Previous Article | Next Article ![]()
Journal of Virology, January 2003, p. 1571-1577, Vol. 77, No. 2
0022-538X/03/$08.00+0 DOI: 10.1128/JVI.77.2.1571-1577.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Cirad, Programme Santé Animale, Campus International de Baillarguet, 34398 Montpellier Cedex 05, France,1 Institute of Animal Health, Pirbright Laboratory, Pirbright, Surrey GU 24 ONF, United Kingdom,2 LANAVET, Garoua, Cameroon3
Received 19 June 2002/ Accepted 17 October 2002
|
|
|---|
|
|
|---|
PPRV, like other viruses in the family Paramyxoviridae, is an enveloped RNA virus with two external glycoproteins, F and H, associated with the envelope. The F protein enables the virus to penetrate the cell membrane and enter the cytoplasm by effecting fusion of the virus and host cell membranes. This phenomenon is also responsible for virus spread from cell to cell without the formation of free viral particles, and this protein is critical for the induction of an effective protective immune response (4, 13, 16, 17). The F proteins of several morbilliviruses have been expressed in different poxviruses by using recombinant DNA technology, and the resultant viruses have proven to be effective vaccines (1, 2, 8, 21, 22, 25, 26, 28-30). Here we report the insertion of the F gene of PPRV into the genome of the attenuated capripoxvirus strain KS-1.
The cDNA corresponding to the PPRV F gene was released by enzymatic digestion from plasmid FNYZ12 as previously described (18). It was subcloned into plasmid JC-35, which contains the vaccinia virus early/late p7.5 promoter. The insertion was made so that, in the new plasmid, FPJ2, expression of the PPRV F protein gene was driven by this promoter. The Escherichia coli xanthine-guanine -phosphoribosyltransferase gene (gpt) was used as a dominant-selectable marker to isolate the recombinant (3, 9). This gene is under the control of a p7.5 promoter in the plasmid GPT. It was released from that plasmid and inserted into FPJ2 in a way to place the two promoters back to back. From this final construct, the E. coli gpt-p7.5-p7.5-PPR F cassette was released by enzymatic digestion and inserted into the plasmid pKH66T at the KpnI site of the gene coding for capripoxvirus thymidine kinase (TK). Indeed, pKH66T contains the HindIII S fragment of KS-1 DNA, which encompasses the complete TK gene of capripoxvirus KS-1 (10). The final construct was used to generate recombinant viruses with the capripoxvirus KS-1 in lamb testis (LT) cells as described previously (22). The virus suspension obtained following transfection of capripoxvirus-infected cells with the insertion plasmid was used to select the recombinants. This was done in the presence of the E. coli gpt selection medium containing mycophenolic acid (MPA) (22). However, while the previous authors were confirming the nature of their clones by DNA probes, we adopted a faster PCR-based method that could be performed directly on the samples without the need for DNA extraction. For that, we used both capripoxvirus TK and PPRV F gene-specific primers (CPTK7 and CPTK8 and F1ab and F2ab, respectively) (Fig. 1). Five microliters of each sample to be tested was used directly in the PCR, which consisted of 10 µl of 10x Pfu buffer, deoxynucleoside triphosphates (dNTPs [250 µM each]), 25 pmol of each primer, and 2.5 U of Pfu polymerase (Stratagene) in a total volume of 100 µl. The PCR was carried out under the following conditions: a first step at 94°C for 5 min; 30 cycles of amplification, each consisting of 94°C for 1 min, 50°C for 1 min, and 72°C for 3 min; and a final step at 4°C to keep the samples. Fifteen microliters of the amplified products was analyzed by electrophoresis on agarose gels. The primers CPTK7 and CPTK8, located in the TK gene of the capripoxvirus strain KS-1 at each side of the insertion site, amplify a fragment about 600 nucleotides long in the absence of a foreign gene insert. The PPRV F gene insert is about 2,400 nucleotides long and is very GC rich (18); therefore, the expected size of the target to be amplified by the primers CPTK7 and CPTK8 in the recombinant would be about 3,000 nucleotides. The conditions used for the PCR allow amplification of the 600-nucleotide target, but not a target of 3,000 nucleotides. Thus, in the case of a recombinant, the PCR with primers CPTK7 and CPTK8 will be negative, while it should give a product of 300 nucleotides amplified on the PPRV F gene with primers F1ab and F2ab. Figure 1A shows the DNA amplified from samples collected at different steps in the procedures of recombinant selection. As can been seen (lanes 1 to 6), a clone that was obtained was still contaminated with parental virus even after three plaque purifications and two rounds of growth in selection medium. The PCR test was positive with both pairs of primers (lanes TK and F). Similar results were obtained with five other selected clones. We presumed that capripoxviruses have a high tendency to form clumps, and by this means, the recombinant viruses, which can grow in the selection medium MPA, could act as a helper virus and allow replication of parental virus in the same clump. We therefore modified the selection method to include a sonication step. One milliliter of the stock virus suspension was submitted to sonication for 30 s in a water bath sonicator with the power set at 15 W (Ultrasonic Processor, Bioblock Scientific). After sonication, 10-fold serial dilutions of the sample were made from 10-1 to 10-7. Confluent LT cells in 96-well plates were preincubated in selection medium for 16 h and then infected with 200 µl of diluted virus suspension (2 wells per dilution). After 10 days of incubation at 37°C, the supernatants from wells from the most dilute suspensions showing a virus cytopathic effect were harvested. These were then subjected to another round of limiting dilution selection and plaque purification. The virus material collected at each step of the purification process was always sonicated to ensure that the virus was not clumped, and its purity was checked by PCR. No DNA amplification was obtained with the TK primers after the second limiting dilution selection (Fig. 1B, lanes 3Tk, 4Tk, and 5Tk), while the presence of the PPRV F protein gene was still detected by primers F1ab and F2ab (Fig. 1B, lanes 3F, 4F, and 5F).
![]() View larger version (78K): [in a new window] |
FIG. 1. Screening of the recombinant virus clones by PCR. Primers CPTK7 (5' ACTTATCAGATTTTGTTACGACATT) and CPTK8 (5' CGATGAGTTCTATTTCCTTTTCTTTAG) were located in the TK gene of capripoxvirus strain KS-1 at each side of the insertion site KpnI. Primers F1ab (5' ATGCTCTGTCAGTGATAACC) and F2ab (5' TTATGGACAG AAGGGACAAG) were located in the PPRV F gene. The PCR products obtained with these primers from samples collected during the different steps of the recombinant virus selection process were analyzed by agarose gel electrophoresis (see the text). The samples amplified with the capripoxvirus TK primers are indicated by TK, while those amplified with the PPRV fusion protein gene primers are in lanes F. M, molecular size markers (100-bp ladders); TKc, positive control capripoxvirus DNA; Fc, positive control PPRV F cDNA; N, negative control (no DNA template). (A) Samples from the first method. Sample 1 is the starting virus stock suspension to be screened for the recombinants. Samples 2, 3, and 4 are from three successive plaque purifications. Samples 5 and 6 are from two successive growth rounds of sample 4 in selection medium. (B) Samples from the second method. Sample 1 is the starting virus stock suspension to be screened for the recombinant. Samples 2 and 3 are from two successive limiting dilution purifications. Sample 4 is a clone collected by plaque purification of sample 4. Sample 5 is aliquot of the virus suspension obtained by one growth round of sample 4 in the selection medium.
|
![]() View larger version (54K): [in a new window] |
FIG. 2. Detection of the PPRV F protein by immunofluorescence staining. LT cells were infected with the recombinant reCapPPR/F (A) or the parental capripoxvirus KS1 (B). Two days after infection, the cells were submitted to indirect immunofluorescence staining with the anti-PPRV F MAb as described by Romero et al. (22), but without Triton treatment.
|
![]() ![]() ![]() ![]() ![]() View larger version (82K): [in a new window] |
FIG. 3. Determination of the minimum effective dose of the recombinant vaccine represented by daily rectal temperatures of goats following challenge with virulent PPRV. Goats were vaccinated with different doses of the recombinant virus reCapPPR/F and challenged 1 month later with the virulent PPRV Guinée Bissau/89 isolate as indicated in the text. Shown are results for unvaccinated animals (A) and animals vaccinated with 0.1 (B), 10 (C), 100 (D), and 10,000 (E) PFU of the recombinant virus reCapPPR/F.
|
50%). Total RNA extracted from these cells was assayed with a reverse transcription-PCR to detect nucleocapsid protein gene-specific RNA of the challenge virus (5). The quality of the RNA was determined by amplifying a fragment of the cellular ß-actin gene by using actin-specific primers. As can be seen in Table 2, PPRV nucleic acid was detected in the WBC from all three unvaccinated animals from day 5 or 7 after challenge. However, in the case of 6 of the 12 vaccinated goats, no DNA amplification could be obtained with the PPRV primers, while the same samples were positive for the ß-actin gene RNA, indicating the integrity of the RNA extracts. For the remaining six vaccinated goats, PPRV nucleic acid was detected in only one or two postchallenge samples. Blood for serum antibody analysis was collected weekly following vaccination and challenge. The sera were analyzed for PPRV-specific antibodies by using an F protein-based competitive enzyme-linked immunosorbent assay (cELISA) (Table 3). All were negative before challenge. However, following challenge, an anamnestic response was observed after 1 week, indicating that replication of the challenge virus had occurred. One month after PPRV challenge, the surviving animals and those in group V, in addition to three new control goats, were submitted to capripoxvirus challenge by intradermal inoculation of 0.2 ml of virulent capripoxvirus (Yemen isolate). The animals were examined daily for 2 weeks to observe their clinical reactions. The control goats, as expected, developed capripox disease, while all of the others resisted. |
View this table: [in a new window] |
TABLE 1. Percentage reduction in WBC counts in goats following challenge with virulent PPRV
|
|
View this table: [in a new window] |
TABLE 2. Detection of PPRV N gene-specific RNA by RT-PCR in WBC collected from goats after challenge with virulent PPRVa
|
|
View this table: [in a new window] |
TABLE 3. Serological responses in goats following challenge with virulent PPRVa
|
Capripoxvirus is a highly host-specific virus, the host range being limited to cattle and small ruminants. It is nonpathogenic to humans, and so it is an ideal vector for the development of recombinant vaccines for use against ruminant diseases. The results reported here indicate that a capripoxvirus recombinant that expresses the PPR F protein can protect goats against two diseases that are of great economic importance in many developing countries: PPR and capripox. The possibility of dual vaccines made by such recombinants and providing efficacy at doses as low as 0.1 PFU would dramatically cut the cost of controlling these diseases by vaccination. However, more work is needed to establish the duration of immunity provided by this vaccine and to test its efficacy in presence of antibodies against capripoxvirus or PPRV. This work is now in progress.
We thank Gerrit Viljoen (OVI, South Africa) for helpful discussions during the course of this work.
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»