Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Shin, Y. C. Articles by Folk, W. R. Search for Related Content PubMed PubMed Citation Articles by Shin, Y. C. Articles by Folk, W. R.

 Previous Article  |  Next Article 

Journal of Virology, November 2003, p. 11491-11498, Vol. 77, No. 21
0022-538X/03/$08.00+0     DOI: 10.1128/JVI.77.21.11491-11498.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Formation of Polyomavirus-Like Particles with Different VP1 Molecules That Bind the Urokinase Plasminogen Activator Receptor

Young C. Shin and William R. Folk^*

Department of Biochemistry, University of Missouri-Columbia, Columbia, Missouri 65211

Received 9 June 2003/ Accepted 6 August 2003

Top Abstract Introduction Materials and Methods Results Discussion References

 
Icosahedral virus-like particles formed by the self-assembly of polyomavirus capsid proteins (Py-VLPs) can serve as useful nanostructures for delivering nucleic acids, proteins, and pharmaceuticals into animal cells and tissues. Four predominant surface-exposed loops in the VP1 structure offer potential sites to display sequences that might contribute new targeting specificities. Introduction into each of these loops of sequences derived from the amino-terminal fragment of urokinase plasminogen activator (uPA) or a related phage display peptide reduced the solubility of VP1 molecules when expressed in insect cells, and insertions into the EF loop reduced VP1 solubility least. Coexpression in insect cells of the uPA-VP1 molecules and VP1 containing a FLAG epitope in the HI loop permitted the formation of heterotypic Py-VLPs containing uPA-VP1 and FLAG-VP1. These heterotypic VLPs bound to uPAR on the surfaces of animal cells. Heterotypic Py-VLPs containing ligands for multiple cell surface receptors should be useful for targeting specific cells and tissues.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The polyomavirus virion is composed of 72 pentameric subunits arranged in an icosahedral lattice with an approximate diameter of 50 nm (51). Polyomavirus virus-like particles (Py-VLPs) of essentially the same dimensions and shape are formed by the self-assembly of the major capsid protein VP1 (55, 56). The structural framework for VP1 is an antiparallel ß-sheet with jelly roll topology from which emanate four loops (58-60). The BC, DE, and HI loops closely interact and are located at the outward-facing end of the ß-sheet; the EF loop, originating from the inward-facing end, is located on a side of the ß-sheet (59, 60). A shallow groove formed between the BC1 and HI loops binds oligosaccharides terminating in -2,3-linked sialic acid, expressed on many animal cells (8, 18, 58, 60); the EF loop, together with the DE loop, contains motifs for integrin binding, which is important for cell susceptibility at a postattachment level (6). Among different strains of polyomavirus, the four VP1 surface-exposed loops exhibit sequence variability (3, 17, 36, 39, 53) and the HI loop has been used predominantly as a site for insertion so as to display on the surface of Py-VLPs the Escherichia coli dihydrofolate reductase (DHFR) (22), protein Z (21), a WW domain peptide (57), and a polyanionic adapter sequence (62).

The urokinase plasminogen activator receptor (uPAR) is a glycosylphosphatidylinositol-linked protein expressed on the apical surfaces of endothelial cells (46) and certain epithelial cells (26) and leukocytes (48) to promote proteolysis (13), cell adhesion (7, 66), migration (5, 15), and chemotaxis (9, 14, 27, 28, 42, 52). uPAR is expressed by many cancer cells, where it is correlated with metastasis and poor prognosis (10, 29-32, 43, 63), and is a potential target for drug and gene therapy. Also, uPAR is expressed on the apical surface of human airway epithelia and might be used to target delivery of DNAs to correct the genetic defect in individuals with cystic fibrosis (12). Sequences binding with high affinity to uPAR occur in the amino-terminal domain of urokinase plasminogen activator (2, 47), and uPA-unrelated sequences with high affinity to uPAR also have been identified (24).

In this study, peptide sequences that bind to uPAR were introduced into each of the four exposed loops. VP1 proteins with insertions in the EF loop were most frequently expressed in insect cells in a soluble form; the same insertions in the other loops caused VP1 to be expressed in an insoluble form. The efficiency of self-assembly of Py-VLPs containing the uPA-VP1 molecules was enhanced by coexpression with soluble VP1 molecules modified in the HI loop by the FLAG epitope. The heterotypic Py-VLPs composed of both types of VP1 bound specifically to uPAR on the surface of U-937 cells. Heterotypic Py-VLPs containing ligands for different receptors should expand the utility of Py-VLPs as gene delivery agents (4, 16).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Modification of polyomavirus VP1 genes. The VP1 gene of the polyomavirus A3 strain cloned in pFastBac1 plasmid (GIBCO-BRL) was used as a backbone for the construction of modified VP1 genes. Insertions into the BC (80 or 87), DE (150), EF (200), and HI (293) loops of VP1 (numbers indicate the residues of the VP1 protein prior to the insertion) were made by the following method, as exemplified by the insertion of the FLAG epitope (DWKDDDDK) into the HI loop. Two DNA fragments of the VP1 coding sequence containing the FLAG coding sequence were synthesized by PCR using primer pairs FBac-F/HI-FLAG-R and FBac-R/HI-FLAG-F. The PCR products were purified by agarose gel electrophoresis and isolated with the Compass DNA purification kit (American Bioanalytical, Natick, Mass.) and then annealed to make the intact VP1/HI-FLAG gene. This DNA was amplified by PCR using FBac-F and FBac-R primers, purified, and then cloned into the pFastBac-1 plasmid at the XbaI and XhoI sites. Essentially the same approach was employed to insert uPA(10-34) and the clone 20 peptide sequence (24) into the HI, BC, DE, and EF loops. The following primers were used to insert these sequences (residues complementary to VP1 are underlined): FBac-F, GATTATTCATACCGTCCCACCATCG; FBac-R, CTGATTATGATCCTCTAGTACTTCT; HI-FLAG-F, AAGGACGACGATGACAAGCCCGGGAACTATGATGTCCATCACTG; HI-FLAG-R, GTCATCGTCGTCCTTGTAGTCGAATTCTCTTGTAACTCTCCTGCCCA; BC-uPA(10-34)-F, CAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAATTTGGCTACATCAGATAC; BC-uPA(10-34)-R, GAGAAGTACTTGTTGGACACACATGTTCCTCCATTTAGACAGTCACAGTTAATCCCTCTGCTCCAACCAT; DE-uPA(10-34)-F, CAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAACAAAAGTAATTTCCACTCC; DE-uPA(10-34)-R, GAGAAGTACTTGTTGGACACACATGTTCCTCCATTTAGACAGTCACAGTTGTTTACTGTATCTGTGGGTT; EF-uPA(10-34)-F, CAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAGACATGGTCAACAAAGACCA; EF-uPA(10-34)-R, GAGAAGTACTTGTTGGACACACATGTTCCTCCATTTAGACAGTCACAGTTCTTCTTTGTGATTGTTTTGA; HI-uPA(10-34)-F, CAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAACTATGATGTCCATCACTG; HI-uPA(10-34)-R, GAGAAGTACTTGTTGGACACACATGTTCCTCCATTTAGACAGTCACAGTTTCTTGTAACTCTCCTGCCCA; BC-clone-20-F, TCTCTGAACTTCTCTCAGTACCTGTGGTACACCGAGGATTCCCCAGAAAATAAT; BC-clone-20-R, AGAGAAGTTCAGAGAGTGCGGCATCGGTTCCGCTGTATCTGATGTAGCCAAATT; DE-clone-20-F, TCTCTGAACTTCTCTCAGTACCTGTGGTACACCACAAAAGTAATTTCCACTCCA; DE-clone-20-R, AGAGAAGTTCAGAGAGTGCGGCATCGGTTCCGCGTTTACTGTATCTGTGGGTTT; EF-clone-20-F, TCTCTGAACTTCTCTCAGTACCTGTGGTACACCGACATGGTCAACAAAGACCAA; EF-clone-20-R, AGAGAAGTTCAGAGAGTGCGGCATCGGTTCCGCCTTCTTTGTGATTGTTTTGAT; HI-clone-20-F, TCTCTGAACTTCTCTCAGTACCTGTGGTACACCAACTATGATGTCCATCACTGG; HI-clone-20-R, AGAGAAGTTCAGAGAGTGCGGCATCGGTTCCGCTCTTGTAACTCTCCTGCCCAT.

For the insertion of longer sequences, such as uPA(1-60) and uPA(1-135), into VP1, restriction enzyme sites for NheI and XmaI were introduced into the coding sequence for each VP1 loop by the same procedure employed to make the FLAG insertion, using the following primers (sequences complementary to VP1 are underlined and sequences of restriction enzymes are boldface): BC-F, GCTAGCAGCCGTCCCGGGGAGGATTCCCCAGAAAATAAT; BC-R, CCCGGGACGGCTGCTAGCTGTATCTGATGTAGCCAAATT; DE-F, GCTAGCAGCCGTCCCGGGACAAAAGTAATTTCCACTCCA; DE-R, CCCGGGACGGCTGCTAGCGTTTACTGTATCTGTGGGTTT; EF-F, GCTAGCAGCCGTCCCGGGGACATGGTCAACAAAGACCAA; EF-R, CCCGGGACGGCTGCTAGCCTTCTTTGTGATTGTTTTGAT; HI-F, GCTAGCAGCCGTCCCGGGAACTATGATGTCCATCACTGG; HI-R, CCCGGGACGGCTGCTAGCTCTTGTAACTCTCCTGCCCAT.

The first cDNA strand of human uPA(1-135) was synthesized by reverse transcription using the uPA(1-135)-R primer by the methods described in the cDNA synthesis system manual (GIBCO-BRL). Total mRNA was purified from cultured PC-3 cells. The first cDNA strand was amplified with the uPA(1-60)-F and uPA(1-60)-R and uPA(1-135)-F and uPA(1-135)-R primer pairs to produce the uPA(1-60) and uPA(1-135) sequences, respectively. The PCR products were inserted into the coding sequence for each loop of VP1 using NheI and XmaI restriction enzymes. The sequences of primers used for amplification of uPA sequences were as follows (sequences of uPA are underlined, and sequences of restriction enzymes are boldface): uPA(1-60)-F, AGCTGCTAGCAGCAATGAACTTCATCAAGTT; uPA(1-60)-R, TAATCCCGGGTCCTCGGTAAAAGTGACCATT; uPA(1-135)-F, CCGGAATTCAGCAATGAACTTCATCAAGTT; uPA(1-135)-R, TCCCCCCGGGTTTTCCATCTGCGCAGTCATG.

Construction of VP1/EF-uPA(1-60)/HI-FLAG was performed by replacing part of the VP1 coding sequence of pFastBac-VP1/HI-FLAG with that of pFastBac-VP1/EF-uPA(1-60) by using the XbaI and ApaI restriction enzymes.

All of the constructs were confirmed by DNA sequencing.

Insect cell culture and baculovirus infections. Hi-5 insect cells were grown with EX-CELL TM 405 medium (JRH Biosciences, Lenexa, Kans.) supplemented with 5% fetal calf serum. Baculoviruses expressing wild-type and modified VP1 proteins were prepared according to procedures described in the Bac-to-Bac instruction manual (GIBCO-BRL) and titered by plaque assay. Cells (5 x 10⁶) in T-150 flasks were infected at a multiplicity of infection (MOI) of 10 and harvested 84 h after infection. For the production of heterotypic Py-VLPs, Hi-5 cells were infected as described above by baculoviruses expressing VP1/HI-FLAG together with baculoviruses expressing VP1/EF-uPA(1-60)/HI-FLAG at a MOI between 2 to 20.

Purification of Py-VLPs. Baculovirus-infected cells were harvested by low-speed centrifugation (900 x g, 5 min) and suspended in 3 ml of buffer A (10 mM Tris-HCl [pH 7.4], 1 M NaCl, 0.01 mM CaCl₂, 0.01% Triton X-100) and sonicated for 20 s three times. Proteinase inhibitors (Complete; Roche Diagnostics, Mannheim, Germany) were added to the lysate, which was centrifuged at 12,000 rpm for 30 min in a Beckman JA21 rotor, and the supernatant was saved. The pellet was resuspended with 2 ml of buffer A and sonicated and then centrifuged as described above. The two supernatants were combined and layered on top of sucrose (2 ml of 10% and 2 ml of 20%) in buffer A and centrifuged at 40,000 rpm for 4 h in a Beckman SW40 rotor. The resulting pellet was resuspended in 1 ml of buffer A (150 mM NaCl) and sonicated for 20 s to disrupt aggregates and centrifuged at 14,000 x g for 10 min, with the supernatant being saved (designated partially purified Py-VLPs). Py-VLPs were further purified by sedimentation through 10 to 50% sucrose gradients at 40,000 rpm for 4 h in a Beckman SW40 rotor.

For analysis based on sedimentation velocity, Py-VLPs partially purified through 10 to 20% sucrose gradients were treated with DNase I (Promega) for 1 h at 37°C and layered on top of 10 to 40% sucrose gradients, followed by centrifugation at 35,000 rpm for 2 h in a Beckman SW40 rotor. Fractions (0.8 ml) were collected, and the protein content of each fraction was determined by Bio-Rad protein assay.

Immunoprecipitation of Py-VLPs. Partially purified Py-VLPs (20 µg) were mixed with an anti-uPA monoclonal antibody (0.1 ml, no. 3921; American Diagnostica) and incubated for 1 h at 4°C with rotary agitation. Protein A-Sepharose CL-4B (50%, vol/vol) was added (80 µl) to the mixture, and the mixture was incubated for another 1 h and centrifuged. The antibody complexes were washed with 1 ml of buffer A (150 mM NaCl), and bound protein was eluted with 100 mM glycine-HCl (pH 3.0) and immediately neutralized with Tris-HCl (1.5 M, pH 8.8) and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting.

Electron microscopy of Py-VLPs. Preparations of partially purified Py-VLPs (0.2 to 0.5 mg/ml) were placed on a carbon-coated copper grid for 5 min and negatively stained with 1% uranyl acetate for 5 min. Transmission electron microscopy was performed with a JEOL 1200EX transmission electron microscope operating at 100 kV, and Py-VLPs were photographed with a magnification factor of 120,000.

Hemagglutination of Py-VLPs. Partially purified Py-VLPs (0.5 mg/ml, 100 µl) were serially diluted with saline in a 96-well (round-bottom) plate. Equal volumes of guinea pig red blood cells (2%, vol/vol) were added to each well and incubated for 3 h at room temperature.

Py-VLP binding to U-937 cells. Human U-937 cells (American Type Culture Collection; CRL 1593) growing in RPMI 1640 medium supplemented with 10% fetal calf serum and gentamicin (20 mg/liter) were harvested and resuspended at a concentration of 5 x 10⁵ cells/ml. Induction of uPAR was performed as described by Stoppelli et al. (61) with slight modifications. Phorbol 12-myristate 13-acetate (PMA) was added at a concentration of 50 nM, and the cells were cultured for 24 h in T-150 flasks. Most of cells were attached by this time. The medium was changed, and the cells were incubated for another 2 days; the cells were detached with phosphate-buffered saline (PBS)-EDTA and incubated in 50 mM glycine-100 mM NaCl (pH 3.0) for 3 min to remove bound endogenous uPA, washed with PBS containing 0.1 mg of bovine serum albumin (PBSA)/ml, and resuspended at 5 x 10⁶ cells/ml in PBSA. Expression of uPAR was verified by Western blot analysis using the anti-uPAR antibody (no. 3931; American Diagnostica). To observe the binding mediated by uPA(1-60), the putative integrin-binding sequence (LDV) (6) in VP1/wt, VP1/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG was changed to LAA by site-directed mutagenesis using the GeneEditor kit (Promega), the resulting VP1 genes were expressed in insect cells, and Py-VLPs were partially purified by the procedure described above. Partially purified Py-VLPs (20 µg) with or without competitor were mixed with 0.1 ml of the cell suspension described above and incubated for 40 min on ice. As a competitor, 30 µg of full-length uPA (no. 128; American Diagnostica) was added in each reaction. At the end of incubation, unbound Py-VLPs were removed by washing twice with PBSA, and cells were lysed with 100 µl of SDS-PAGE sample buffer. SDS-PAGE and Western blotting were performed to evaluate the amount of bound Py-VLPs.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Expression of polyomavirus VP1 proteins. Recombinant baculoviruses were constructed so as to express the wild-type polyomavirus VP1 protein and modified VP1 proteins containing inserts in each of the four surface-exposed loops. The uPA-related inserts included uPA(10-34), the principal binding determinant for uPAR (2); uPA(1-135), the amino-terminal fragment (ATF) whose affinity for uPAR (50% inhibitory concentration [IC₅₀] = 0.12 nM) approximates that of intact uPA (2, 47) and which has been widely used in studies of the uPA-uPAR interaction (2, 33, 61); uPA(1-60), comprising the more-hydrophilic half of ATF; and a phage display peptide (clone 20, 15 amino acids) with high affinity for uPAR (IC₅₀ = 0.01 µM) (24). Additionally, VP1 containing a FLAG epitope in the HI loop was expressed.

Lysates of baculovirus-infected insect cells were centrifuged at 12,000 rpm for 30 min, and the distribution of VP1 proteins between the supernatant and pellet was determined by SDS-PAGE and Western blotting with the anti-VP1 antibody (Table 1). Unmodified VP1 and VP1 modified by insertion of the FLAG epitope (VP1/HI-FLAG) partitioned primarily into the supernatants. Approximately two-thirds of the VP1/EF-clone 20, VP1/EF-uPA(10-34), and VP1/EF-uPA(1-60) proteins also partitioned into the supernatants. However, all other modified VP1 proteins were pelleted, suggesting that they did not fold properly or that the hydrophobic inserts caused aggregation.

View this table: [in this window] [in a new window]

TABLE 1. Partitioning of modified VP1 proteins between supernatant and pellet following centrifugation of insect cell lysates

VP1 with uPA(1-60) and uPA(1-135) inserts in the four loops were recognized by the anti-uPA antibody (no. 3921; American Diagnostica), but VP1/EF-uPA(1-60) gave stronger signals in Western blots than the same insert into the BC, DE, and HI loops of VP1 (Fig. 1A), suggesting that the antibody-reactive structure is either more accessible or better retained when introduced into the EF loop. Also, VP1/EF-uPA(1-60) migrated somewhat faster on SDS-PAGE, suggesting a more compact structure. To disrupt VP1/EF-uPA(1-60) binding to sialic acid, we introduced the FLAG epitope into its HI loop. VP1/EF-uPA(1-60)/HI-FLAG was expressed as well as the singly modified VP1/EF-uPA(1-60) and was as reactive with anti-uPA antibody (data not shown).

View larger version (47K): [in this window] [in a new window]

FIG. 1. Partitioning of VP1/uPA(1-60) proteins between supernatant and pellet following centrifugation of insect cell lysates and detection with antibodies. (A) VP1 proteins containing uPA(1-60) in each loop region were expressed in insect cells, and the whole-cell lysates (WCL) were evaluated with the anti-VP1 antibody or the anti-uPA antibody (no. 3921; American Diagnostica). Lane 1, VP1/BC-uPA(1-60); lane 2, VP1/DE-uPA(1-60); lane 3, VP1/EF-uPA(1-60); lane 4, VP1/HI-uPA(1-60). (B) Partitioning of the modified VP1 proteins between supernatant (S) and pellet (P), after centrifugation at 12,000 rpm for 30 min, and evaluation by SDS-PAGE and blotting with the anti-VP1 antibody. Lanes are the same as for panel A.

Formation of Py-VLPs by modified VP1 proteins. To determine whether the VP1 proteins had assembled into Py-VLPs, samples of the supernatants of cell lysates containing VP1/wt, VP1/HI-FLAG, VP1/EF-uPA(1-60)/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG (cells coexpressing both proteins) were layered on top of 10 to 20% sucrose and centrifuged at 40,000 rpm for 4 h. Each of the VP1 proteins could be pelleted (Fig. 2), suggesting that they self-assembled into Py-VLPs. Further purification of Py-VLPs by sedimentation through 10 to 50% sucrose gradients revealed that only a small portion of VP1/EF-uPA(1-60)/HI-FLAG was pelleted, while the others were pelleted efficiently. To confirm the slower sedimentation rate of the VLPs formed by VP1/EF-uPA(1-60)/HI-FLAG, the Py-VLPs partially purified through 10 to 20% sucrose gradients were layered onto 10 to 40% sucrose gradients and centrifuged, and the VP1 protein in each fraction was determined. As expected, VP1/EF-uPA(1-60)/HI-FLAG was observed to sediment more slowly than VP1/wt, VP1/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG (Fig. 3), indicating that the Py-VLPs formed by this VP1 were different from others.

View larger version (77K): [in this window] [in a new window]

FIG. 2. Sedimentation of VP1 proteins. Supernatants after low-speed centrifugation (lanes 1 to 4) were sedimented through 10 to 20% sucrose gradients (lanes 5 to 8), and pelleted proteins were analyzed by SDS-12% PAGE. Circles, VP1 proteins of interest; arrow, protein migrating around 38 kDa, possibly a degradation product of VP1. Lane M, molecular weight standard; lanes 1 and 5, VP1/wt; lanes 2 and 6, VP1/HI-FLAG; lanes 3 and 7, VP1/EF-uPA(1-60)/HI-FLAG; lanes 4 and 8, VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG.

View larger version (29K): [in this window] [in a new window]

FIG. 3. Analysis of VP1 proteins based on sedimentation velocity. Partially purified VP1 proteins were sedimented through 10 to 40% sucrose gradients, and fractions (0.8 ml) were collected (fraction 1 is the bottom). The main peaks of VP1/wt, VP1/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG occurred in fractions 4 to 6, while the main peak of VP1/EF-uPA(1-60)/HI-FLAG occurred in fractions 9 to 11.

The partially purified Py-VLPs derived from VP1/wt, VP1/HI-FLAG, VP1/EF-uPA(1-60)/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG were examined by transmission electron microscopy (Fig. 4). The VP1/wt, VP1/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG preparations contained mainly typical 50 nm VLPs, but only smaller particles approximately 20 nm in diameter were observed with VP1/EF-uPA(1-60)/HI-FLAG, suggesting that they might be 12-ICOSA structures (56). The partially purified Py-VLP preparations derived from VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG also contained a small amount of 20-nm particles (Fig. 4D and E), which increased concomitantly with the expression of VP1/EF-uPA(1-60)/HI-FLAG (data not shown). The 20-nm particles were infrequently observed in preparations of VP1/wt and VP1/HI-FLAG, as for example in the minor peaks (fraction 10) in Fig. 3.

View larger version (89K): [in this window] [in a new window]

FIG. 4. Transmission electron micrographs of Py-VLPs. Py-VLPs purified by sucrose sedimentation (A through D) or immunoprecipitation (E) were photographed with a magnification factor of 120,000. Bars, 50 (A) and 20 nm (C). (A) VP1/wt; (B) VP1/HI-FLAG; (C) VP1/EF-uPA(1-60)/HI-FLAG; (D and E) VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG.

To determine whether the VP1/HI-FLAG and VP1/EF-uPA(1-60)/HI-FLAG proteins assemble heterotypic Py-VLPs when coexpressed, the preparation was immunoprecipitated with the anti-uPA antibody and analyzed by Western blotting using the anti-VP1 antibody (Fig. 5). Both VP1/HI-FLAG and VP1-EF-uPA(1-60)/HI-FLAG were precipitated (Fig. 5B, lane 3), indicating that these two proteins occurred in the same particles. Immunoprecipitated Py-VLPs were not enriched in 20-nm particles, compared to those purified by sucrose sedimentation (Fig. 4D and E), indicating that the anti-uPA antibody bound both 50- and 20-nm particles. This supports the suggestion that 50-nm particles contain VP1/EF-uPA(1-60)/HI-FLAG and VP1/HI-FLAG.

View larger version (28K): [in this window] [in a new window]

FIG. 5. Immunoprecipitation of Py-VLPs. (A) Partially purified Py-VLPs were resuspended to approximately the same concentration and detected in Western blots with the anti-VP1 antibody. Lane 1, VP1/wt; lane 2, VP1/HI-FLAG; lane 3, VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG. (B) The VLPs from panel A were immunoprecipitated with the anti-uPA monoclonal antibody and detected by the anti-VP1 antibody. The weak signals in lanes 1 and 2 might be due to nonspecific binding of VP1 proteins to the resin, as we did not observe any cross-reactivity of the anti-uPA antibody to VP1/wt or VP1/HI-FLAG in Western blots (data not shown). Lanes are the same as for panel A.

Py-VLPs expressed in insect cells frequently contain cellular DNA (1, 20). Analysis of the partially purified Py-VLPs derived from VP1/wt, VP1/HI-FLAG, and VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG by agarose gel electrophoresis after DNase I treatment showed that they contained 5 kb of DNA (data not shown), indicating that heterotypic Py-VLPs are capable of packaging DNA.

Specific binding of heterotypic Py-VLPs to uPAR. Insertion of the FLAG epitope into the HI loop of VP1 was predicted to eliminate binding of the Py-VLPs to sialic acid (58-60) and the hemagglutination of red blood cells, as has been observed with the insertion of other foreign sequences (21, 22, 57, 62). Accordingly, the Py-VLPs derived by the self-assembly of VP1/HI-FLAG or VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG did not agglutinate red blood cells, unlike the Py-VLPs derived from VP1/wt (Fig. 6).

View larger version (27K): [in this window] [in a new window]

FIG. 6. Hemagglutination assay of Py-VLPs. Doubling dilutions of Py-VLPs (from left to right) mixed with guinea pig red blood cells are shown.

U-937 cells were chosen to assess the affinity of heterotypic VLPs for uPAR. Normally, these cells express only low levels of uPAR, but, upon stimulation with PMA, high levels of uPAR are induced (47, 61). Since VP1/wt binds to sialic acid expressed on many mammalian cells, Py-VLPs containing VP1/wt were expected to bind to U-937 cells regardless of whether they are stimulated by PMA (Fig. 7). VP1/HI-FLAG did not bind to U-937 cells in either case. Heterotypic VLPs composed of VP1/EF-uPA(1-60)/HI-FLAG and VP1/HI-FLAG bound to PMA-stimulated U-937 cells but not to unstimulated U-937 cells, and the binding was inhibited by purified uPA added as a competitor. Mutation of LDV, the putative integrin-binding motif, did not affect binding (data not shown). These results indicate that the binding to uPAR is caused by the uPA(1-60) sequence introduced into VP1 at the EF loop.

View larger version (52K): [in this window] [in a new window]

FIG. 7. Binding of Py-VLPs to uPAR expressed on the surfaces of U-937 cells. (A) Expression of uPAR by U-937 cells without (-) and with (+) stimulation by PMA was assessed by Western blotting with the anti-uPAR monoclonal antibody. (B) Partially purified Py-VLPs resuspended to approximately the same concentration were assessed by Western blotting with the anti-VP1 antibody. Lane 1, VP1/wt; lane 2, VP1/HI-FLAG; lane 3, VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG. (C and D) Py-VLPs bound to unstimulated (C) or stimulated (D) U-937 cells were assessed by Western blotting with the anti-VP1 antibody. The Py-VLPs composed of VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG bound to stimulated but not to unstimulated U-937 cells. Binding was reduced by the addition of uPA as a competitor (lane 4), leaving a weak signal from VP1/HI-FLAG. The signal from VP1/EF-uPA(1-60)/HI-FLAG was weaker than that from VP1/HI-FLAG (the relative amount of each protein in SDS-PAGE gel was shown in lane 8 of Fig. 2) and could hardly be detected. Lanes 1 to 3 are as for panel B; lane 4, VP1/EF-uPA(1-60)/HI-FLAG+VP1/HI-FLAG plus full-length uPA.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The BC, DE, EF, and HI loops of polyomavirus VP1 are surface-exposed and thus provide sites for the display of sequences that might bind to receptors on the surfaces of cells. Modification of the HI loop is attractive, in that the VP1 protein's native tropism for sialic acid binding can be disrupted concomitantly with the insertion of the foreign sequences, as was done here with the FLAG sequence. However, introduction of the WW domain into the HI loop prevented its correct folding and interfered with the formation of VLPs (57). For this sequence, the DE loop was a better insertion site than the HI loop. Also, the E. coli DHFR inserted into the HI loop reduced the efficiency of self-assembly and altered the properties of the VLPs (22).

In this study, four different sequences that bind to uPAR, the clone 20 peptide, uPA(10-34), uPA(1-60), and uPA(1-135), were inserted into sites in the four major surface-exposed loops of the polyomavirus VP1. Except for insertion of uPA(10-34) into the BC loop, the sequences had little effect on the expression of VP1, but they differed significantly in their effects on the solubility of VP1. The VP1 proteins that remained in the supernatant had peptide insertions in the EF loop, indicating that this loop tolerates greater sequence variability. Furthermore, uPA(1-60) introduced into the EF loop retained greater reactivity with the antibody than when it was introduced into the BC, DE, or HI loop. These data suggest that the EF loop, fairly isolated at the side of the pentamer, might be more flexible and accommodating of foreign sequences than the BC, DE, and HI loops, which are interlocked to form the top surface of the pentamer (58-60) and hence less flexible.

Our data and that published by others suggest that the size of a foreign sequence inserted into VP1 is a limiting factor for self-assembly into VLPs. Since the VLPs are composed of 360 copies of VP1, introduction of this many copies of a foreign sequence with the mass of E. coli DHFR or uPA(1-135) (18 and 15 kDa, respectively) may constrain assembly or proper folding. On the other hand, relatively small peptides such as the FLAG sequence, protein Z (6.8 kDa), and the WW domain (4 kDa) can be introduced without disrupting the self-assembly of VP1. A size constraint for insertion of foreign sequences into the papillomavirus L1 protein, which can accommodate no more than 60 amino acids without its self-assembly being affected, had been suggested (41). One way to overcome such a size constraint is by forming VLPs from two different modified VP1 proteins, one of which has a small insert. For example, while VP1/EF-uPA(1-60)/HI-FLAG could not form normal VLPs, it was able to do so when expressed with VP1/HI-FLAG.

Another factor to be considered in Py-VLP formation is the hydrophobicity of the foreign sequence introduced into VP1. Short anionic sequences on the surface of a VLP have the least likelihood of interfering with the ionic character of the native polyomavirus surface, which is mainly negatively charged in neutral and alkaline solutions (64). The FLAG sequence, containing five negatively charged aspartates, is most likely an ideal sequence to be displayed on the surface of polyomavirus VLPs and other virus assemblies (34). The polyanionic adapter (E8C) is also mainly negatively charged (62) and should be relatively easy to display on the surfaces of polyomavirus VLPs. In contrast, hydrophobic sequences derived from or mimicking uPA caused problems in expression of modified VP1, with VP1/EF-uPA(1-60) retaining only moderate solubility and VP1/EF-uPA(1-135) retaining even less. The uPA(1-135) sequence alone is expressed in inclusion bodies in E. coli (50) and as an insoluble form in insect cells (data not shown). It might also be difficult for uPA(1-135) to fold correctly when it is introduced into the VP1 protein. The solubility of recombinant adenovirus capsids, which also was dependent on the ligand introduced into the capsid, was strongly correlated with the production of viable virus (38).

Binding of Py-VLPs to sialic acid is mediated by the BC1 and HI loops of VP1, but disruption of the HI loop alone by the insertion of a foreign peptide sequence resulted in a total loss of binding. Disruption of the BC1 loop is likely to have a similar effect. The binding of polyomavirus VLPs to U-937 cells before the mutation of the LDV integrin-binding motif was not noticeably different from that after the mutation (data not shown), consistent with the suggestion that the interaction of the LDV motif and integrin might occur after the initial binding with sialic acids on the cell surface (6).

Binding of Py-VLPs containing uPA(1-60) to uPAR is the first example of targeting a polyomavirus to a cellular receptor expressed on a particular cell type. Polyomavirus virions are internalized via caveolae (54) or yet-unidentified vesicles (19) after initial attachment to the sialic acids of an unidentified protein receptor. The 4ß1 integrin is thought to be involved in this process, facilitating the internalization of virions (6). VLPs targeted to the erbB-2 receptor, which is not internalized, are still directed to the nucleus for efficient transgene expression even though they lack sialic acid-binding capacity (62). This suggests that modified polyomavirus VLPs employ a specific internalization pathway that is independent of the pathway(s) normally utilized by the receptors to which they are directed. It will be interesting to investigate the internalization process of uPAR-binding polyomavirus VLPs, because both uPAR and polyomavirus have their own distinctive internalization pathways involving clathrin-coated vesicles (11) and caveolae (54), respectively.

The formation of heterotypic VLPs affords the opportunity to develop polyvalent vectors in which multiple ligands can be displayed simultaneously on one particle. In principle, employing multiple ligands should combinatorially increase the specificity for a particular cell or tissue type. Peptide sequences that can be used to target specific cell types include the epidermal growth factor (EGF)-like domain of heregulin, composed of 60 amino acids and known to sufficient for the binding to the EGF receptor (35), which is expressed on many breast cancer cells (49). Alternatively the C-terminal 21 amino acids of gastrin-releasing protein have proved their potential in targeting its receptor (23), which is overexpressed in a variety of carcinomas and melanomas (40, 44, 67). It is feasible to incorporate these compact ligands into heterotypic VLPs in combination with other ligands such as uPA(1-60) to increase the specificity of targeting certain cell types. The enhanced specificity of polyvalent VLPs might also be valuable in imaging cancer cells that express multiple tumor-associated antigens. Efforts to explore these possibilities are under way.

Another likely use of heterotypic VLPs will be as carriers of multiple antigenic epitopes. It is known that VLP elicits an immune response to a virus with inherent adjuvant activity and thus might be applied to the preparation of vaccines. In fact, VLPs of the human immunodeficiency virus (HIV) Gag protein (25), bovine papillomavirus L1 protein (45), and hepatitis virus surface antigen (65) have proven to be efficient antigen delivery tools. Especially in the work of Liu et al. (37), multiple cytotoxic T-lymphocyte epitopes were introduced at the C terminus of the L1 protein to induce simultaneous immune responses against HIV and human papillomavirus. But the utility of the L1 protein as a polyvalent carrier is limited, for only up to 60 amino acids can be introduced without affecting VLP self-assembly. Even though polyomavirus VLPs exhibited a similar size limitation, the formation of heterotypic VLPs might overcome this limitation because such VLPs can be formed by several kinds of VP1 proteins having different peptide inserts.

 
We thank the members of the Folk laboratory for their helpful suggestions during the research and Sarah Scanlon for her invaluable assistance. We also thank Mark Martin, University of Missouri, Columbia, for providing the pET-15b-VP1/wt plasmid and Richard A. Consigli, Kansas State University, Manhattan, for his kind gift of the anti-VP1 antibody. The electron microscopy was performed with the assistance of staff in the Molecular Biology Electron Microscopy core of the University of Missouri-Columbia.

Support was provided by U.S. Army Medical Research and Materiel Command grant DAMD17-98-1-8321.

 
* Corresponding author. Mailing address: Department of Biochemistry, 117 Schweitzer Hall, University of Missouri-Columbia, Columbia, MO 65211. Phone: (573) 882-2841. Fax: (573) 884-4808. E-mail: folkw{at}missouri.edu.

Present address: Tumor Virology Division, New England Regional Primate Research Center, Southborough, Mass.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. An, K., E. T. Gillock, J. A. Sweat, W. M. Reeves, and R. A. Consigli. 1999. Use of the baculovirus system to assemble polyomavirus capsid-like particles with different polyomavirus structural proteins: analysis of the recombinant assembled capsid-like particles. J. Gen. Virol. 80:1009-1016.[Abstract]
2
2. Appella, E., E. A. Robinson, S. J. Ullrich, M. P. Stoppelli, A. Corti, G. Cassani, and F. Blasi. 1987. The receptor-binding sequence of urokinase. A biological function for the growth-factor module of proteases. J. Biol. Chem. 262:4437-4440.[Abstract/Free Full Text]
3
3. Bauer, P. H., R. T. Bronson, S. C. Fung, R. Freund, T. Stehle, S. C. Harrison, and T. L. Benjamin. 1995. Genetic and structural analysis of a virulence determinant in polyomavirus VP1. J. Virol. 69:7925-7931.[Abstract]
4
4. Braun, H., K. Boller, J. Lower, W. M. Bertling, and A. Zimmer. 1999. Oligonucleotide and plasmid DNA packaging into polyoma VP1 virus-like particles expressed in Escherichia coli. Biotechnol. Appl. Biochem. 29:31-43.
5
5. Busso, N., S. K. Masur, D. Lazega, S. Waxman, and L. Ossowski. 1994. Induction of cell migration by pro-urokinase binding to its receptor: possible mechanism for signal transduction in human epithelial cells. J. Cell Biol. 126:259-270.[Abstract/Free Full Text]
6
6. Caruso, M., L. Belloni, O. Sthandier, P. Amati, and M. I. Garcia. 2003. 4ß1 integrin acts as a cell receptor for murine polyomavirus at the postattachment level. J. Virol. 77:3913-3921.[Abstract/Free Full Text]
7
7. Chapman, H. A. 1997. Plasminogen activators, integrins, and the coordinated regulation of cell adhesion and migration. Curr. Opin. Cell Biol. 9:714-724.[CrossRef][Medline]
8
8. Chen, M. H., and T. Benjamin. Roles of N-glycans with alpha2, 6 as well as alpha2, 3 linked sialic acid in infection by polyoma virus. Virology 233:440-442.
9
9. Chiaradonna, F., L. Fontana, C. Iavarone, M. V. Carriero, G. Scholz, M. V. Barone, and M. P. Stoppelli. 1999. Urokinase receptor-dependent and -independent p56/59(hck) activation state is a molecular switch between myelomonocytic cell motility and adherence. EMBO J. 18:3013-3023.[CrossRef][Medline]
10
10. Crowley, C. W., R. L. Cohen, B. K. Lucas, G. Liu, M. A. Shuman, and A. D. Levinson. 1993. Prevention of metastasis by inhibition of the urokinase receptor. Proc. Natl. Acad. Sci. USA 90:5021-5025.[Abstract/Free Full Text]
11
11. Czekay, R. P., T. A. Kuemmel, R. A. Orlando, and M. G. Farquhar. 2001. Direct binding of occupied urokinase receptor (uPAR) to LDL receptor-related protein is required for endocytosis of uPAR and regulation of cell surface urokinase activity. Mol. Biol. Cell 12:1467-1479.[Abstract/Free Full Text]
12
12. Drapkin, P. T., C. R. O'Riordan, S. M. Yi, J. A. Chiorini, J. Cardella, J. Zabner, and M. J. Welsh. 2000. Targeting the urokinase plasminogen activator receptor enhances gene transfer to human airway epithelia. J. Clin. Investig. 105:589-596.[Medline]
13
13. Estreicher, A., J. Muhlhauser, J. L. Carpentier, L. Orci, and J. D. Vassalli. 1990. The receptor for urokinase type plasminogen activator polarizes expression of the protease to the leading edge of migrating monocytes and promotes degradation of enzyme inhibitor complexes. J. Cell Biol. 111:783-792.[Abstract/Free Full Text]
14
14. Fazioli, F., M. Resnati, N. Sidenius, Y. Higashimoto, E. Appella, and F. Blasi. 1997. A urokinase-sensitive region of the human urokinase receptor is responsible for its chemotactic activity. EMBO J. 16:7279-7286.[CrossRef][Medline]
15
15. Fibbi, G., M. Ziche, L. Morbidelli, L. Magnelli, and M. Del Rosso. 1988. Interaction of urokinase with specific receptors stimulates mobilization of bovine adrenal capillary endothelial cells. Exp. Cell Res. 179:385-395.[CrossRef][Medline]
16
16. Forstova, J., N. Krauzewicz, V. Sandig, J. Elliott, Z. Palkova, M. Strauss, and B. E. Griffin. 1995. Polyoma virus pseudocapsids as efficient carriers of heterologous DNA into mammalian cells. Hum. Gene Ther. 6:297-306.[Medline]
17
17. Freund, R., A. Calderone, C. J. Dawe, and T. L. Benjamin. 1991. Polyomavirus tumor induction in mice: effects of polymorphisms of VP1 and large T antigen. J. Virol. 65:335-341.[Abstract/Free Full Text]
18
18. Fried, H., L. D. Cahan, and J. C. Paulson. 1981. Polyoma virus recognizes specific sialyligosaccharide receptors on host cells. Virology 109:188-192.[CrossRef][Medline]
19
19. Gilbert, J. M., and T. L. Benjamin. 2000. Early steps of polyomavirus entry into cells. J. Virol. 74:8582-8588.[Abstract/Free Full Text]
20
20. Gillock, E. T., S. Rottinghaus, D. Chang, X. Cai, S. A. Smiley, K. An, and R. A. Consigli. 1997. Polyomavirus major capsid protein VP1 is capable of packaging cellular DNA when expressed in the baculovirus system. J. Virol. 71:2857-2865.[Abstract]
21
21. Gleiter, S., and H. Lilie. 2001. Coupling of antibodies via protein Z on modified polyoma virus-like particles. Protein Sci. 10:434-444.[CrossRef][Medline]
22
22. Gleiter, S., K. Stubenrauch, and H. Lilie. 1999. Changing the surface of a virus shell fusion of an enzyme to polyoma VP1. Protein Sci. 8:2562-2569.[Medline]
23
23. Gollan, T. J., and M. R. Green. 2002. Selective targeting and inducible destruction of human cancer cells by retroviruses with envelope proteins bearing short peptide ligands. J. Virol. 76:3564-3569.[Abstract/Free Full Text]
24
24. Goodson, R. J., M. V. Doyle, S. E. Kaufman, and S. Rosenberg. 1994. High-affinity urokinase receptor antagonists identified with bacteriophage peptide display. Proc. Natl. Acad. Sci. USA 91:7129-7133.[Abstract/Free Full Text]
25
25. Griffiths, J. C., S. J. Harris, G. T. Layton, E. L. Berrie, T. J. French, N. R. Burns, S. E. Adams, and A. J. Kingsman. 1993. Hybrid human immunodeficiency virus Gag particles as an antigen carrier system: induction of cytotoxic T-cell and humoral responses by a Gag:V3 fusion. J. Virol. 67:3191-3198.[Abstract/Free Full Text]
26
26. Gross, T. J., R. H. Simon, and R. G. Sitrin. 1990. Expression of urokinase-type plasminogen activator by rat pulmonary alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol. 3:449-456.
27
27. Gudewicz, P. W., and N. Gilboa. 1987. Human urokinase-type plasminogen activator stimulates chemotaxis of human neutrophils. Biochem. Biophys. Res. Commun. 147:1176-1181.[Medline]
28
28. Gyetko, M. R., R. F. Todd III, C. C. Wilkinson, and R. G. Sitrin. 1994. The urokinase receptor is required for human monocyte chemotaxis in vitro. J. Clin. Investig. 93:1380-1387.
29
29. Hearing, V. J., L. W. Law, A. Corti, E. Appella, and F. Blasi. 1988. Modulation of metastatic potential by cell surface urokinase of murine melanoma cells. Cancer Res. 48:1270-1278.[Abstract/Free Full Text]
30
30. Hollas, W., N. Hoosein, L. W. Chung, A. Mazar, J. Henkin, K. Kariko, E. S. Barnathan, and D. Boyd. 1992. Expression of urokinase and its receptor in invasive and non-invasive prostate cancer cell lines. Thromb. Haemost. 68:662-666.[Medline]
31
31. Hoosein, N. M., D. D. Boyd, W. J. Hollas, A. Mazar, J. Henkin, and L. W. Chung. 1991. Involvement of urokinase and its receptor in the invasiveness of human prostatic carcinoma cell lines. Cancer Commun. 3:255-264.[Medline]
32
32. Jankun, J., H. W. Merrick, and P. J. Goldblatt. 1993. Expression and localization of elements of the plasminogen activation system in benign breast disease and breast cancers. J. Cell. Biochem. 53:135-144.[CrossRef][Medline]
33
33. Kobayashi, H., H. Ohi, H. Shinohara, M. Sugimura, T. Fujii, T. Terao, M. Schmitt, L. Goretzki, N. Chucholowski, and F. Janicke. 1993. Saturation of tumour cell surface receptors for urokinase-type plasminogen activator by amino-terminal fragment and subsequent effect on reconstituted basement membranes invasion. Br. J. Cancer 67:537-544.[Medline]
34
34. Krasnykh, V., I. Dmitriev, G. Mikheeva, C. R. Miller, N. Belousova, and D. T. Curiel. 1998. Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. J. Virol. 72:1844-1852.[Abstract/Free Full Text]
35
35. Landgraf, R., M. Pegram, D. J. Slamon, and D. Eisenberg. 1998. Cytotoxicity and specificity of directed toxins composed of diphtheria toxin and the EGF-like domain of heregulin beta1. Biochemistry 37:3220-3228.[CrossRef][Medline]
36
36. Liddington, R. C., Y. Yan, J. Moulai, R. Sahli, T. L. Benjamin, and S. C. Harrison. 1991. Structure of simian virus 40 at 3.8-A resolution. Nature 354:278-284.[CrossRef][Medline]
37
37. Liu, W. J., X. S. Liu, K. N. Zhao, G. R. Leggatt, and I. H. Frazer. 2000. Papillomavirus virus-like particles for the delivery of multiple cytotoxic T cell epitopes. Virology 273:374-382.[CrossRef][Medline]
38
38. Magnusson, M. K., S. S. Hong, P. Henning, P. Boulanger, and L. Lindholm. 2002. Genetic retargeting of adenovirus vectors: functionality of targeting ligands and their influence on virus viability. J. Gene Med. 4:356-370.[CrossRef][Medline]
39
39. Mezes, B., and P. Amati. 1994. Mutations of polyomavirus VP1 allow in vitro growth in undifferentiated cells and modify in vivo tissue replication specificity. J. Virol. 68:1196-1199.[Abstract/Free Full Text]
40
40. Miyazaki, M., N. Lamharzi, A. V. Schally, G. Halmos, K. Szepeshazi, K. Groot, and R. Z. Cai. 1998. Inhibition of growth of MDA-MB-231 human breast cancer xenografts in nude mice by bombesin/gastrin-releasing peptide (GRP) antagonists RC-3940-II and RC-3095. Eur. J. Cancer 34:710-717.
41
41. Muller, M., J. Zhou, T. D. Reed, C. Rittmuller, A. Burger, J. Gabelsberger, J. Braspenning, and L. Gissmann. 1997. Chimeric papillomavirus-like particles. Virology 234:93-111.[CrossRef][Medline]
42
42. Nusrat, A. R., and H. A. Chapman, Jr. 1991. An autocrine role for urokinase in phorbol ester-mediated differentiation of myeloid cell lines. J. Clin. Investig. 87:1091-1097.
43
43. Ossowski, L. 1988. In vivo invasion of modified chorioallantoic membrane by tumor cells: the role of cell surface-bound urokinase. J. Cell Biol. 107:2437-2445.[Abstract/Free Full Text]
44
44. Pansky, A., F. Peng, M. Eberhard, L. Baselgia, W. Siegrist, J. B. Baumann, A. N. Eberle, C. Beglinger, and P. Hildebrand. 1997. Identification of functional GRP-preferring bombesin receptors on human melanoma cells. Eur. J. Clin. Investig. 27:69-76.[CrossRef][Medline]
45
45. Peng, S., I. H. Frazer, G. J. Fernando, and J. Zhou. 1998. Papillomavirus virus-like particles can deliver defined CTL epitopes to the MHC class I pathway. Virology 240:147-157.[CrossRef][Medline]
46
46. Pepper, M. S., A. P. Sappino, R. Stocklin, R. Montesano, L. Orci, and J. D. Vassalli. 1993. Upregulation of urokinase receptor expression on migrating endothelial cells. J. Cell Biol. 122:673-684.[Abstract/Free Full Text]
47
47. Picone, R., E. L. Kajtaniak, L. S. Nielsen, N. Behrendt, M. R. Mastronicola, M. V. Cubellis, M. P. Stoppelli, S. Pedersen, K. Dano, and F. Blasi. 1989. Regulation of urokinase receptors in monocytelike U937 cells by phorbol ester phorbol myristate acetate. J. Cell Biol. 108:693-702.[Abstract/Free Full Text]
48
48. Plesner, T., M. Ploug, V. Ellis, E. Ronne, G. Hoyer-Hansen, M. Wittrup, T. L. Pedersen, T. Tscherning, K. Dano, and N. E. Hansen. 1994. The receptor for urokinase-type plasminogen activator and urokinase is translocated from two distinct intracellular compartments to the plasma membrane on stimulation of human neutrophils. Blood 83:808-815.[Abstract/Free Full Text]
49
49. Plowman, G. D., J. M. Culouscou, G. S. Whitney, J. M. Green, G. W. Carlton, L. Foy, M. G. Neubauer, and M. Shoyab. 1993. Ligand-specific activation of HER4/p180erbB4, a fourth member of the epidermal growth factor receptor family. Proc. Natl. Acad. Sci. USA 90:1746-1750.[Abstract/Free Full Text]
50
50. Rajagopal, V., and R. J. Kreitman. 2000. Recombinant toxins that bind to the urokinase receptor are cytotoxic without requiring binding to the alpha(2)-macroglobulin receptor. J. Biol. Chem. 275:7566-7573.[Abstract/Free Full Text]
51
51. Rayment, I., T. S. Baker, D. L. Caspar, and W. T. Murakami. 1982. Polyoma virus capsid structure at 22.5 A resolution. Nature 295:110-115.
52
52. Resnati, M., M. Guttinger, S. Valcamonica, N. Sidenius, F. Blasi, and F. Fazioli. 1996. Proteolytic cleavage of the urokinase receptor substitutes for the agonist-induced chemotactic effect. EMBO J. 15:1572-1582.[Medline]
53
53. Ricci, L., R. Maione, C. Passananti, A. Felsani, and P. Amati. 1992. Mutations in the VP1 coding region of polyomavirus determine differentiating stage specificity. J. Virol. 66:7153-7158.[Abstract/Free Full Text]
54
54. Richterova, Z., D. Liebl, M. Horak, Z. Palkova, J. Stokrova, P. Hozak, J. Korb, and J. Forstova. 2001. Caveolae are involved in the trafficking of mouse polyomavirus virions and artificial VP1 pseudocapsids toward cell nuclei. J. Virol. 75:10880-10891.[Abstract/Free Full Text]
55
55. Salunke, D. M., D. L. Caspar, and R. L. Garcea. 1986. Self-assembly of purified polyomavirus capsid protein VP1. Cell. 46:895-904.[CrossRef][Medline]
56
56. Salunke, D. M., D. L. Caspar, and R. L. Garcea. 1989. Polymorphism in the assembly of polyomavirus capsid protein VP1. Biophys. J. 56:887-900.[Medline]
57
57. Schmidt, U., R. Rudolph, and G. Bohm. 2001. Binding of external ligands onto an engineered virus capsid. Protein Eng. 14:769-774.[Abstract/Free Full Text]
58
58. Stehle, T., and S. C. Harrison. 1996. Crystal structures of murine polyomavirus in complex with straight-chain and branched-chain sialyloligosaccharide receptor fragments. Structure 4:183-194.[Medline]
59
59. Stehle, T., and S. C. Harrison. 1997. High-resolution structure of a polyomavirus VP1-oligosaccharide complex: implications for assembly and receptor binding. EMBO J. 16:5139-5148.[CrossRef][Medline]
60
60. Stehle, T., Y. Yan, T. L. Benjamin, and S. C. Harrison. 1994. Structure of murine polyomavirus complexed with an oligosaccharide receptor fragment. Nature 369:160-163.[CrossRef][Medline]
61
61. Stoppelli, M. P., A. Corti, A. Soffientini, G. Cassani, F. Blasi, and R. K. Assoian. 1985. Differentiation-enhanced binding of the amino-terminal fragment of human urokinase plasminogen activator to a specific receptor on U937 monocytes. Proc. Natl. Acad. Sci. USA 82:4939-4943.[Abstract/Free Full Text]
62
62. Stubenrauch, K., S. Gleiter, U. Brinkmann, R. Rudolph, and H. Lilie. 2001. Conjugation of an antibody Fv fragment to a virus coat protein: cell-specific targeting of recombinant polyoma-virus-like particles. Biochem. J. 356:867-873.[CrossRef][Medline]
63
63. Testa, J. E., and J. P. Quigley. 1990. The role of urokinase-type plasminogen activator in aggressive tumor cell behavior. Cancer Metastasis Rev. 9:353-367.[CrossRef][Medline]
64
64. Thorne, H. V., W. House, and A. L. Kisch. 1965. Electrophoretic properties and purification of large and small plaque-forming strains of polyoma virus. Virology 27:37-43.[CrossRef][Medline]
65
65. Tindle, R. W., K. Herd, P. Londono, G. J. Fernando, S. N. Chatfield, K. Malcolm, and G. Dougan. 1994. Chimeric hepatitis B core antigen particles containing B- and Th-epitopes of human papillomavirus type 16 E7 protein induce specific antibody and T-helper responses in immunised mice. Virology 200:547-557.[CrossRef][Medline]
66
66. Wei, Y., D. A. Waltz, N. Rao, R. J. Drummond, S. Rosenberg, and H. A. Chapman. 1994. Identification of the urokinase receptor as an adhesion receptor for vitronectin. J. Biol. Chem. 269:32380-32388.[Abstract/Free Full Text]
67
67. Yano, T., J. Pinski, K. Groot, and A. V. Schally. 1992. Stimulation by bombesin and inhibition by bombesin/gastrin-releasing peptide antagonist RC-3095 of growth of human breast cancer cell lines. Cancer Res. 52:4545-4547.[Abstract/Free Full Text]

---

Journal of Virology, November 2003, p. 11491-11498, Vol. 77, No. 21
0022-538X/03/$08.00+0     DOI: 10.1128/JVI.77.21.11491-11498.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Shin, Y. C. Articles by Folk, W. R. Search for Related Content PubMed PubMed Citation Articles by Shin, Y. C. Articles by Folk, W. R.