consistent with a role in increasing the affinity of UL9 for DNA. Optimum enhancement of unwinding was observed at UL42/UL9 molecular ratios of 4:1, although enhancement was reduced when high UL42/DNA ratios were present. Under the assay conditions employed, UL42 did not alter the rate constant for dissociation of UL9 from the DNA substrate. UL42 also did not significantly reduce the lag period which was observed following the addition of UL9 to DNA, regardless of whether UL42 was added to DNA prior to or at the same time as UL9. Moreover, addition of UL42 to ongoing unwinding reactions increased the steady-state rate for unwinding, but only after a 10- to 15-min lag period. Thus, the increased affinity of UL9 for DNA most likely is the result of an increase in the rate constant for binding of UL9 to DNA, and it explains why helicase enhancement is observed only at subsaturating concentrations of UL9 with respect to DNA. In contrast, ICP8 enhances unwinding at both saturating and subsaturating UL9 concentrations and reduces or eliminates the lag period. The different means by which ICP8 and UL42 enhance the ability of UL9 to unwind DNA suggest that these two members of the presumed functional replisome may act synergistically on UL9 to effect initiation of HSV-1 DNA replication in vivo.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Seven proteins encoded by herpes simplex virus type 1 (HSV-1) have been shown to be required for origin (ori)-dependent DNA synthesis (reviewed in reference 9). These proteins include an ori-binding protein, a single-stranded (ss) DNA binding protein, a heterotrimeric helicase-primase complex, and a heterodimeric processive DNA polymerase. The product of the UL9 gene is an 851-amino-acid (aa) multifunctional protein which is capable of sequence-specific binding to ori-containing DNA (14, 32) and is presumably involved in the initiation of HSV-1 DNA synthesis from these essential cis-acting sequences. In addition to its ori-specific DNA binding ability, UL9 protein (hereafter referred to as UL9) possesses DNA-dependent ATPase and 3'-to-5' helicase activities (10, 15). Mutational analysis of conserved domains associated with these activities suggests that they are essential for productive viral DNA replication (reviewed in reference 27).

As expected for a protein involved in initiation of DNA synthesis, UL9 interacts physically with a number of the other viral proteins required for ori-dependent DNA replication, including the major ss DNA binding protein (infected cell protein 8 [ICP8]), the noncatalytic component (UL8) of the heterotrimeric helicase-primase complex, and the DNA polymerase processivity factor (UL42) (6, 28, 30). The specific interactions of these proteins with UL9 may facilitate the correct assembly of the DNA replisome at or close to defined ori sequences on the HSV-1 genome. Alternatively, they may modify one or more activities of UL9 to enable efficient initiation of DNA replication, such as the formation of an open complex at ori's, or to facilitate transition from initiation of DNA synthesis to elongation of DNA. Defining the functions of the interactions of the partner proteins with UL9 should contribute to a better understanding of the mechanism of and requirements for initiation of HSV-1 DNA synthesis.

The best characterized of UL9 protein-protein interactions is that observed with ICP8 (6). ICP8 increases the ATPase activity of UL9 on nonspecific DNA substrates and on substrates that contain all or part of the HSV-1 ori (2, 13, 18, 34). The helicase activity of UL9, which is dependent on functional ATPase activity, is also stimulated by ICP8 (7, 15, 25). The C-terminal 27 aa residues of UL9 are essential for ICP8 binding, and binding of ICP8 to this region or removal of the C terminus of UL9 has been shown to enhance the helicase activity of UL9 on non-ori-containing DNA substrates (6, 25). Moreover, although UL9 alone or together with ICP8 cannot unwind blunt duplex DNA containing only the high-affinity binding site, box I (21), evidence for UL9 unwinding of minimal ori sequences in the presence, but not in the absence, of ICP8 has been reported (3, 17, 21, 26). Although the complete mechanism by which ICP8 modulates UL9 activities has not been elucidated, ICP8 increases the rate and amount of DNA which can be unwound by UL9 and also enhances the processivity of the 3'-to-5' helicase activity (5, 7, 15, 25). Interestingly, the ss DNA binding activity of ICP8 is not required for the enhancement of UL9 helicase activity in vitro, although it may play an important role in initiation in vivo (1).

The protein encoded by UL8, which forms a 1:1:1 stable heterotrimer with UL5 and UL52 proteins to form a helicase-primase complex (11), interacts physically with the N-terminal 535 aa residues of UL9 (28). Although a precise function for the interaction of UL8 protein with UL9 has not been described, the physical interaction could serve to allow the entry of the helicase-primase complex into open complexes formed by the action of UL9 at ori sequences.

Work from our laboratory has demonstrated a physical interaction between UL9 and the DNA polymerase processivity factor, UL42 (30). UL9 and UL42, expressed in cells infected with recombinant baculoviruses containing these genes, could be coimmunoprecipitated with specific antibodies to either UL9 or UL42. Moreover, UL9 translated in vitro in rabbit reticulocyte lysates was found to bind to affinity columns containing glutathione S-transferase (GST)-UL42 fusion protein expressed in Escherichia coli, but not to columns containing GST alone. Results also demonstrated that the N-terminal 533 aa residues of UL9, essential for helicase activity, were sufficient for interaction with GST-UL42. In that report, it was hypothesized that the interaction of UL42 with UL9 might serve as a bridging function to allow the entry of the DNA polymerase holoenzyme into the initiation complex. However, it is also possible that UL42, similar to findings with ICP8, could enhance or modify one or more enzymatic activities or functions of UL9. In this report, we demonstrate for the first time that UL42 enhances the helicase activity of UL9 on nonspecific DNA substrates and describe experiments which begin to address the mechanism by which it does so.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Growth of Sf9 cells and preparation of infected-cell extracts. UL9, UL42, and ICP8 proteins were purified from Sf9 insect cells infected with recombinant baculovirus (Autographica californica), which expresses the respective HSV-1 genes from the polyhedrin promoter. Sf9 cells were propagated at 27°C in TNM-FH insect medium (Invitrogen, Carlsbad, Calif.) supplemented with 100 U of penicillin per ml, 100 µg of streptomycin sulfate per ml, and 10% fetal bovine serum. Twenty 150-cm2 flasks containing subconfluent monolayers of Sf9 cells (2 x 107 cells per flask) were infected with recombinant baculovirus at an input multiplicity of 5 PFU per cell and incubated at 27°C for 44 h (for UL42) or 72 h (for UL9 or ICP8). Dislodged cells in the medium were collected by low-speed centrifugation and suspended in 4°C hypotonic buffer containing 10 mM Tris-Cl (pH 7.4), 10 mM NaCl, and 3 mM MgCl2. The cytoplasm was separated from nuclei by Dounce homogenization using five strokes of a tight-fitting pestle, followed by centrifugation at 2,000 x g. The nuclear pellet was suspended in 20 ml of lysis buffer. Lysis buffer A for nuclei from which ICP8 or UL9 was prepared contained 20 mM HEPES (pH 7.6), 1 M NaCl, 25% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, and 2 mM 2-mercaptoethanol. For the preparation of UL42 protein, lysis buffer B, containing 10 mM Tris-Cl (pH 8.2), 1 M NaCl, 3.5 mM EDTA, and 1 mM 2-mercaptoethanol, was used. After 30 min of gentle mixing at 4°C, the soluble fractions were collected following ultracentrifugation at 70,000 x g for 30 min at 4°C and were stored at -80°C.

Purification of UL9. The purification of UL9 was monitored by applying portions of column fractions to nitrocellulose filters and probing with polyclonal antibody RH-7 to UL9 (gift of Dan Tenney and Robert Hamatake, Bristol-Myers Squibb). The RH-7 antibody and immunoblotting procedure have been described previously (30). In most cases fractions were also monitored for the presence of DNA-dependent ATPase activity by the malachite green-ammonium molybdate colorimetric assay of Lanzetta and coworkers (20) essentially as described by Dodson and Lehman (13), except that denatured salmon sperm DNA (40 µg/ml) was included in each reaction. The UL9-containing nuclear extract (20 ml) was diluted 1:4 in ice-cold buffer V (20 mM HEPES [pH 7.6], 1 mM EDTA, 10% glycerol) to achieve a final salt concentration of 0.25 M NaCl and centrifuged at 4°C for 10 min at 25,000 x g to remove particulates. The clarified extract was applied to two tandemly assembled prepacked 5-ml Hi-Trap heparin columns (Amersham Biosciences, Piscataway, N.J.) equilibrated in buffer V containing 0.25 M NaCl. The column was washed with 50 ml of the same buffer, and proteins were eluted with a 70-ml linear salt gradient from 0.25 to 1.3 M NaCl in buffer V. Peak fractions of UL9 eluted between 600 and 800 mM NaCl and were pooled and applied to a 5-ml column of ceramic hydroxyapatite HTP type II (Bio-Rad, Hercules, Calif.) equilibrated in buffer D (10 mM Na2HPO4 [pH 7.0], 10% glycerol) containing 0.15 M NaCl. The unbound fraction contained UL9 and was dialyzed against buffer V, 0.25 M NaCl, and applied to a 10-ml cellulose phosphate P11 column (Whatman, Clifton, N.J.) equilibrated in the same buffer. The column was washed with 40 ml of buffer V, 0.25 M NaCl, and proteins were eluted with a 60-ml linear salt gradient from 0.25 to 1 M NaCl in buffer V. UL9 eluted between 450 and 510 mM NaCl. The purity of UL9-containing fractions was judged to be >95% by comparison of total protein concentration, determined using a commercial dye-based assay (Bio-Rad), to the protein content estimated from separated polypeptides on Coomassie blue-stained sodium dodecyl sulfate-polyacrylamide gels using bovine serum albumin (BSA) standards. The high purity was also demonstrated by the absence of contaminating polypeptides on silver-stained gels (Fig. 1).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1. Purity of protein preparations. Proteins were purified from nuclei of insect cells infected with recombinant baculoviruses by column chromatography as described in Materials and Methods. Representative preparations of UL42 (lane 1), UL9 (lane 2), or ICP8 (lane 3) proteins were subjected to electrophoresis through a denaturing gradient (5 to 15%) polyacrylamide gel followed by silver staining. The silver reagent differentially stains the three proteins such that intensity is not directly proportional to protein amount. For this gel, different amounts of the UL42, UL9, and ICP8 proteins were loaded (3, 2, and 1 µg, respectively) to obtain comparable staining intensities. Preparations were estimated to be at least 95% pure as described in Materials and Methods.

 
Purification of UL42. UL42 protein was purified as described previously (12), except that the Blue Sepharose column was replaced with two linked 5-ml prepacked HiTrap Blue columns (Amersham Biosciences, Piscataway, N.J.). UL42 eluted from the HiTrap Blue column between 1.5 and 2 M KCl. After the final Q-Sepharose column, the preparation was concentrated by ultrafiltration using a Centricon 30 (Amicon, Bedford, Mass.) and stored in buffer V, 0.3 M NaCl, at 4°C. Protein concentration and purity were assessed as indicated above for UL9 (Fig. 1).

Purification of ICP8 protein. The procedure used was based on that reported by Boehmer and Lehman (8). The presence of ICP8 in fractions was monitored by immunoblotting against mouse monoclonal antibody 39S specific for ICP8 (gift of Martin Zweig, National Institutes of Health). Briefly, ICP8-containing nuclear extract was dialyzed against buffer V, 0.1 M NaCl, and clarified by centrifugation at 4°C for 10 min at 25,000 x g. The dialyzed extract was applied to two tandemly linked 5-ml HiTrap heparin columns equilibrated in buffer V, 0.1 M NaCl. The column was washed with 30 ml of the same buffer, and protein was eluted with a 50-ml linear salt gradient from 100 to 750 mM NaCl in buffer V. Peak fractions of ICP8, which eluted between 275 and 375 mM NaCl, were pooled and applied directly to a 4.5-ml hydroxyapatite column (Macroprep ceramic hydroxyapatite HTP type I; Bio-Rad) equilibrated in buffer D containing 0.1 M NaCl. The column was washed with 40 ml of buffer D, 0.1 M NaCl, and ICP8 was eluted using a 50-ml linear gradient of Na2HPO4 (10 to 200 mM) in buffer D, 0.1 M NaCl. Fractions containing ICP8 eluted from 60 to 80 mM Na2HPO4 and were pooled, dialyzed against buffer V, 0.1 M NaCl, and applied to a 10-ml Q-Sepharose column equilibrated in the same buffer. The column was washed with 40 ml of equilibration buffer, and bound proteins were eluted with a 40-ml linear salt gradient from 100 to 750 mM NaCl in buffer V. The peak ICP8-containing fractions eluted between 400 and 450 mM NaCl and were combined and stored at 4°C. Protein concentration and purity were estimated as described above (Fig. 1).

Preparation of DNA substrates for helicase assays. All synthetic oligonucleotides were purchased as gel-purified products from Integrated DNA Technologies, Inc. (Coralville, Iowa). The helicase substrate was adapted from one previously utilized (35) and consisted of a 23-mer top strand annealed to a 38-mer bottom strand to yield a partially double-stranded (ds) DNA substrate with a 15-nucleotide 3' ss overhang (Fig. 2 and 3A). The 23-mer (top) DNA was labeled at the 5' end with [{gamma}-32P]ATP using T4 polynucleotide kinase according to the instructions of the manufacturer (Invitrogen), and unincorporated nucleotide was removed using spin column chromatography (Microspin G-25; Amersham Biosciences). To ensure the absence of free labeled ss DNA, the partially ds DNA helicase substrate was prepared by mixing the labeled 23-mer DNA with 38-mer DNA (1:2 molar ratio) in buffer containing 10 mM HEPES (pH 7.6), 50 mM NaCl, 5% glycerol, heating to 50°C for 3 min, and slowly cooling to room temperature. Annealed substrate (5 x 105 to 70 x 105 dpm/pmol) was stored at 4°C. For some experiments, a cold-competitor helicase substrate was added after reactions were initiated to trap dissociated UL9. The competitor helicase substrate contained a 45-mer top strand (5' GGCTCAGGATGCTCAGGAGGTGGGAGGACAGGAGGACAGGCGTCG) annealed to a 60-mer bottom strand (5' CGACGCCTGTCCTCCTGTCCTCCCACCTCCTGAGCATCCTGAGCCTTTTTTTTTTTTTTT) as described above to provide a 15-nucleotide 3' ss overhang.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 2. Working model for translocation and unwinding by UL9. (A) The individual steps that are proposed to catalyze the ATP-dependent unidirectional translocation of UL9 on the partially duplex helicase substrate are shown together with the rate constants which control them (see text for description of model). Translocation of single UL9 molecules (homodimers) does not result in complete unwinding due to reannealing of the strands behind the UL9. (B) Complete unwinding is a multistep process which requires high UL9/DNA stoichiometries to prevent or reduce reannealing.

 


View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Helicase activity of purified UL9 protein. (A) The DNA substrate consisted of a 32P-end-labeled 23-mer annealed to a 38-mer to provide a 3' ss DNA tail for loading UL9. (B and C) Increasing concentrations of UL9 (0.8 to 100 nM) were incubated in triplicate with the 23/38-mer substrate (0.5 nM) for 20 min at 37°C as described in Materials and Methods, and the products were separated by electrophoresis through 12% nondenaturing polyacrylamide gels. Autoradiograms of gels are shown (B). The substrate was denatured by heating to 95°C for 5 min ({Delta}), retained on ice (S), or incubated at 37°C with the indicated final concentrations of UL9. Gels were also exposed to phosphor storage screens, and the concentration of free (unwound) 23-mer was quantified using a Molecular Dynamics PhosphorImager and ImageQuant software as described in Materials and Methods and plotted as a function of UL9 concentration (C). The data points shown represent the mean values ± standard deviations of three independent replicates and were fit to the Hill equation (equation 2) with coefficients of 1 (solid line), 2 (long dashed line), or 3 (short broken line). The inset graph expands the portion of the data associated with low concentrations of UL9. The curve fit to a Hill coefficient of 2 estimated an apparent Kd of 9.6 ± 0.8 nM, while the fit using a Hill coefficient of 3.0 was the best fit for the data and estimated an apparent Kd of 9.3 ± 0.4 nM.

 
Helicase assays. The assay used was a modification of one previously described (7). Reactions (80 µl) were performed at 37°C for the times indicated in buffer containing 50 mM hydroxyethylpiperazinepropanesulfonic acid (pH 8.6), 25 mM NaCl, 2.5 mM MgCl2, 3 mM ATP, 5 mM dithiothreitol, 10% glycerol, 8% dimethyl sulfoxide, and 0.1 mg of BSA/ml. Reactions contained 0.5 nM labeled 23/38-mer DNA substrate and 5 nM (10-fold excess) unlabeled 23-mer to trap unwound DNA. Immediately prior to initiation of reactions, UL9 was incubated without or with accessory protein (UL42 or ICP8) for 10 min at room temperature to facilitate complex formation, followed by dilution to achieve the concentration specified in each experiment. Except as noted otherwise, reactions were initiated by the addition of UL9 or a mixture of UL9 and accessory protein. For some experiments as indicated, UL9, with or without accessory protein, was preincubated with the labeled DNA substrate in reaction buffer containing 2.5 mM EDTA, and reactions were initiated by the addition of MgCl2 to 6 mM, 5 nM unlabeled 23-mer ss DNA trap, and accessory protein, where indicated. Control reactions with the hepatitis C virus NS3 helicase domain protein (NS3h; kind gift of Smita Patel, Robert Wood Johnson Medical School) were performed by preincubating NS3h with 2 nM DNA substrate in reaction buffer containing 20 mM morpholinepropanesulfonic acid-NaOH (pH 7.0), 5 mM magnesium acetate, and 1 mg of BSA/ml. Reactions were initiated by the addition 5 mM ATP, 20 nM unlabeled 23-mer, with or without 50 nM UL42 (final concentrations), and were performed at 23.5°C. All helicase reactions were terminated with 15 mM EDTA (pH 8.0), 1% sodium dodecyl sulfate, 5% glycerol, 0.04% bromophenyl blue, and 0.04% xylene cyanol (final concentrations), and the products were immediately loaded onto native 12% polyacrylamide gels and separated by electrophoresis. Reaction products were quantified using a Molecular Dynamics PhosphorImager and ImageQuant software (Sunnyvale, Calif.). The amount of ss DNA released under condition n was determined as a fraction of total radioactivity in that lane, to normalize for loading error, and corrected for background presence of ss DNA in substrate (condition 0, no UL9) as follows:

(1)
Autoradiograms were also obtained by exposure of the gel to X-ray film (T-mat; Eastman Kodak, Rochester, N.Y.) at -80°C with an intensifying screen.

For determination of the apparent equilibrium dissociation constant (Kd) for the formation of productive complex of UL9 and DNA, the concentration of DNA unwound ([unwound]) after 20 min at 37°C was plotted as a function of monomeric UL9 concentration ([UL9]). The data were fit by a nonlinear method to the Hill equation (4, 31):

(2)
where Kd is the concentration of UL9 at which one-half of the maximum DNA unwinding ([unwound]max) was observed and n is the value of the Hill coefficient.

To determine the apparent dissociation rate constant, the concentration of DNA unwound ([unwound]) at the time of addition of the unlabeled helicase substrate was set to zero, and the increased concentration of labeled DNA substrate unwound thereafter was plotted as a function of time (t). The data were fit according to the following function:

(3)
where a is the maximum increase in concentration unwound, and k is the rate constant for dissociation of UL9 from the labeled helicase substrate.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Working model for unwinding of DNA by UL9. Although the HSV-1 DNA polymerase processivity factor, UL42, interacts physically with the ori-binding protein, UL9 (30), no functional interaction between the two proteins has been described. Because one function of UL9 thought to be important for initiation of viral DNA synthesis is the 3'-to-5' helicase activity, we wished to test the hypothesis that UL42 could modify or enhance the inherent ability of UL9 to unwind DNA and to determine the mechanism by which it did so. Unwinding of DNA by UL9 is a multistep process, and elucidation of the mechanism by which an accessory protein modifies the helicase activity of UL9 requires dissection of the steps involved. Although the complete mechanism by which any helicase unwinds DNA has not been defined to date, the process requires the unidirectional translocation of the helicase, driven by the hydrolysis of ATP, along a strand of DNA (reviewed in reference 24). To facilitate analysis, a working model was employed to describe the kinetic steps which are likely to occur to enable the UL9 protein to unwind a partially duplex DNA substrate (Fig. 2A) and is based on one previously described for the unwinding of DNA by the hexameric T7 helicase (19). UL9, which exists as a stable homodimer in solution, binds preferentially to ss DNA on DNA substrates that do not contain the high-affinity sequence-specific binding sites for UL9 found on functional ori's (25). Binding of UL9 to the ss 3' tail of the DNA substrate is reversible and is controlled by the rate constant for association, kon. Although the stoichiometry of the functional UL9 helicase moiety is not known, the substantial lag period observed following binding of UL9 to DNA but prior to ATP hydrolysis or unwinding is defined kinetically by the rate constant, kassembly, and has been interpreted as an assembly step (8, 13). Nevertheless, this apparently slow step could represent the rate by which a conformational change is conferred on UL9 to convert it to a functional helicase, as found for other helicases (24). Once the assembly and/or conformational change has occurred, UL9 is capable of translocating in the 3'-to-5' direction on the strand to which it is bound, and translocation is driven by the energy of hydrolysis of ATP, consistent with the ss DNA-dependent ATPase activity exhibited by UL9 (13, 15). As UL9 translocates along the bottom strand, it locally displaces the upper strand, but rapid reannealing behind a single UL9 helicase prevents complete unwinding of the DNA. On short DNA substrates, UL9 is likely to remain bound to the DNA until it dissociates from the end, controlled by the rate constant (kend), while on DNA molecules >60 nucleotides in length, dissociation is predominantly from internal sites (13) and is controlled by the dissociation rate constant (kd). To achieve complete unwinding, high UL9/DNA stoichiometries are required (7), presumably to allow the simultaneous translocation of multiple UL9 helicase moieties along a single DNA substrate (Fig. 2B). The helicase assays described below also include the presence of a 10-fold amount of unlabeled ss DNA (top strand) to prevent reannealing once the labeled DNA substrate is completely unwound. The presence of the ss DNA trap is expected to reduce the absolute steady-state rate for unwinding (compared to the theoretical rate in its absence), since UL9 can bind and translocate along the trap DNA as well as along the labeled DNA substrate. Therefore, all kinetic constants and rates reported herein are apparent. However, the actual step that limits the steady-state unwinding rate will not change, and comparison of apparent rates and constants is valid because all reactions are performed in the presence of the same excess DNA trap.

UL42 stimulation of UL9 helicase activity. Because UL9 has been shown to unwind DNA stoichiometrically (7), we determined the apparent equilibrium dissociation constant (Kd) for UL9 with DNA in order to elucidate concentrations of UL9 required to fully saturate the DNA substrate under our standard reaction conditions. Assays included 0.5 nM labeled 23/38-mer partially ds DNA substrate containing a 3' ss DNA overhang (Fig. 3A) and were performed in triplicate with increasing concentrations of UL9 ranging from 0.8 to 100 nM. Kinetic analysis revealed that rates of unwinding were increasing linearly by 20 min for all UL9 concentrations of >=1.6 nM (see below). Therefore, helicase reactions were terminated after 20 min at 37°C, and the reaction products were analyzed by electrophoresis through native polyacrylamide gels to separate unwound ss DNA from the annealed ds DNA substrate (Fig. 3B). Boiling denatured most but not all of the DNA substrate, and there was little ss DNA in the unreacted substrate or in reactions incubated at 37°C for 20 min in the absence of UL9. Substantial unwinding was not detected below a UL9 concentration of 3.13 nM, but unwinding was readily detectable at all other UL9 concentrations tested. The concentration of DNA unwound was determined by phosphorimaging analysis and plotted as a function of UL9 concentration (Fig. 3C). The data fit poorly to the Michaelis-Menten function (equation 2, with the Hill coefficient equal to 1), but fit well when the Hill coefficient was set from 2 to 3, in increments of 0.1 (4, 31). The curves shown in Fig. 3C represent the fits for Hill coefficients of 1, 2, and 3. The sigmoidal curve fits with Hill coefficients of 2 and 3 at low UL9 concentrations are shown in the inset to Fig. 3C and demonstrate that UL9 unwinds the DNA cooperatively. Cooperativity was also evident when the maximum steady-state rate for unwinding was plotted as a function of UL9 concentration (results not shown). Thus, cooperative action is predicted to occur among two or three subunits, presumably homodimers of UL9. Curve fits obtained with Hill coefficients of 2 or 3 (Fig. 3C) estimated virtually the same apparent equilibrium dissociation constant (Kd) for productive complex of UL9 with DNA. With a Hill coefficient of 2, the apparent Kd was 9.6 ± 0.8 nM, and for a coefficient of 3 it was 9.3 ± 0.4 nM. Similar values were obtained with multiple preparations of UL9. The data revealed that only 65% (~0.32 nM) of the DNA substrate was unwound after 20 min of incubation at saturating UL9 concentrations.

Because of the poor ability of UL9 to unwind DNA at low UL9/DNA ratios, a subsaturating concentration (below apparent Kd) of UL9 (3.13 nM) under standard assay conditions was initially selected to test the hypothesis that UL42 enhances UL9 helicase activity. In order to maximize the probability for complex formation between UL9 and UL42, a high concentration of UL9 (250 nM) was preincubated with different molar ratios of UL42 for 10 min, and the mixture was serially diluted just prior to initiation of helicase reactions to yield a final UL9 concentration of 3.13 nM and a partially duplex DNA substrate concentration of 0.5 nM. Figure 4 shows the results of assays terminated after 40 min at 37°C. Although a 1:2 UL42/UL9 ratio unwound slightly less DNA than 3.13 nM UL9 alone, increasing concentrations of UL42 stimulated the UL9 unwinding activity such that maximum helicase activity was observed with 12.5 nM UL42, equivalent to a 4:1 UL42/UL9 ratio (Fig. 4A). Reactions incubated for shorter (20 min) or longer (60 min) times at 37°C also demonstrated optimum enhancement of helicase activity in the presence of UL42 at a 4:1 ratio with respect to UL9, as did at least three independent preparations of UL42 (results not shown). Although helicase activity was enhanced above that observed with 3.13 nM UL9 alone at concentrations of UL42 up to 100 nM, the level of stimulation was reduced compared to the maximum observed with a 4:1 UL42/UL9 ratio (Fig. 4B). At even higher UL42 concentrations (200 nM), the unwinding activity of UL9 was reduced compared to that in the absence of UL42. Moreover, no significant unwinding of the DNA substrate was observed when incubated with up to 200 nM UL42 alone (results not shown). Enhancement of UL9 unwinding activity by UL42 was not due to a general protective effect of protein, since BSA did not significantly stimulate or inhibit UL9 helicase activity over the same wide concentration range (Fig. 4).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. Effect of UL42 on UL9 helicase activity. UL42 and UL9 proteins were incubated together at different ratios for 10 min at room temperature to allow for complex formation and diluted immediately prior to initiation of reactions to achieve a final UL9 concentration of 3.13 nM and the indicated concentrations of UL42 (•) or BSA ({blacksquare}). For controls containing no added UL42 protein, UL9 protein was similarly incubated alone at room temperature (0 nM UL42) or with BSA and diluted immediately prior to initiation of reactions. All reactions contained 0.5 nM 23/38mer and were initiated by the addition of preincubated UL9, UL9-UL42, or UL9-BSA mixes. Reactions were incubated at 37°C and terminated after 40 min by the addition of EDTA. The products were separated as described in the legend to Fig. 3, and the concentration of unwound 23-mer was plotted as a function of final UL42 or BSA protein concentration. (A) Reactions were initiated with UL9 and UL42 (0 to 25 nM) or with UL9 and BSA (12.5 nM). The data point for UL9 alone (3.13 nM) was the average of two independent reactions. (B) Reactions were initiated with 3.13 nM UL9 and a higher concentration range of UL42 (12.5 to 200 nM) or BSA (200 nM).

 
Enhancement of UL9 helicase activity by UL42 does not occur at saturating UL9 concentrations. To determine the effect of UL42 on both the rate and extent of unwinding by UL9, we performed detailed kinetic analysis of unwinding over a range of UL9 concentrations from subsaturating (below the Kd) to saturating (five times the Kd) with respect to the 0.5 nM labeled 23/38-mer DNA substrate (Fig. 5A and B, respectively). UL42 concentration was adjusted to a 4:1 ratio with respect to UL9 for low UL9 concentrations but was not allowed to exceed a concentration of 12.5 nM in reaction mixes (25:1 UL42/DNA ratio), since higher UL42/DNA ratios reduced the amount of stimulation of unwinding (Fig. 5B and results not shown). Figure 5A shows the kinetics of unwinding over a 90-min period at 3.13 nM UL9, representative of a subsaturating UL9 concentration, while Fig. 5B shows unwinding at 50 nM UL9, representative of a saturating UL9 concentration, in the absence or in the presence of 12.5 nM UL42. Little or no unwinding of the DNA substrate was observed following incubation at 37°C in the absence of protein or in the presence of 12.5 nM UL42 alone. At limiting UL9 concentration (3.13 nM), a lag of approximately 15 to 20 min was observed prior to a faster linear rate for unwinding the DNA, consistent with an assembly lag as suggested previously (7). Although the concentration of DNA unwound by UL9 in the presence of 12.5 nM UL42 was consistently higher than that observed with UL9 alone, those reactions containing UL9 and UL42 also displayed a lag of up to 20 min prior to reaching the maximum steady-state rate for unwinding (Fig. 5A). Between 20 and 60 min, the amount of DNA unwound increased linearly with respect to time in reactions containing 3.13 nM UL9 alone or with a 4/1 ratio of UL42 to UL9. Over this time frame, the apparent steady-state rate of unwinding by UL9 in the presence of UL42 was 5.15 ± 0.39 pM (molecules)/min, 2.5 times the rate of 2.08 ± 0.44 pM/min observed with 3.13 nM UL9 alone (Table 1). Significant enhancement of the steady-state rate of unwinding by UL9 was observed at two other concentrations of UL9 below the apparent Kd (Table 1). However, the relative enhancement in rate was not consistent, most likely due to the higher percentage of error associated with the low rate of unwinding with 1.56 nM UL9 and by our inability to use optimum UL42/UL9 ratios above UL9 concentrations of 3.13 nM.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5. Effect of UL42 on the kinetics of unwinding at subsaturating and saturating concentrations of UL9. Reactions were performed in bulk as described in the legend to Fig. 4, except that samples were removed at various times following initiation and terminated by the addition of EDTA. The concentration of unwound 23-mer was determined as described and plotted as a function of time. The data shown represent the mean values ± standard deviations from three independent experiments. (A) Unwinding with a subsaturating concentration (3.13 nM) of UL9 alone ({circ}), with 3.13 nM UL9 and 12.5 nM UL42 (•), with 12.5 nM UL42 alone ({triangleup}), or with no added protein ({square}). (B) Unwinding with a saturating (50 nM) concentration of UL9 alone ({circ}), with 50 nM UL9 and 12.5 nM UL42 (•), with 12.5 nM UL42 alone ({triangleup}), or with no added protein ({square}).

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Unwinding by UL9 with or without accessory proteins

 
At saturating UL9 concentrations (50 nM) with respect to the labeled DNA, the time associated with the assembly lag was reduced, compared with that observed at lower UL9 concentrations, under our standard assay conditions. Unwinding of the DNA increased in a linear fashion with respect to time from 5 to 20 min after initiation of reactions with UL9 alone (50 nM) or together with 12.5 nM UL42 (Fig. 5B). Although the apparent steady-state rate of unwinding by 50 nM UL9 was nine times faster than observed at the subsaturating concentration of 3.13 nM, no increase in the rate of unwinding was detected in the presence, compared to that in the absence, of UL42. Indeed, as observed in the experiments described above, the addition of 12.5 nM UL42 caused a slight reduction in the rate of unwinding by UL9 (Table 1; Fig. 5B). We also observed no difference in unwinding by a nearly saturating concentration of UL9 (25 nM) in the presence of an equimolar concentration of UL42 (results not shown), whereas an equimolar ratio of UL42 and UL9 at subsaturating UL9/DNA concentrations resulted in approximately a 50% increase in the amount of DNA unwound (Fig. 4A). Thus, UL42 increases the rate and amount of unwinding observed after 90 min of incubation at subsaturating UL9 concentrations but not at saturating ones.

Enhancement of helicase activity by UL42 is specific to UL9. Because UL42 is a ds DNA-binding protein (16), it was possible that UL42 enhanced unwinding at low UL9 concentrations by preventing nonproductive interactions of UL9 with the duplex portion of the DNA substrate. To rule out this possible mechanism, we tested the effect of UL42 on unwinding by a noncognate helicase, the hepatitis C virus (HCV) NS3h helicase domain protein. The HCV NS3h unwinds both DNA and RNA substrates by translocating in the 3'-to-5' direction (33). Because the NS3h helicase unwinds DNA at a faster rate than does UL9, a higher concentration of labeled DNA was used (2 nM) and reactions were initiated by the addition of ATP and a 10-fold concentration (20 nM) of ss DNA trap and terminated at intervals from 15 s to 10 min. Based on previously reported kinetics of unwinding as a function of NS3h concentration (23), we determined the effect of UL42 on the kinetics of unwinding by a concentration of NS3h expected to be subsaturating (6.25 nM) and by one expected to be at or close to saturating (50 nM) with respect to the 2 nM labeled DNA substrate (Fig. 6). Indeed, 6.25 nM NS3h was subsaturating under our standard assay conditions, as demonstrated by a linear rate for unwinding over the entire reaction period and by the fact that only 25% of the DNA substrate was unwound after 10 min. A concentration of 50 nM UL42 was selected in order to yield the same UL42/DNA ratio (25:1) as that which produced optimum stimulation of UL9 unwinding activity. The addition of this concentration of UL42, together with ss DNA trap and ATP at the time of initiation, had no effect on the kinetics of unwinding by 6.25 nM NS3h (Fig. 6). The higher concentration of NS3h (50 nM) unwound most of the DNA within the first 90 s (Fig. 6), and similar unwinding kinetics were observed with 25 nM NS3h (results not shown). However, even in the presence of 50 nM UL42, there was no change in the kinetics of unwinding. Thus, the enhancement by UL42 of the helicase activity of UL9 is specific for the cognate protein with which it forms a direct physical interaction.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 6. Effect of UL42 on unwinding by the HCV NS3 helicase domain protein. The labeled 23/38-mer DNA substrate (2 nM) was preincubated with subsaturating (6.25 nM; squares) or close-to-saturating (50 nM; circles) concentrations of HCV NS3h as described in Materials and Methods. Reactions were initiated by the addition of ATP and a 10-fold concentration (20 nM) of cold 23-mer (open symbols) or by the addition of UL42 (50 nM, final concentration) together with ATP and ss DNA (closed symbols) and were incubated at 23.5°C. Portions were removed at various times, and reactions were terminated by the addition of excess EDTA. Unwinding was quantified as described in the legend to Fig. 3 and plotted as a function of time.

 
UL42 differs from ICP8 in parameters associated with enhancement of UL9 helicase activity. ICP8, another essential HSV-1 DNA replication protein that specifically interacts with UL9, also has been shown to enhance the ability of UL9 to unwind DNA containing a 3' ss overhang (7, 25). To begin to assess whether UL42 and ICP8 enhance UL9 unwinding by similar or different mechanisms, we tested the effect of ICP8 on unwinding by subsaturating and saturating UL9 concentrations under our assay conditions. The stoichiometry of ICP8 to UL9 which produces optimum enhancement of unwinding by UL9 has been shown to be 1:1, but even much higher stoichiometries produce similar enhancement, provided that the ICP8 concentration is maintained below that required to coat 100% of the ss DNA in the reactions (5). Moreover, because ICP8 is an ATP-independent helix-destabilizing protein, levels of ICP8 need to be used which are unable to melt significant amounts of the DNA substrate. Control experiments revealed that in the absence of UL9, only small amounts (2.4%) of the substrate melted after 20 min with 12.5 nM ICP8, although larger amounts were melted with higher concentrations. We preincubated UL9 and ICP8 to drive complex formation and initiated reactions following dilution to achieve a UL9 concentration of 3.13 or 50 nM. When either a 4:1 (data not shown) or 2:1 ratio of ICP8 was used with a final UL9 concentration of 3.13 nM, we observed an enhancement in the rate and extent of UL9 unwinding at all times up to 90 min (Fig. 7A). However, the low but detectable level of melting of the DNA substrate by 12.5 nM ICP8 alone (0.63 pM/min), compared with the low level of unwinding by 3.13 nM UL9, complicated our interpretation of the results (Table 1). Therefore, Fig. 7A shows the results of triplicate unwinding reactions obtained with 6.25 nM ICP8 (a 2:1 ratio with respect to UL9). This concentration of ICP8 would be expected to drive complex formation with UL9 but unwind only small amounts of the DNA compared to reactions containing no added protein. The apparent steady-state rate of unwinding by 3.13 nM UL9 in the presence of ICP8 was 5.26 ± 1.11 pM/min, an enhancement of 2.5-fold (Table 1), and similar to the rate observed in the presence of UL42. In contrast to what was observed with UL42 at saturating UL9 concentrations, the addition of 12.5 nM ICP8 enhanced the steady-state rate of unwinding by 50 nM UL9 more than fivefold (Fig. 7B; Table 1). This concentration of ICP8 resulted in the melting of a small percentage of the DNA substrate after 60 min (Fig. 7B) and probably accounts for the slight difference in the maximum concentration of DNA unwound by 50 nM UL9 in the presence versus the absence of ICP8. The ability of ICP8 to enhance the rate of unwinding by UL9 at both saturating and subsaturating UL9 concentrations suggests that one or more mechanisms for enhancement may differ between UL42 and ICP8.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 7. Effect of ICP8 on the kinetics of unwinding at subsaturating and saturating concentrations of UL9. Reactions were performed essentially as described in the legend to Fig. 5, except that the accessory protein added was ICP8. Each data point represents the mean ± standard deviation from three independent experiments. (A) Unwinding with a subsaturating concentration (3.13 nM) of UL9 alone (•), with 3.13 nM UL9 and 6.25 nM ICP8 ({blacksquare}), with 6.25 nM ICP8 alone ({square}), or with no added protein ({circ}). (B) Unwinding with a saturating concentration (50 nM) of UL9 alone (•), with 50 nM UL9 and 12.5 nM ICP8 ({blacksquare}), with 12.5 nM ICP8 alone ({square}), or with no added protein ({circ}).

 
UL42 does not alter the dissociation rate of UL9 from the 23/38-mer DNA substrate. The results which demonstrated that UL42 enhanced the steady-state rate for unwinding at subsaturating UL9 to DNA concentrations are consistent with the hypothesis that UL42 increases the affinity of UL9 for the DNA substrate at equilibrium. An increased affinity is manifest by a decrease in the equilibrium dissociation constant, Kd, which is equivalent to the rate constant for dissociation divided by the rate constant for association. Because moderately high concentrations of UL42 resulted in reduced enhancement of unwinding, we were unable to accurately measure the apparent Kd of UL9 in the presence of UL42 as we did for UL9 alone (Fig. 3C). Therefore, we examined the effect of UL42 on the rate of dissociation of UL9 from DNA under steady-state conditions. The effect on dissociation was determined by the ability of excess unlabeled competitor DNA substrate, added following the establishment of steady-state conditions, to trap UL9 as it dissociates from the labeled DNA substrate, thereby preventing or dramatically reducing its reassociation with that substrate. Parallel reactions were initiated by the addition of 3.13 nM UL9 alone, or in combination with UL42 (12.5 nM) or ICP8 (6.25 nM), and incubated at 37°C. After 40 min, a 100-fold excess of unlabeled 45/60-mer competitor substrate was added. To parallel control reactions, a comparable volume of buffer was added and portions of each reaction mixture were removed and analyzed for unwinding. The results (Fig. 8A, C, and D) demonstrate that new steady-state kinetics are established in each set of reactions after approximately 5 min, as indicated by the slight reduction in rate in buffer controls due to dilution of UL9. The addition of cold competitor substrate effectively trapped the UL9 as it dissociated from labeled 23/38-mer substrate (Fig. 8A), such that essentially no additional unwinding was observed within 5 min of the addition of trap. The rate constant for dissociation of UL9 from the DNA was estimated from an exponential fit of the average increase in amount of DNA unwound following the addition of the trap (Fig. 8B) and indicated that the UL9 dissociated from DNA with a half-life of approximately 1.3 min (range, 1.1 to 1.9 min). Although UL42 and ICP8 each increased the rate of unwinding by UL9, neither accessory protein significantly altered the rate of dissociation of UL9 from the labeled DNA substrate (Fig. 8C and D, respectively, and results not shown). However, on longer DNA substrates, ICP8 has been shown to decrease the rate of dissociation of UL9 (5). Because of the short length of the DNA substrate used in our experiments and our inability to observe a change in dissociation kinetics of UL9 in the presence of ICP8, it is likely that the dissociation of the UL9 from the end of the DNA, as it completes unwinding and/or translocation, is more rapid than its rate of dissociation from an internal position. Thus, under our assay conditions, a change in dissociation kinetics cannot account for the increased rate of unwinding observed in the presence of either UL42 or ICP8.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 8. Effect of competitor DNA on the kinetics of UL9 unwinding with or without accessory proteins. UL9 was incubated alone (A and B), or together with a fourfold molar concentration of UL42 (C), or a twofold molar concentration of ICP8 (D) at room temperature for 10 min and diluted immediately prior to initiation of reactions to achieve final concentrations of 3.13 nM for UL9, 12.5 nM for UL42 or 6.25 nM for ICP8, and 0.5 nM labeled 23/38-mer DNA substrate. Reactions were incubated at 37°C, and samples were removed at the times indicated and terminated by the addition of EDTA. A 100-fold excess (50 nM) of nonradioactive competitor substrate (45/60-mer) was added (open symbols) 40 min after initiation (indicated by the arrow), or the same volume of buffer was added to control reactions (closed symbols). Panel B depicts the increase in concentration of DNA unwound by UL9 alone as a function of time following the addition of the cold helicase substrate (average of two independent experiments). The data were fit to an exponential function (equation 3) and estimated a half-life for association of UL9 with the DNA substrate of 1.3 min (range, 1.1 to 1.9 min).

 
Effects of accessory proteins on the association kinetics of UL9 with DNA. To begin to address other mechanisms by which UL42 could enhance the steady-state rate for unwinding by UL9, we wished to determine whether UL42 was capable of increasing the rate following preloading of UL9 onto the DNA. Because the preceding reactions involved initiation with UL9 and included excess ss DNA trap to prevent reannealing of unwound substrate, it was important to know how unwinding rates were affected when UL9 was preloaded onto labeled DNA substrate in the absence of the DNA trap. Reactions were assembled in buffer containing labeled DNA and ATP, but with EDTA to prevent premature initiation as described in Materials and Methods. Parallel reactions were prepared to contain UL9 (3.13 nM) for preloading and were initiated by the addition of MgCl2 and the ss DNA trap, or did not contain UL9 and were initiated by the addition of UL9 and MgCl2 (Fig. 9A). The amount of DNA unwound as a function of time at 37°C was monitored. Despite equilibration of UL9 with labeled DNA for 10 min prior to initiation, a lag of 10 to 15 min was observed before rapid unwinding occurred in reactions containing preloaded UL9 or in those in which UL9 was added at the time of initiation. However, lack of preincubation of UL9 with the labeled DNA substrate slowed the initial rate of unwinding by UL9, in part due to competition between the partially duplex-labeled DNA substrate and the excess ss DNA trap for binding to UL9. Nevertheless, reaction rates were indistinguishable at later times regardless of whether UL9 had been preloaded onto DNA or whether it was added at the time of initiation. Taken together, these results suggest that the initial stages of unwinding are limited more by the rate of assembly of UL9 than by the rate at which UL9 binds to the DNA.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 9. (A) Effect of preloading on UL9 unwinding kinetics. UL9 (3.13 nM) was preincubated with 0.5 nM labeled 23/38-mer DNA for 10 min at 37°C in the presence of EDTA, and reactions were initiated with MgCl2 and 5 nM unlabeled 23-mer ssDNA trap (•). In parallel reactions containing 0.5 nM labeled 23/38-mer and 5 nM unlabeled 23-mer DNA trap, reactions were initiated by the addition of 3.13 nM UL9 ({blacksquare}) or a comparable volume of buffer ({circ}). Samples were removed at the indicated times, quenched with EDTA, and the concentration of 23-mer unwound was quantified as described in Materials and Methods. (B) Effect of time of addition of UL42 on UL9 unwinding kinetics. For all reactions, UL9 or a mixture of UL9 and UL42 was preincubated with 0.5 nM labeled 23/38-mer DNA substrate for 10 min. •, reaction mixtures contained 3.13 nM UL9 and were initiated by the addition of MgCl2 and 5 nM 23-mer ss DNA trap; {blacksquare}, reaction mixtures contained 3.13 nM UL9 and were initiated by the addition of MgCl2, ss DNA trap, and UL42 (12.5 nM, final concentration); {blacktriangleup}, reaction mixes contained 3.13 nM UL9 and 12.5 nM UL42 and were initiated by the addition of MgCl2 and 5 nM 23-mer ss DNA trap.

 
We predicted that if UL42 enhanced the assembly of UL9 onto DNA, we should observe a decrease in the lag time prior to the onset of a rapid and linear rate for unwinding. In two sets of reactions, UL9 was preincubated with the labeled DNA substrates and reactions were initiated with or without UL42 protein in buffer containing MgCl2 and ss DNA trap (Fig. 9B). In a third set of reactions, UL9 and UL42 were included in the preincubation mix and reactions were initiated with MgCl2 and ss DNA trap. We observed similar kinetics for unwinding in reactions containing both UL9 and UL42, regardless of whether UL42 was included in the preincubation mix. As observed above, reaction rates in the presence of UL42 were higher than in reactions containing only UL9. Despite the more rapid rate for unwinding by UL9 in the presence of UL42, UL42 did not significantly decrease the initial lag period associated with functional UL9 assembly (Fig. 9B).

To better distinguish association kinetics from the kinetics of assembly into functionally competent protein, reactions were initiated with UL9 (3.13 nM) and allowed to reach steady state (15 min), prior to the addition of UL42 (12.5 nM), ICP8 (6.25 nM), or equivalent volume of buffer. Similar rates of unwinding were observed for approximately 15 min after the addition of UL42 or buffer (Fig. 10A). However, following this 15-min lag period, the rate of unwinding increased substantially for reactions containing UL42, but remained the same for control reactions. In other experiments, when UL42 (or buffer) was added 40 min after initiation, we also observed similar rates of unwinding for approximately 15 min following the addition of UL42 versus buffer and an increased rate for unwinding thereafter in UL42-containing reactions (results not shown). The fact that steady-state reaction rates did not change for 15 min following the addition of UL42, regardless of the time of addition of the accessory protein, argues that UL42 has little or no impact on the inherent ability of UL9 to assemble or undergo a conformational change to form a functionally competent complex.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 10. Kinetics of unwinding by UL9 following the addition of accessory proteins to steady-state reactions. Reactions containing 0.5 nM labeled 23/38-mer substrate were initiated by the addition of UL9 (3.13 nM, final concentration), and samples were removed at the indicated times following initiation. (A) Fifteen minutes after initiation (indicated by the arrow), UL42 (12.5 nM final concentration {blacksquare}) or an equivalent volume of buffer (•) was added, and unwinding by UL9 was monitored as a function of time. In control reactions lacking UL9, the DNA substrate was incubated in the absence of added protein ({circ}) or, 15 min after initiation, 12.5 nM UL42 was added ({square}). (B) Reactions were conducted as indicated for panel A, except that ICP8 (6.25 nM) was added after 15 min to reaction mixtures containing 3.13 nM UL9 ({blacktriangleup}), or a comparable volume of buffer was added (•). Control reactions lacking UL9 contained no added protein ({circ}), or 6.25 nM ICP8 was added 15 min after initiation ({triangleup}).

 
Similar reactions were performed in which ICP8 was added 15 min following initiation with UL9 (Fig. 10B). In contrast to what was observed following the addition of UL42, the concentration of unwound product increased rapidly (within 5 min) following the addition of ICP8, compared to only a slight increase in unwinding observed over the same period in controls in which buffer only was added to reactions. Thus, ICP8-containing reactions did not require an additional assembly period, or the period was drastically reduced before a new steady-state rate was established, suggesting a role for ICP8 in facilitating assembly of functionally competent UL9 onto DNA. This is consistent with observations by others that ICP8 eliminates the lag period observed in UL9 helicase reactions (5, 7).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is becoming increasingly evident that the formation of the HSV-1 DNA replisome is likely to involve a large number of viral (and perhaps host) protein-protein interactions (9). Our laboratory previously demonstrated that two of the essential HSV-1 DNA replication proteins, UL9 and UL42, physically interact (30), and we set out to determine whether the proteins also exhibited a functional interaction. In this report, we have demonstrated for the first time that the polymerase processivity factor, UL42, which has no known inherent enzymatic activity, provides accessory function to UL9, the protein thought to initiate DNA replication. Although the events required to initiate ori-dependent DNA replication remain unclear, it is likely that the helicase activity of UL9 is important in this process (27). Nevertheless, in vitro, UL9 alone unwinds DNA poorly and requires high stoichiometries with respect to DNA for optimum unwinding (e.g., Fig. 3). ICP8, another essential HSV-1 DNA replication protein, has been shown to enhance UL9 ATPase and helicase activities (3, 7, 13, 15, 18, 21, 26, 34). Although it was clear in our initial experiments that UL42 also enhanced the helicase activity of UL9 in vitro, the mechanism(s) by which it did so was not. Therefore, we compared the behavior of UL9 in the presence of UL42 to that in the presence of ICP8 to better uncover how each accessory function worked.

Mechanism by which UL42 enhances the steady-state rate of unwinding. The ability of UL42 to enhance the steady-state rate of helicase activity at subsaturating, but not at saturating, concentrations of UL9 suggested that UL42 increased the amount of UL9 bound in functional complex to the DNA substrate at equilibrium (i.e., a decreased apparent Kd). Several possible mechanisms (Fig. 2) that are not mutually exclusive but by which this could be accomplished include (i) increasing the rate of binding of UL9 to the DNA substrate (increased kon); (ii) decreasing the rate of dissociation of UL9 from DNA (decreased kd and/or kend); and (iii) increasing the ability or rate of UL9 to assemble into functional complex or to undergo a conformational change (increased kassembly). To simplify the analysis, we selected a short DNA substrate to minimize the possibility for enzyme dissociation prior to completing unwinding of the DNA. That dissociation of UL9 from the DNA is controlled predominantly by translocation off the end (kend), rather than from an internal location, is suggested by the fact that ICP8 does not decrease the dissociation rate of UL9 from the 23/38-mer (compare Fig. 8D with A), despite the fact that it does increase retention of UL9 on longer DNA substrates (5). Because UL42 also did not alter the dissociation kinetics of UL9 from this short DNA substrate (compare Fig. 8C with A), dissociation cannot account for the increased steady-state rate of unwinding we observed for UL9 in the presence of UL42. However, our studies have not addressed possible effects of UL42 on the processivity of UL9 helicase activity on longer DNA substrates.

UL9 requires a period of time after binding to DNA before initiating unwinding (5, 7), and it unwinds DNA stoichiometrically (7). These results suggest that assembly of UL9 into a functional helicase is required following initial binding of UL9 to DNA, and this is most likely the rate-limiting step in steady-state reactions (5). Although neither the stoichiometry nor the nature of the functional helicase is known, it is interesting that we observed unwinding to be cooperative (Fig. 3C). It is possible that this cooperativity may reflect an essential assembly step required for UL9 helicase function. However, the possibility that the lag period may involve dissociation of homodimers of UL9 has not been excluded (34), nor has a requirement for a conformational change with or without assembly. The addition of UL42 to ongoing steady-state reactions increased the steady-state rate of unwinding, but only after a delay of 10 to 15 min (Fig. 10A), roughly equivalent to the lag period we observed prior to the onset of unwinding by UL9 alone (Fig. 5A and 9B). Thus, our results demonstrate that UL42 does not alter the requirement for a slow, rate-limiting step subsequent to binding of UL9 to DNA.

Given that UL42 does not alter the rate of dissociation of UL9 from the DNA under our reaction conditions or substantially alter the requirement for assembly and/or conformational change prior to the formation of a helicase-competent complex, the results are most consistent with UL42 increasing the rate constant for association of UL9 with DNA (kon) (Fig. 2), which would result in a decrease in the apparent Kd of UL9 for DNA. The ability to load UL9 onto DNA at a faster inherent rate would result in a higher occupancy of UL9 on DNA at equilibrium, but only under conditions in which limiting UL9 is present. Interestingly, an extremely short lag time is also associated with the highest UL9/DNA stoichiometries (100:1) we used (Fig. 5B), suggesting an increased rate of assembly would be expected when more UL9 is bound to DNA. Nevertheless, UL42 increases by only 2.5-fold the apparent steady-state rate of unwinding at subsaturating concentrations (3.13 nM) of UL9 (Table 1). Because functional titration results (Fig. 3) demonstrated that a 2.5-fold increase in the amount of bound UL9 would remain far from saturating, increased binding at 3.13 nM UL9 is unlikely to result in a substantial alteration in lag time, although a small increase in rate of assembly is likely to occur, driven by higher local concentrations of UL9 on DNA in the presence of UL42. An increase in the rate constant for association of UL9 with DNA in the presence of UL42 is also consistent with the inability of UL42 to enhance UL9 helicase activity at saturating concentrations of UL9, since occupancy of UL9 on DNA under those conditions cannot be increased. Additional confirmation that UL42 increases the rate constant for association of UL9 with DNA will require direct binding assays, preferably using an isolated stable complex of UL9 and UL42, or pre-steady-state kinetic analysis, such as that described by Kim and coworkers (19).

Several pieces of evidence suggest that it is unlikely that UL42 increases the kon of UL9 with the DNA substrate by simply preventing nonproductive associations of UL9 with DNA. First, enhancement of helicase activity in the presence of UL42 increases proportionately with the addition of UL42, up to an optimum stoichiometry of four molecules of UL42 per molecule of UL9 (Fig. 4A). However, neither the nature of the functional complex nor the number of active molecules of each is known. Second, higher concentrations of UL42 reduced the enhancement effect on helicase activity (Fig. 4B), suggesting that high occupancy of the DNA by UL42 actually decreases the ability of UL9 to associate with the DNA substrate. Third, UL42 does not enhance the unwinding rate of a noncognate helicase, regardless of whether that helicase is present at subsaturating or close-to-saturating concentrations with respect to DNA. Nevertheless, it remains possible that UL42 facilitates the binding of UL9 to DNA by virtue of its ability to bind ds DNA and to form specific interactions with UL9.

Whether or not UL42 has an effect on the inherent rate of translocation by UL9 was not addressed directly by our studies. However, we consider it unlikely that an increased rate of translocation and unwinding by UL9 could account for the increased steady-state rate of unwinding we observed in the presence of UL42. An effect on translocation rate would be expected to have an effect on steady-state rates at saturating and subsaturating UL9 concentrations, but UL42 increased the steady-state rate of unwinding at only subsaturating concentrations of UL9 (Fig. 5). Moreover, in the presence of UL42, unwinding rates never exceeded those observed at saturating UL9 concentrations alone, as one would expect for an increase in translocation rate.

Mechanism by which ICP8 enhances the steady-state rate of unwinding. ICP8 increased the steady-state rate for unwinding at subsaturating and saturating UL9 concentrations, as well as the maximum proportion of DNA unwound at all UL9 concentrations (Fig. 7B). These results demonstrate that ICP8 differs from UL42 in at least some aspects of the mechanism(s) by which it enhances helicase activity. Previous studies demonstrated that ICP8 increased the length of DNA which could be effectively unwound by UL9 (7, 15, 25). Moreover, ICP8 allowed retention of UL9 on long (100-mer) DNA substrates following the addition of an unlabeled substrate, demonstrating that it increased the processivity of unwinding by UL9 (5). We employed a shorter DNA substrate and demonstrated that ICP8 did not alter the rate of dissociation of UL9, most likely because UL9 alone is capable of translocating off the end once unwinding begins. Because ICP8 increases the steady-state rate for unwinding the short DNA substrate even when dissociation is not altered, it is likely that ICP8 enhances the helicase activity of UL9 by mechanisms in addition to its effect on processivity.

At least one of these mechanisms is an increase in the rate of the step associated with assembly and/or conformational change. The addition of ICP8 to steady-state reactions produced an almost immediate increase in the steady-state rate as previously observed by others (5, 7), but in contrast to effects observed following the addition of UL42. We observed approximately a twofold increase in unwinding within the first 5 min following the addition of ICP8 (Fig. 10B). In fact, ICP8 decreased the lag period associated with unwinding by UL9, when added at the time of initiation (Fig. 7) or following the establishment of steady-state kinetics (Fig. 10B). This suggests that ICP8 increases the rate of the rate-limiting assembly or conformational step and/or promotes steady-state unwinding by changing the step which is rate limiting. The former is consistent with the proposed ability of ICP8 to alter the conformation of UL9 to render it more competent for unwinding (1, 22). The reduction in lag time could also be the result, at least in part, of an increased rate of translocation of UL9 through DNA. The complexity of the response to ICP8 prevents us from ruling out an effect on association kinetics of UL9 with DNA substrate.

At subsaturating UL9 concentrations, a condition which is likely to exist in HSV-1-infected cells, the individual effects of UL42 and ICP8 on the steady-state rate for unwinding by UL9 are modest (2.5-fold [Table 1]). However, it should be noted that MutL, a protein important in DNA repair, increases the ability of the helicase encoded by the UvrD gene to load onto DNA only two- to fourfold (29). Our findings that UL42 and ICP8 enhance UL9 helicase activity by apparently different mechanisms suggest the possibility that they can act synergistically. Thus, the ability of UL42 to increase the inherent rate by which UL9 can associate with DNA could be coupled to the ability of ICP8 to increase the rate for assembly of UL9 into a functionally competent helicase and to increase the processivity of unwinding in order to produce a more efficient and longer-binding helicase. Such synergism might allow more efficient opening of DNA at or close to ori sequences and/or permit more efficient unwinding for leading-strand synthesis as DNA replication transitions from initiation to elongation. Although the ability of ICP8 and UL42 to bind to UL9 simultaneously has not been determined, UL42 binds to the N-terminal portion of UL9, whereas ICP8 binds to the C-terminal domain (6, 30). Given the poor ability of UL9 alone to unwind DNA and the high stoichiometries of UL9 to DNA required to achieve unwinding in vitro, it seems likely that other factors assist UL9 to unwind DNA in vivo, and UL42 now joins ICP8 as a likely candidate.


    ACKNOWLEDGMENTS
 
We gratefully acknowledge the assistance of Yali Zhu in conducting some of the experiments and Rong Guo and Houleye Diallo for assistance with purification of proteins used in these studies. We also thank Smita Patel (UMDNJ) for supplying purified HCV NS3h protein and for her advice and help with interpreting some of the data reported herein.

This work was supported in part by grants GM34930 and GM58809 from the National Institutes of Health and by services supplied by the OSU Comprehensive Cancer Center Core Grant (P30 CA16058) and the Department of Molecular Virology, Immunology, and Medical Genetics.


    FOOTNOTES
 
* Corresponding author. Mailing address: 2198 Graves Hall, 333 West Tenth Ave., Columbus, OH 43210. Phone: (614) 292-0735. Fax: (614) 292-9805. E-mail: parris.1{at}osu.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Arana, M. E., B. Haq, N. Tanguy Le Gac, and P. E. Boehmer. 2001. Modulation of the herpes simplex virus type-1 UL9 DNA helicase by its cognate single-strand DNA-binding protein, ICP8. J. Biol. Chem. 276:6840-6845.[Abstract/Free Full Text]
  2. Aslani, A., B. Macao, S. Simonsson, and P. Elias. 2001. Complementary intrastrand base pairing during initiation of herpes simplex virus type 1 DNA replication. Proc. Natl. Acad. Sci. USA 98:7194-7199.[Abstract/Free Full Text]
  3. Aslani, A., M. Olsson, and P. Elias. 2002. ATP-dependent unwinding of a minimal origin of DNA replication by the origin-binding protein and the single-strand DNA-binding protein ICP8 from herpes simplex virus type 1. J. Biol. Chem. 277:41204-41212.[Abstract/Free Full Text]
  4. Bell, J. E., and E. T. Bell. 1988. Proteins and enzymes, pp. 465-467. Prentice-Hall, Inc., Englewood Cliffs, N.J.
  5. Boehmer, P. E. 1998. The herpes simplex virus type-1 single-strand DNA-binding protein, ICP8, increases the processivity of the UL9 protein DNA helicase. J. Biol. Chem. 273:2676-2683.[Abstract/Free Full Text]
  6. Boehmer, P. E., M. C. Craigie, N. D. Stow, and I. R. Lehman. 1994. Association of origin binding protein and single strand DNA-binding protein, ICP8, during herpes simplex virus type 1 DNA replication in vivo. J. Biol. Chem. 269:29329-29334.[Abstract/Free Full Text]
  7. Boehmer, P. E., M. S. Dodson, and I. R. Lehman. 1993. The herpes simplex virus type-1 origin binding protein: DNA helicase activity. J. Biol. Chem. 268:1220-1225.[Abstract/Free Full Text]
  8. Boehmer, P. E., and I. R. Lehman. 1993. Physical interaction between the herpes simplex virus 1 origin-binding protein and single-stranded DNA-binding protein ICP8. Proc. Natl. Acad. Sci. USA 90:8444-8448.[Abstract/Free Full Text]
  9. Boehmer, P. E., and I. R. Lehman. 1997. Herpes simplex virus DNA replication. Annu. Rev. Biochem. 66:347-384.[CrossRef][Medline]
  10. Bruckner, R. C., J. J. Crute, M. S. Dodson, and I. R. Lehman. 1991. The herpes simplex virus 1 origin binding protein: a DNA helicase. J. Biol. Chem. 266:2669-2674.[Abstract/Free Full Text]
  11. Calder, J. M., and N. D. Stow. 1990. Herpes simplex virus helicase-primase: the UL8 protein is not required for DNA-dependent ATPase and DNA helicase activities. Nucleic Acids Res. 18:3573-3578.[Abstract/Free Full Text]
  12. Chaudhuri, M., and D. S. Parris. 2002. Evidence against a simple tethering model for enhancement of herpes simplex virus DNA polymerase processivity by accessory protein UL42. J. Virol. 76:10270-10281.[Abstract/Free Full Text]
  13. Dodson, M. S., and I. R. Lehman. 1993. The herpes simplex virus type 1 origin binding protein: DNA-dependent nucleoside triphosphatase activity. J. Biol. Chem. 268:1213-1219.[Abstract/Free Full Text]
  14. Elias, P., and I. R. Lehman. 1988. Interaction of origin binding protein with an origin of replication of herpes simplex virus 1. Proc. Natl. Acad. Sci. USA 85:2959-2963.[Abstract/Free Full Text]
  15. Fierer, D. S., and M. D. Challberg. 1992. Purification and characterization of UL9, the herpes simplex virus type 1 origin-binding protein. J. Virol. 66:3986-3995.[Abstract/Free Full Text]
  16. Gallo, M. L., D. H. Jackwood, M. Murphy, H. S. Marsden, and D. S. Parris. 1988. Purification of the herpes simplex virus type 1 65-kilodalton DNA-binding protein: properties of the protein and evidence of its association with the virus-encoded DNA polymerase. J. Virol. 62:2874-2883.[Abstract/Free Full Text]
  17. He, X., and I. R. Lehman. 2000. Unwinding of a herpes simplex virus type 1 origin of replication (Oris) by a complex of the viral origin binding protein and the single-stranded DNA binding protein. J. Virol. 74:5726-5728.[Abstract/Free Full Text]
  18. He, X., and I. R. Lehman. 2001. An initial ATP-independent step in the unwinding of a herpes simplex virus type 1 origin of replication by a complex of the viral origin-binding protein and single-strand DNA-binding protein. Proc. Natl. Acad. Sci. USA 98:3024-3028.[Abstract/Free Full Text]
  19. Kim, D.-E., M. Narayan, and S. S. Patel. 2002. T7 DNA helicase: a molecular motor that processively and unidirectionally translocates along single-stranded DNA. J. Mol. Biol. 321:807-819.[CrossRef][Medline]
  20. Lanzetta, P. A., L. J. Alvarez, P. S. Reinach, and O. A. Candia. 1979. An improved assay for nanomole amounts of inorganic phosphate. Anal. Biochem. 100:95-97.[CrossRef][Medline]
  21. Lee, S. S.-K., and I. R. Lehman. 1997. Unwinding of the box 1 element of a herpes simplex virus type 1 origin by a complex of the viral origin binding protein, single-strand DNA binding protein, and single-stranded DNA. Proc. Natl. Acad. Sci. USA 94:2838-2842.[Abstract/Free Full Text]
  22. Lee, S. S.-K., and I. R. Lehman. 1999. The interaction of herpes simplex type 1 virus origin-binding protein (UL9 protein) with box I, the high affinity element of the viral origin of DNA replication. J. Biol. Chem. 274:18613-18617.[Abstract/Free Full Text]
  23. Levin, M. K., and S. S. Patel. 1999. The helicase from hepatitis C virus is active as an oligomer. J. Biol. Chem. 274:31839-31846.[Abstract/Free Full Text]
  24. Levin, M. K., and S. S. Patel. 2003. Helicases as molecular motors, p. 170-198. In M. Schliwa (ed.), Molecular motors, Wiley-VCH Verlag GmbH, Weinheim, Germany.
  25. Makhov, A. M., P. E. Boehmer, I. R. Lehman, and J. D. Griffith. 1996. Visualization of the unwinding of long DNA chains by the herpes simplex virus type 1 UL9 protein and ICP8. J. Mol. Biol. 258:789-799.[CrossRef][Medline]
  26. Makhov, A. M., S. S.-K. Lee, I. R. Lehman, and J. D. Griffith. 2003. Origin-specific unwinding of herpes simplex virus 1 DNA by the viral UL9 and ICP8 proteins: visualization of a specific preunwinding complex. Proc. Natl. Acad. Sci. USA 100:898-903.[Abstract/Free Full Text]
  27. Marintcheva, B., and S. K. Weller. 2001. A tale of two HSV-1 helicases: roles of phage a