This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Connolly, S. A.
Right arrow Articles by Eisenberg, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Connolly, S. A.
Right arrow Articles by Eisenberg, R. J.

 Previous Article  |  Next Article 

Journal of Virology, July 2003, p. 8127-8140, Vol. 77, No. 14
0022-538X/03/$08.00+0     DOI: 10.1128/JVI.77.14.8127-8140.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Structure-Based Mutagenesis of Herpes Simplex Virus Glycoprotein D Defines Three Critical Regions at the gD-HveA/HVEM Binding Interface

Sarah A. Connolly,1,2* Daniel J. Landsburg,1,2 Andrea Carfi,3 Don C. Wiley,4,{dagger} Gary H. Cohen,1 and Roselyn J. Eisenberg2

Department of Microbiology, School of Dental Medicine,1 Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104,2 Istituto di Ricerche di Biologia Molecolare P. Angeletti, Rome, Italy,3 Department of Molecular and Cellular Biology, Howard Hughes Medical Institute, Harvard University, Cambridge, Massachusetts 021384

Received 7 March 2003/ Accepted 30 April 2003


arrow
ABSTRACT
 
Herpes simplex virus (HSV) entry into cells requires the binding of glycoprotein D (gD) to one of several cell surface receptors. The crystal structure of gD bound to one of these receptors, HveA/HVEM, reveals that the core of gD comprises an immunoglobulin fold flanked by a long C-terminal extension and an N-terminal hairpin loop. HveA is a member of the tumor necrosis factor receptor family and contains four cysteine-rich domains (CRDs) characteristic of this family. Fourteen amino acids within the gD N-terminal loop comprise the entire binding site for HveA. To determine the contribution of each gD contact residue to virus entry, we constructed gD molecules mutated in these amino acids. We determined the abilities of the gD mutants to bind receptors, facilitate virus entry, and mediate cell-cell fusion. Seven of the gD mutants exhibited wild-type levels of receptor binding and gD function. Results from the other seven gD mutants revealed three critical regions at the gD-HveA interface. (i) Several gD residues that participate in an intermolecular ß-sheet with HveA were found to be crucial for HveA binding and entry into HveA-expressing cells. (ii) Two gD residues that contact HveA-Y23 contributed to HveA binding but were not required for mediating entry into cells. HveA-Y23 fits into a crevice on the surface of gD and was previously shown to be essential for gD binding. (iii) CRD2 was previously shown to contribute to gD binding, and this study shows that one gD residue that contacts CRD2 contributes to HveA binding. None of the gD mutations prevented interaction with nectin-1, another gD receptor. However, when cotransfected with the other glycoproteins required for fusion, two gD mutants gained the ability to mediate fusion of cells expressing nectin-2, a gD receptor that interacts with several laboratory-derived gD mutants but not with wild-type gD. Thus, results from this panel of gD mutants as well as those of previous studies (A. Carfi, S. H. Willis, J. C. Whitbeck, C. Krummenacher, G. H. Cohen, R. J. Eisenberg, and D. C. Wiley, Mol. Cell 8:169-179, 2001, and S. A. Connolly, D. J. Landsburg, A. Carfi, D. C. Wiley, R. J. Eisenberg, and G. H. Cohen, J. Virol. 76:10894-10904, 2002) provide a detailed picture of the gD-HveA interface and the contacts required for functional interaction. The results demonstrate that of the 35 gD and HveA contact residues that comprise the gD-HveA interface, only a handful are critical for complex formation.


arrow
INTRODUCTION
 
Herpes simplex virus (HSV) is a human pathogen that typically causes lesions on mucosal surfaces and spreads to the peripheral nervous system to establish lifelong latency. The viral envelope contains at least 11 membrane glycoproteins, and four of these (gD, gH, gL, and gB) are essential for entry of HSV into cells. The current model for virus entry proposes the following series of events (56). The initial binding of gC and/or gB to cell surface heparan sulfate proteoglycans is followed by gD binding to one of several cell surface receptors. Receptor binding leads to fusion of the viral envelope with the cell plasma membrane, a process that is facilitated by gD, gH, gL, and gB. Cells transfected with these four glycoproteins are able to fuse with cells expressing a functional gD receptor (2, 40, 51, 56, 59).

Expression cloning and homology searches have identified several HSV receptors, including herpesvirus entry mediator A (HveA/HVEM), nectin-1 (HveC), nectin-2 (HveB), and a modified form of heparan sulfate (3, 56). HveA, a member of the tumor necrosis factor receptor protein family, binds directly to gD and mediates entry of most HSV-1 and HSV-2 strains (39, 64). Nectin-1 and nectin-2 are members of the immunoglobulin superfamily. Nectin-1 binds gD and facilitates entry of all alphaherpesviruses tested, including HSV-1, HSV-2, pseudorabies virus, and bovine herpesvirus type 1 (13, 22, 28). Nectin-2 mediates entry of pseudorabies virus and only mutant strains of HSV-1, such as rid1 (32, 60).

The crystal structure of the gD-HveA complex revealed that the structure of HveA is similar to those of other members of the tumor necrosis factor receptor family, especially within cysteine-rich domains 1 and 2 (CRD1 and CRD2) (Fig. 1A and B) (5, 6, 45). HSV entry and gD binding are blocked by a monoclonal antibody (MAb) that binds CRD1, but biochemical studies showed that both CRD1 and CRD2 are necessary and sufficient for gD binding (62). Residues in both domains contact gD, and mutagenesis of HveA revealed that CRD2 contact residues contribute to gD binding but are not required (Fig. 1C) (12). Taken together, these data suggest that CRD2 is required for gD binding due to its effect on the presentation of a gD binding site present within CRD1.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 1. Highlighted regions within the gD-HveA complex. (A) Diagram of full-length gD and HveA. The amino acid numbers begin with the first residue in the mature protein after signal sequence cleavage. The positions of N glycosylation sites (black circles) and transmembrane regions (TM) are indicated. The gD amino acids comprising each of four defined functional regions (FR) and the group VII and IIb MAb epitopes (gray circles) are labeled. The disulfide bond pattern (dotted lines) and locations of cysteines (C) within gD are indicated. The HveA amino acids comprising each of the four CRDs are labeled. Arrows indicate the sites of truncation for the proteins used to solve the crystal structure. (B) Ribbon diagram of the crystal structure of gD bound to HveA. The N- and C-terminal residues observed in the crystal structure and the locations of HveA CRDs are indicated. The gD molecule is shown in gray, with the gD contact residues located within the gD N-terminal loop shownin red. An {alpha}-helix behind the loop is noted. The HveA molecule is shown in blue, with the HveA contact residues found within CRD1 and CRD2 shown in green. Contact residues were defined as amino acids containing atoms that come within 4 Å of the partner molecule (Table 1). Some of the contact residues are numbered for reference. (C) An enlarged view of the gD-HveA interface shown in the same orientation as that in panel B. gD contact residues are displayed in red, and HveA contact residues are displayed in green. Three ß-strands are labeled (a, b, and c) for reference. (D) An intermolecular antiparallel ß-sheet formed between gD and HveA. A short gD ß-strand (residues 27 [gD-Q27] to 29 [gD-T29] in red, strand a) is hydrogen bonded (dotted lines) to HveA residues 35 (HveA-T35) to 37 within a ß-strand of HveA (residues 35 to 40 [HveA-C40] in green, strand b). This gD-HveA ß-sheet augments a two-stranded ß-sheet formed between HveA residues 36 and 40 and a second HveA ß-strand (residues 22 [HveA-G22] to 26 [HveA-K26] in blue, strand c). gD side chains are shown in gray, and HveA side chains are omitted for clarity. The three ß-strands are shown in the same orientation as those in panel C and labeled (a, b, and c) for reference. Nitrogen (navy) and oxygen (yellow) atoms are indicated. These graphics were created by using Swiss-PdbViewer (23) and POV-Ray software.

The gD-HveA interface centers around the phenol ring of HveA-Y23 that protrudes into a crevice on the surface of gD (6). Site-directed mutagenesis showed that this HveA residue is essential for gD binding (12). Mutagenesis also revealed that many HveA contact residues that contribute to gD binding are clustered near an intermolecular antiparallel ß-sheet formed between gD residues 27 to 29 and HveA residues 35 to 37 (Fig. 1D).

The gD core comprises a V-shaped immunoglobulin fold (Fig. 1B) (6). This core is flanked by a long C-terminal extension and an N-terminal hairpin loop structure that constitutes the entire HveA binding site. Immunization of mice with a peptide that mimics the N terminus (residues 1 to 23) protects them from a lethal HSV challenge (16). Furthermore, antibodies against this peptide neutralize virus infectivity (10).

The gD contact residues are contained within two short segments of the hairpin loop structure (residues 7 to 15 and 24 to 32) (Fig. 1C). Some of these amino acids lie within a previously described epitope (residues 11 to 19) for neutralizing group VII MAbs that block the binding of gD to HveA (Fig. 1A). Others are located within the previously described functional region 1 of gD (residues 27 to 43) (Fig. 1A) (7). Mutations in functional region 1 disrupt HveA binding and prevent HSV from entering HveA-expressing cells (37a, 65).

Previous studies uncovered mutations at two sites within the gD N-terminal loop that result in altered receptor usage. These mutations were selected for their ability to confer resistance to gD-mediated interference to infection. Substitution of gD-L25 with proline or gD-Q27 with proline or arginine permitted usage of the nectin-2 receptor for virus entry (3, 4, 14, 32, 56, 60). Furthermore, gD with the Q27P mutation lost the ability to interact with HveA and gained a 10-fold greater affinity for nectin-1 (28, 39).

In this study, we examined the contribution of each gD contact residue to receptor binding, cell-cell fusion, and virus entry. Using site-directed mutagenesis, we mutated each of the gD contact residues to alanine or valine and examined the phenotypes of the mutated gD molecules. The results defined three regions within the gD-HveA interface that contribute to complex formation. The critical region on gD for HveA interaction is located near a short ß-strand between residues 27 and 29 (Fig. 1D). Mutating gD contact residues in this region prevented usage of HveA as an entry receptor without disturbing nectin-1 usage.

(This work was presented by S. A. Connolly in partial fulfillment of the requirements for the degree of doctor of philosophy at the University of Pennsylvania, Philadelphia, 2003.)


arrow
MATERIALS AND METHODS
 
Cells and viruses. 293T cells and L cells were grown in Dulbecco's minimal essential medium (DMEM) supplemented with 10% fetal calf serum (FCS). VD60 cells (31) were derived from Vero cells to express gD under control of its own promoter and were grown in DMEM supplemented with 5% FCS. B78-H1 mouse melanoma cells (36) were grown in DMEM supplemented with 5% FCS. These cells do not express any gD receptors but can be made permissive to HSV entry by transfection with a gD receptor. B78-H1-C10 cells and B78-H1-B5 cells were derived from B78-H1 cells to stably express nectin-1 and nectin-2, respectively (36). The B78-A cell line used in this study expresses HveA (data not shown) and was created from B78-H1 cells after transfection with pSC386 (12), a plasmid encoding human HveA. The receptor-bearing B78-H1 cell lines were grown in DMEM supplemented with 10% FCS and 500 µg of G418/ml. CHO-K1 cells were grown in Ham's F-12 medium supplemented with 10% FCS. CHO-HVEM12 (58) and CHO-R3A cells were derived from CHO-K1 cells to stably express HveA and nectin-1, respectively, and were grown in Ham's F-12 medium supplemented with 10% FCS and 250 µg of G418/ml. CHO-IEß8 cells (39) carry lacZ under the control of the ICP4 promoter and were grown in Ham's F-12 medium supplemented with 10% FCS and 150 µg of puromycin/ml. M1A, M2A, and M3A (29) cells were derived from CHO-IEß8 cells to stably express HveA, nectin-2, and nectin-1, respectively. These cells were grown in Ham's F-12 medium supplemented with 10% FCS, 150 µg of puromycin/ml, and 250 µg of G418/ml.

The gD-null HSV-1 KOS-gDß virus carries lacZ under the control of the gD promoter (14) and was propagated on VD60 cells as described previously (31).

PAbs and MAbs. Rabbit polyclonal antibody (PAb) serum R7 was raised against HSV-2 gD and cross-reacts with HSV-1 gD (26). Anti-gD MAbs that recognize linear epitopes include DL6, which binds gD residues 272 to 279 (17, 26), and 1D3, which binds residues 11 to 19 (7, 10, 20). Anti-gD MAbs used that recognize discontinuous epitopes include HD1 (41, 50), DL11 (11, 41), AP7 (7, 38), and DL2 (11). Immunoglobulin G (IgG) was purified from rabbit serum or mouse ascites fluid by using HiTrap Protein G 1-ml columns (Amersham Pharmacia Biotech).

Production and purification of soluble receptors. Procedures for production and purification of truncated forms of HveA (HveA200t), nectin-1 (HveC346t), and nectin-2 (HveB361t) expressed by recombinant-baculovirus-infected insect cells have been described elsewhere (28, 60, 64).

Construction of mutant gD molecules. DNA extracted from Vero cells infected with HSV-1 KOS was used as a template for PCR amplification of the gD gene. An upstream primer (CGCGGAAGCTTCCGGTATGGGGGGGGCT) and a downstream primer (CGCCCTCGAGTATCTAGTAAAACAAGGGCT) amplified the full-length sequence of the wild-type KOS gD gene. With the use of the underlined restriction digest sites, the gD fragment was digested and ligated with pcDNA3.1 vector to generate the plasmid pSC390.

The QuikChange site-directed mutagenesis kit (Stratagene Cloning Systems, La Jolla, Calif.) was used to generate mutant gD constructs as recommended by the manufacturer. Briefly, primers designed to mutate individual gD residues were used to PCR amplify the entire pSC390 plasmid. The reaction products were then treated with DpnI to digest methylated template DNA and used to transform competent bacteria (Stratagene Escherichia coli XL1-Blue cells or Invitrogen One Shot Top10F'). The mutant gD sequences were confirmed by sequencing the entire gene. The plasmids were named as follows: gD-A7V (pSC421), gD-M11A (pSC415), gD-A12V (pSC422), gD-P14A (pSC423), gD-N15A (pSC402), gD-V24A (pSC424), gD-L25A (pSC448), gD-D26A (pSC409), gD-Q27A (pDL437), gD-Q27P (pDL491), gD-L28A (pSC425), gD-T29A (pSC420), gD-D30A (pDL449), gD-P31A (pDL439), and gD-P32A (pDL440).

CELISA. To detect gD cell surface expression, we used a modification of the cellular enzyme-linked immunosorbent assay (CELISA) method (21, 37). B78-H1 cells growing in 12-well plates were transfected with endotoxin-free preparations (Qiagen) of gD plasmids by using 1 µg of DNA/well and 7 µl of GENEPorter (Gene Therapy Systems)/ml diluted in DMEM, as recommended by the manufacturer. Cells were exposed to the DNA-GENEPorter mix for 3 h before an equal volume of DMEM containing 20% FCS was added. Cells were trypsinized 1 day posttransfection and plated on 96-well plates pretreated with 0.2% gelatin. Cells were grown to confluence overnight and fixed in 3% paraformaldehyde. Cells were rinsed with 50 mM NH4Cl to quench residual paraformaldehyde and then rinsed twice with phosphate-buffered saline (PBS). Cells were incubated for 1 h at room temperature (RT) with PAb R7 IgG diluted in DMEM-5% FCS, rinsed with PBS three times, and incubated for 30 min at RT with goat anti-rabbit antibodies coupled to horseradish peroxidase. Following another three washes in PBS, cells were rinsed with 20 mM citrate buffer (pH 4.5). ABTS [2,2'-azino-di(3-ethylbenzthiazoline)sulfonic acid] peroxidase substrate (Moss, Inc.) was added, and the absorbance at 405 nm was recorded by using a microtiter plate reader.

Dot blot analysis. 293T cells growing in 48-well plates were transfected with the gD plasmids by using 0.5 µg of DNA/well and 2.5 µl of GENEPorter/well for 3 h before an equal volume of DMEM containing 20% FCS was added. After an overnight incubation at 37°C, transfected cells were harvested in extraction buffer (10 mM Tris, 150 mM NaCl, 10 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride [pH 8]) supplemented with 1x complete protease inhibitor (Roche). The amount of gD in each extract was normalized (see below), and proteins were spotted onto nitrocellulose with a dot blot apparatus (Schleicher & Schuell). Blots were incubated in blocking solution (PBS containing 5% nonfat dry milk and 0.2% Tween 20), reacted with various MAbs or R7 PAb (as a positive control), and incubated with secondary antibody (goat anti-mouse or goat anti-rabbit) coupled to horseradish peroxidase. Blots were washed and visualized by exposure to film after the addition of chemiluminescent substrate (ECL; Amersham).

ELISA. We used a capture enzyme-linked immunosorbent assay (ELISA) to normalize the amount of gD in the 293T extracts. ELISA plates were coated with 50 µl of a 10-µg/ml concentration of DL6 IgG diluted in PBS/well. After an overnight incubation at 4°C, plates were exposed to blocking solution for 1 h and then to gD extracts diluted in blocking solution for 2 h at RT. Captured gD was detected by adding 50 µl of a 1-µg/ml concentration of PAb R7 IgG/well followed by goat anti-rabbit antibody coupled to horseradish peroxidase. Plates were rinsed with 20 mM citrate buffer (pH 4.5), ABTS peroxidase substrate was added, and the absorbance at 405 nm was recorded by using a microtiter plate reader.

The level of gD in each extract was normalized by dilution in extraction buffer, and the normalization was confirmed by repeating the capture ELISA. To assess receptor binding of the gD mutants, ELISA plates were coated overnight with soluble receptors (4 µg of HveA/ml, 10 µg of nectin-1/ml, or 10 µg of nectin-2/ml), exposed to blocking solution, and incubated with normalized cell extracts diluted in blocking solution for 2 h at RT. Bound gD was detected as described above. Percent binding was defined as follows: [(mutant A405 - vector A405)/(wild-type A405 - vector A405)] x 100.

Quantitative fusion assay. To detect cell-cell fusion, we modified the luciferase reporter gene activation assay previously described (48, 51). To prepare effector cells, CHO-K1 cells growing in 96-well plates were transfected with plasmids encoding T7 RNA polymerase, gB, gH, gL, and one of the mutant gD plasmids described above. According to the manufacturer's recommendations, 40 ng of each plasmid/well and 0.5 µl of Lipofectamine 2000 (Invitrogen)/well were added to the cells. Transfections were performed in triplicate. To prepare receptor-bearing target cells, CHO-HVEM12 or CHO-R3A cells growing in 6-well plates were transfected with 10 µl of Lipofectamine 2000/well and 4 µg/well of a plasmid encoding the firefly luciferase gene under control of the T7 promoter. After 6 h at 37°C, the transfection mixes were replaced with fresh medium. After overnight incubation at 37°C, target cells were trypsinized and 4 x 104 cells/well were added to the effector cells and incubated at 37°C. At 20 h postcocultivation, cells were washed once with PBS, lysed in 30 µl /well of 1x reporter lysis buffer (luciferase assay system; Promega), and then frozen. To measure the extent of fusion, 25 µl of each sample was mixed with 100 µl of luciferase substrate (Promega) and immediately assayed for light output with a Luminoskan Ascent (Thermo Labsystems). To assay for gD expression by CELISA, one 96-well plate of effector cells was fixed in paraformaldehyde without cocultivation, incubated with 10 µg of R7 IgG/ml, and treated as described above. Plasmids encoding the firefly luciferase gene (pT7EMCLuc), T7 RNA polymerase (pCAGT7), gB (pPEP98), gH (pPEP100), and gL (pPEP101) were gifts of P. Spear (48, 51).

Syncytium formation assay. B78-A, B78-H1-B5, or B78-H1-C10 cells growing in 24-well plates were transfected with plasmids encoding gB (pPEP98), gH (pPEP100), gL (pPEP101), and one of the gD mutants. According to the manufacturer's recommendations, 0.25 µg of each plasmid/well and 5 µl of GENEPorter reagent in DMEM/well were added to the cells for 3 h before an equal volume of DMEM containing 20% FCS was added. After an overnight incubation at 37°C, cells were fixed with methanol, stained with Giemsa (Gibco BRL) for 10 min, and scored for syncytium formation by microscopy.

Complementation assay. The complementation assay was modified from previous protocols (7, 44). L cells were originally used to identify the functional regions of gD and used here because they produce sufficient quantities of complemented virus. L cells growing in 12-well plates were transfected with 2 µg of DNA/well and 10 µl of GENEPorter/well diluted in 500 µl of DMEM. After 3 h, an equal volume of DMEM containing 20% FCS was added. After an overnight incubation at 37°C, cells were infected with 8 x 106 PFU of HSV-1 KOS-gDß per well in 300 µl of DMEM. After 1 h at 37°C, 300 µl of DMEM containing 20% FCS/well was added. After an additional hour at 37°C, the medium was removed and extracellular virus was inactivated by incubation with 40 mM sodium citrate (pH 3.0), 10 mM KCl, and 135 mM NaCl for 1 min. The acid was removed, and the cells were incubated in 600 µl of fresh medium/well at 37°C overnight. At 24 h postinfection, complemented virus was harvested, either by collecting cell supernatants or by exposing the plates to three freeze-thaw cycles and collecting cell lysates. The virus preparations were then cleared of cell debris in a microcentrifuge and stored at -80°C.

Viral titers were determined with VD60 cells. Serial 10-fold dilutions of the cell lysates containing complemented virus were added to VD60 cells growing in 24-well plates. At 90 min postinfection, VD60 cells were overlaid with DMEM containing 1% carboxy-methylcellulose and 5% FCS and incubated for 3 days. Cells were fixed in 5% formaldehyde-PBS and stained with crystal violet, and plaques were counted.

To detect HSV entry into cells expressing defined receptors, we modified a previously described assay (29). Briefly, M1A, M2A, or M3A cells growing in 96-well plates were exposed to serial dilutions of the lysates or supernatants containing complemented virus. After an overnight incubation at 37°C, the cells were washed with PBS and lysed in DMEM containing 0.5% NP-40. ß-Galactosidase activity in the lysate was measured by adding substrate (chlorophenol red-ß-D-galactopyranoside; Boehringer Mannheim), reading the absorbance at 570 nm at multiple times with a microtiter plate reader, and recording the mean slopes. Percent complementation was defined as follows: [(slopemutant - slopevector)/(slopewild-type - slopevector)] x 100.


arrow
RESULTS
 
Production of gD mutants. Using the crystal structure of gD bound to HveA (6), we identified 14 gD contact residues, defined as gD amino acids that contain atoms located within 4 Å of HveA (Table 1; Fig. 1C). To determine the contribution of these contact residues to HSV entry, we individually mutated each residue to alanine or valine. Alanine was chosen as a generic substitute because its presence removes the majority of the original residue's side chain atoms. In addition, alanine is commonly found in many secondary structures in both exposed and buried positions (61). We substituted valine for the two gD contact residues that exist as alanine in wild-type gD (Table 1). The gD plasmid constructs were cloned and sequenced, and the phenotypes of the mutant gD molecules were compared to that of wild-type gD. For comparison, we also cloned a plasmid encoding the gD present in the HSV-1 rid1 strain, gD-Q27P (Table 1) (14). A virus carrying this single gD mutation cannot enter cells expressing HveA as the sole entry mediator but can enter cells expressing nectin-2. This form of gD has a 10-fold higher affinity for nectin-1 than does wild-type gD (14, 22, 28, 39).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Categorization of gD mutant proteins

Expression and structural integrity of gD mutant proteins. Cell surface expression was used as an indication that the mutant gD molecules were properly folded and transported to the plasma membrane. Using CELISA, we measured expression in B78-H1 cells that do not express any gD receptors to avoid potential artifacts created by gD binding to a receptor (21, 36). These cells were transiently transfected with plasmids encoding the gD mutants and incubated with various concentrations of anti-gD polyclonal serum (R7). This polyclonal serum was previously shown by Western blot analysis to react equally with all the gD mutants (data not shown). CELISA data are shown for wild-type gD and three mutants (Fig. 2A). Throughout this report, data for these mutants represent three distinct gD phenotypes (Table 1). Expression of all three mutants was identical to that of wild-type gD. Similar CELISA results were obtained for all the gD mutants (data not shown). Thus, none of the mutations had a significant effect on the level of gD transported to the cell surface.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2. Expression and receptor binding of gD mutants. (A) Cell surface expression. B78-H1 cells transfected with plasmids encoding each of the gD mutants or wild-type gD (wt-gD) were seeded onto 96-well plates, and expression of gD on the cell surface was detected by using dilutions of anti-gD PAb. (B) gD quantitation by capture ELISA. Cell extracts were prepared from 293T cells transfected with plasmids encoding each of the gD mutants. Dilutions of extracts were added to 96-well plates coated with anti-gD MAb. The amount of gD captured by the MAb was detected by using anti-gD PAb. The cell extracts were then diluted in extraction buffer to obtain normalized levels of gD, and the capture ELISA was repeated for confirmation. Data are shown for normalized extracts of wild-type gD and three representative gD mutants. (C) Binding of gD mutants to nectin-1. Ninety-six-well plates were coated with a truncated form of nectin-1, incubated with dilutions of transfected cell extracts normalized for gD content, and probed with an anti-gD PAb to detect the levels of gD binding. Data are shown for wild-type gD and three gD mutants. (D) Binding of gD mutants to HveA. Ninety-six-well plates were coated with truncated forms of HveA and treated as described above. Assays detecting gD binding to HveA, nectin-1, and anti-gD MAb were run in parallel. (E) Nectin-1binding for all the gD mutants. Binding data for a single dilution of normalized extract (7.5 µl/well) are plotted. The negative control signal is subtracted, and receptor binding is expressed as a percentage of wild-type gD receptor binding. (F) HveA binding for all the gD mutants. Binding data for a single dilution of normalized extract (15 µl/well) are plotted as described above. The gD mutants are divided into three categories based on the overall phenotypes exhibited for interactions with HveA (Table 1). Category 1 mutants (black bars) have near wild-type levels of binding to both receptors. Category 2 (striped bars) and category 3 (gray bars) mutants have impaired binding to HveA but not nectin-1.

To examine the structural integrity of the proteins, we tested their binding to a defined panel of anti-gD MAbs. Cell extracts were prepared from 293T cells transfected with plasmids encoding each of the gD mutants. We used 293T cells because gD expression is greatly increased in these cells. To normalize gD levels among the cell extracts, various amounts of each extract were added to ELISA plates that were coated with the anti-gD MAb DL6 and the amount of gD bound was determined with R7 serum. Extracts were then diluted to contain equivalent amounts of gD, and the ELISA was repeated (Fig. 2B). The DL6 epitope maps to a linear stretch between residues 272 and 279 of gD (26) (Fig. 1A), and thus none of these N-terminal mutations should alter DL6 binding.

Using the normalized extracts, we screened the mutants for reactivity against anti-gD MAbs belonging to different epitope groups (Table 2). All of the gD mutants bound MAb 1D3, which recognizes a linear epitope between amino acids 11 and 19 (7, 10, 20). The mutant proteins also bound MAbs HD1, DL11, and DL2, each of which recognizes a different discontinuous epitope (11, 41, 42, 50). This suggests that the gD mutant proteins are conformationally intact. In contrast, MAb AP7 did not bind gD-L25A, gD-D26A, gD-Q27A, gD-Q27P, or gD-D30A. AP7 is a neutralizing MAb that recognizes a discontinuous epitope with elements in both the N and C termini of the gD ectodomain (4, 7, 38, 47). The loss of AP7 reactivity with these mutants was not surprising since previous reports indicate that AP7 fails to neutralize virus carrying a mutation at either residue 25 or 27 (14, 38).


View this table:
[in this window]
[in a new window]
  		TABLE 2. MAb reactivity of the gD mutant proteins

Binding of gD mutant proteins to receptors. To determine the ability of the gD mutant proteins to bind to three HSV entry receptors, various amounts of normalized cell extracts were added to ELISA plates that were coated with soluble forms of HveA, nectin-1, or nectin-2 (28, 60, 64). The amount of gD bound to each receptor was detected by using R7 serum. gD-M11A and gD-D30A bound as well as wild-type gD to nectin-1, and gD-Q27A showed increased binding to this receptor (Fig. 2C). The phenotype of gD-Q27A is similar to that of the rid1 mutant gD-Q27P (Table 1) (28). In contrast, gD-M11A, gD-Q27A, and gD-D30A did not bind to HveA (Fig. 2D).

To compare the receptor binding phenotypes of all the gD mutants, we plotted the amount of gD bound to each receptor as a percentage of wild-type gD bound using a single concentration. Whereas all of the gD mutants bound to nectin-1 (Fig. 2E), none bound to nectin-2 (data not shown). Seven of the gD mutants bound to HveA, while eight others did not (Fig. 2F). Binding experiments were repeated at least three times, and the patterns of receptor binding were consistent. Thus, some gD contact residues are more critical for HveA binding than are others.

gD mutants mediating cell-cell fusion To determine whether receptor binding correlated with the abilities of the gD mutants to mediate fusion, we tested gD function by using a cell-cell fusion assay. Effector cells were prepared by transfecting CHO-K1 cells with plasmids encoding T7 RNA polymerase, gB, gH, gL, and a gD mutant. Target cells were prepared by transfecting cells that stably express HveA (CHO-HVEM12) or nectin-1 (CHO-R3A) with a plasmid encoding the luciferase gene under control of the T7 promoter. The target and effector cells were mixed, incubated, and assayed for luciferase activity as a measure of cell-cell fusion.

Effector cells expressing any of the gD mutants were able to fuse with nectin-1-bearing target cells (Fig. 3A). Similarly, effector cells expressing any of the gD mutants that bound HveA (category 1) were able to fuse with HveA-bearing target cells (Fig. 3B and Table 1). Unexpectedly, four of the gD mutants that did not bind HveA (category 2) showed reduced but detectable levels of fusion with HveA-bearing target cells (Fig. 3B and Table 1). Thus, the detrimental effect of mutations was more apparent in the receptor binding assay than in the fusion assay. A similar observation was made previously with rid1 gD, which did not bind detectably to nectin-2 but mediated fusion of cells expressing nectin-2 (51). In contrast, effector cells expressing any of the remaining gD mutants that did not bind HveA (category 3) failed to fuse with the HveA-bearing target cells (Fig. 3B and Table 1). All of the mutants were expressed at equivalent levels on the surface of effector cells as judged by CELISA (data not shown), and this fusion assay was repeated three times with similar results.



View larger version (51K):
[in this window]
[in a new window]
  		FIG. 3. gD mutants mediating cell-cell fusion. CHO cells stably expressing either HveA (CHO-HVEM12) or nectin-1 (CHO-R3A) were transfected with a plasmid encoding the luciferase gene under the control of the T7 promoter and cocultivated with CHO-K1 cells transfected with plasmids encoding gB, gH, gL, a gD mutant, and T7 polymerase. The cells were lysed and assayed for luciferase activity as a measure of cell-cell fusion. The means and standard deviations of the results from one experiment performed in triplicate are shown. The gD mutants are divided into three categories (Table 1). Category 1 gD mutants (black bars) mediate near-wild-type levels of fusion of cells expressing either receptor. Category 2 mutants (striped bars) show reduced fusion of cells expressing HveA but wild-type levels of fusion of nectin-1-expressing cells. Category 3 mutants (gray bars) fail to mediate fusion of cells expressing HveA but mediate wild-type levels of fusion of nectin-1-expressing cells. wt-gD, wild-type gD.

gD mutants mediating syncytium formation. To visually confirm the results of the luciferase fusion assay, we tested the mutants for their abilities to form syncytia. We used B78-H1 cells stably expressing one of the gD receptors because they readily form large syncytia within 48 h posttransfection. These cells were transfected with plasmids encoding gB, gH, gL, and a gD mutant. Sample results for two gD mutants are shown in Fig. 4. After 48 h, nectin-1-bearing cells (B78-H1-C10) expressing any of the gD mutants formed large syncytia. Similarly, HveA-bearing cells (B78-A) that expressed any of the gD mutants from categories 1 and 2 formed syncytia. Consistent with the results of the luciferase assay, category 3 mutants did not mediate syncytium formation on HveA-bearing cells.



View larger version (153K):
[in this window]
[in a new window]
  		FIG. 4. gD mutants mediating syncytium formation. B78-H1 cells stably expressing either HveA, nectin-1, or nectin-2 were transfected with plasmids encoding gB, gH, gL, and a gD mutant. Cells were stained and syncytia (arrows) were viewed by microscopy. The entire panel of gD mutants was tested. Sample data for two gD mutants are shown.

Interestingly, though we were unable to demonstrate binding of any gD mutant proteins to nectin-2, three mutants mediated syncytium formation on cells expressing nectin-2 (B78-H1-B5). gD-Q27A behaved like rid1 gD (gD-Q27P), mediating fusion of nectin-1- and nectin-2-expressing cells but not that of HveA-expressing cells. Surprisingly, gD-L28A was uniquely capable of fusing B78-H1 cells expressing any of the three receptors.

gD mutants mediating HSV entry. To further evaluate gD function, we tested the abilities of the gD mutants to mediate virus entry by using a well-described complementation assay (7, 31, 44). L cells were transiently transfected with mutant gD plasmids and then infected with a gD-null HSV that had been phenotypically complemented with wild-type gD to allow for entry. Progeny virus was harvested 24 h postinfection, and the titers of the virus were determined with VD60 cells. VD60 cells stably express wild-type gD under the control of its own promoter (31), and plaque formation on these cells is mediated by the gD provided in trans. If a functional gD mutant was incorporated into the progeny virions, they should enter the complementing VD60 cells and form plaques. HSV complemented with any of the gD mutants was able to infect VD60 cells (Fig. 5A). These results were expected since these cells are derived from Vero cells that express primate homologs of HveA and nectin-1 (19, 37, 37a). These results indicate that all the gD mutants were incorporated into virion particles at levels that are sufficient to mediate virus entry.



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 5. gD mutants mediating HSV entry into cells. L cells were transfected with plasmids encoding gD mutants, incubated overnight, and infected with gD-null HSV that had been phenotypically complemented with wild-type gD to allow for entry. Cell lysates containing progeny virions complemented with the gD mutants were harvested and assayed for virus entry activity. (A) Entry into VD60 cells. Dilutions of the complemented cell lysates were added to VD60 monolayers. After 2 days, cells were stained and plaques were counted. Titers are expressed as numbers of PFU per milliliter. wtgD, wild-type gD. (B) Entry into cells expressing nectin-1 and HveA. CHO cells that express either receptor and carry lacZ under control of the ICP4 promoter were incubated overnight with dilutions of complemented cell lysates. ß-Galactosidase production was used as a measure of virus entry. Data are shown for wild-type gD and three gD mutants. (C and D) Entry mediated by the panel of gD mutants. The entry assay described for panel B was repeated for all gD mutants. For comparison, the ß-galactosidase activities from a single dilution of the complemented cell lysates (50 µl/well) are shown. For each mutant, a negative control signal was subtracted and entry was expressed as a percentage of the entry mediated by wild-type gD. Category 1 (black bars) and category 2 (striped bars) mutants mediate entry into both nectin-1- and HveA-expressing cells. Category 3 mutants (gray bars) mediate entry into cells expressing nectin-1 but not those expressing HveA. (E) Entry of HSV complemented with gD-D26A into cells expressing HveA. Complemented virus was harvested from cell supernatants and assayed as described above. To compare the mutants, we plotted the ß-galactosidase activity of each complemented virus lysate (at 50 µl/well) as a percentage of the ß-galactosidase activity obtained when HSV was complemented with wild-type gD.

We next assessed virus entry into cells expressing a single defined gD receptor. To do this, we used CHO cells that stably express human HveA (M1A) or human nectin-1 (M3A) and carry the lacZ gene under the control of the ICP4 promoter (29, 58). Since these cell lines do not provide gD in trans, complemented gD-null HSV is capable of only a single round of infection and cannot form plaques. To circumvent this problem, we modified an existing entry assay (39). M1A or M3A cells were incubated overnight with various amounts of complemented virus, and the amount of ß-galactosidase produced was used as a measure of entry.

HSV complemented with any of the three representative gD mutants exhibited the same level of entry into nectin-1-bearing cells as HSV complemented with wild-type gD (Fig. 5B). Similarly, HSV complemented with gD-M11A infected HveA-expressing cells. However, HSV complemented with either gD-Q27A or gD-D30A failed to infect HveA-expressing cells.

This entry assay was repeated for the entire panel of gD mutants. For comparison, we plotted the entry activity of each gD mutant (at 50 µl of lysate/well) as a percentage of that of wild-type gD. With the exception of gD-D26A, all of the gD mutants mediated entry into cells expressing nectin-1 (Fig. 5C). Variations in the levels of entry may simply reflect differences in virus titers. These data agree with the observation that all the mutant gD proteins bound nectin-1 and mediated fusion of nectin-1-bearing cells (Fig. 2 and 3). Similarly, all category 1 and category 2 mutants, except for gD-D26A, mediated entry into HveA-expressing cells (Fig. 5D). In contrast, category 3 mutants failed to complement gD-null HSV for entry into these cells. Thus, these data agree with the categorization of gD mutants delineated by the fusion assay (Table 1). We were unable to determine entry into nectin-2-bearing cells (M2A), due to high levels of background ß-galactosidase expression.

As noted above, HSV complemented with gD-D26A displayed reduced entry into cells expressing nectin-1 or HveA (Fig. 5C and D). This virus also had a 10-fold lower titer on VD60 cells (Fig. 5A). Since gD-D26A bound both HveA and nectin-1 (Fig. 2E and F) and mediated fusion of cells expressing these receptors (Fig. 3), we suspected that its low entry activity simply reflected low virus titers in these preparations. Therefore, we repeated the complementation assay, this time harvesting virus from cell supernatants and leaving the L cells intact to assay them for cell surface expression of gD by CELISA. All of the gD mutants, including gD-D26A, were expressed at wild-type levels, and all mutants from categories 1 and 2 mediated entry into HveA-bearing cells, in agreement with the results of the fusion assay. Complementation data for gD-D26A are shown in Fig. 5E.


arrow
DISCUSSION
 
The crystal structure of the gD-HveA complex shows that gD contacts residues in both CRD1 and CRD2 of HveA (6). In a previous study, we used site-directed mutagenesis to determine the contribution to receptor function of the HveA residues that contact gD (12). We found that most of the HveA residues were not individually required for receptor function; however, some residues were critical for both gD binding and HSV entry, such as the binding hot spot HveA-Y23 (Fig. 6A and C) (8). Other HveA residues contributed to gD binding without affecting HSV entry, such as residues in CRD2 and residues near an intermolecular ß-sheet.



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 6. (A) Space-filling model of HveA and gD. The gD-HveA structure has been pried apart to expose the binding face of each protein. Residues that are critical for binding (red) or that contribute to binding (yellow) are indicated. HveA data are taken from reference 12. HveA-Y23 (red) fits into a crevice on the surface of gD (blue arrows). (B) The HveA binding site on gD. The gD-HveA interface from Fig. 1C is rotated so that the face of HveA binding on the gD N-terminal loop is shown. All gD contact residues are numbered, and the N and C termini are labeled. The space-filling spheres represent atoms of gD contact residues from category 1 (gray), category 2 (yellow), and category 3 (red) (Table 1). (C) The gD binding site on HveA. The gD-HveA interface from Fig. 1C is rotated so that the N-terminal loop of gD (black) lies on top of the HveA binding surface. HveA is viewed from the perspective of the {alpha}-helix (Fig. 1B). All HveA contact residues are numbered and shown in space-filling format. Individually mutating these residues results in wild-type or enhanced gD binding (gray), reduced gD binding (yellow), or a loss of gD binding (red) (12). The N and C termini of gD are labeled.

In the present study, we used a similar approach to determine the contribution of each of the gD residues that contact HveA to receptor binding, cell-cell fusion, and HSV entry. We found that some mutations had a greater effect on gD function than others. Thus, the gD contact residues do not contribute equally to HveA binding, concordant with those in other protein-protein complexes (1, 15). The 14 gD mutants were classified into three categories (Table 1; Fig. 6B). Seven mutants displayed wild-type function on HveA (category 1). Four mutants failed to bind HveA at detectable levels but retained the ability to mediate HSV entry and facilitate fusion, albeit at reduced levels (category 2). Four mutants were negative for HveA binding, cell-cell fusion, and HSV entry (category 3). These results defined three critical regions at the gD-HveA interface (Fig. 7A).



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 7. (A) Three critical regions at the gD-HveA interface. The interface from Fig. 1C is shown in two orientations. At the top of the interface, an intermolecular ß-sheet (red) is formed between gD residues 27 to 29 and HveA residues 35 to 37. This ß-sheet is critical for receptor binding and HSV entry. At the center of the interface, shown in green, HveA-Y23 contacts two gD residues on either side of the loop, gD-M11 and gD-L25, via a water molecule (w). HveA-Y23 is required for gD binding and HSV entry, while gD-M11 and gD-L25 contribute to HveA binding. Below this region, shown in yellow, gD-N15 contacts HveA CRD2 residues HveA-S74 and HveA-T76. These three residues contribute to complex formation. Dashed lines represent intermolecular hydrogen bonds. Oxygen (red), nitrogen (navy), and sulfur (white) atoms are indicated. (B) Location of four category 1 gD residues (red) and HveA residues (green). A salt bridge between gD-D26 and HveA-K26 (dotted lines) is indicated, as are nitrogen (navy) and oxygen (yellow) atoms. Main chain oxygen atoms are omitted for clarity.

Category 1 mutants. gD binding, cell-cell fusion, and HSV entry were not greatly affected by mutations in seven of the 14 contact residues (Table 1). When viewed in the context of the HveA mutagenesis study (12), the results for many of these mutants were not surprising. For example, mutation of gD residue A7, P31, or P32 failed to affect HveA binding, and each of these residues contacts only HveA amino acids previously shown to be dispensable for gD binding (Table 1; Fig. 6C) (12). In contrast, although gD-A12 contacts HveA-Y23, a critical residue for HveA function, the conservative gD mutation A12V probably failed to affect gD function because gD-A12 interactions with HveA-Y23 are mediated solely by main chain atoms (Table 1; Fig. 7B).

Comparing this study with the previous HveA mutagenesis study (12) provides a complete picture of the structural and functional interactions across the gD-HveA binding interface. For example, we previously demonstrated that contact residues in HveA CRD2 (S74 and T76) contribute to gD binding (Fig. 6C). Since gD-P14 and gD-N15 are the only residues that contact these CRD2 residues and mutation of gD-P14 fails to affect gD function, we conclude that the major contribution of CRD2 contact residues to gD binding is due to interactions with gD-N15, a category 2 residue (Fig. 7). Similarly, results for gD-V24A shed light on the relative importance of HveA-P39, a residue that contacts gD-V24 (Fig. 7B). HveA-P39A previously showed reduced gD binding, but since gD-V24A has wild-type gD function, we conclude that the HveA-P39A phenotype is not due to a loss of interactions with the gD-V24 side chain. We suggest that the HveA-P39A phenotype may be due to a loss of interactions with gD-L25, a category 2 residue. Alternatively, mutating this proline may cause a local structural change in HveA that disrupts gD binding.

One unexpected result in category 1 was that the gD mutation D26A did not affect HveA binding. gD-D26 mediates multiple side chain interactions with three HveA residues, including a salt bridge with HveA-K26 (Table 1; Fig. 7B). Moreover, the HveA mutation K26A was previously shown to reduce gD binding and gD-D26 is the only gD residue contacted by HveA-K26 (Fig. 6C) (12). Since gD-D26A has wild-type ability to bind to HveA, we suggest that the phenotype of HveA-K26A is due to something other than a loss of direct interactions with gD-D26, such as the partial disruption of a ß-sheet formed between gD and HveA (described in detail below).

Category 2 mutants. Although the four gD mutants in this category mediated HSV entry and reduced levels of cell-cell fusion, we were unable to detect their binding to HveA (Table 1). Thus, if binding to soluble HveA can be extrapolated to reflect receptor binding during virus entry, these results suggest that HSV entry can occur without demonstrable binding between gD and HveA. Fusion and entry in the absence of appreciable receptor binding has been shown for nectin-2 and mutant HSV strains (51, 60). Similarly, a wide range of affinities between gD and nectin-1 is tolerated for the entry of HSV, pseudorabies virus, and bovine herpes virus (13, 28, 35, 37).

The overnight incubation of complemented virus with cells that overexpress a receptor may account for the sensitivity of the entry assay used in this study. These conditions may compensate for the low receptor affinities of the category 2 mutants and permit appreciable levels of virus entry even when the entry process is inefficient. Alternatively, the interaction between gD and HveA may be different when gD is presented in the context of an intact virion rather than in a cell extract. Future optical biosensor studies will more precisely define the alterations in receptor binding kinetics and affinities for these gD mutants.

The crystal structure of the gD-HveA complex provides explanations for the phenotypes of the four category 2 mutants (6). Each category 2 residue contacts HveA amino acids that were previously shown to contribute to gD binding (Table 1). For example, the extensive HveA interactions of gD-M11 include seven with HveA-Y23, a residue at the center of the gD-HveA interface that is critical for gD-HveA binding (12). HveA-Y23 is a hot spot for gD binding (8), and substituting it with alanine inhibits HSV entry (12). The loss of detectable HveA binding by gD-M11A was predicted (12) and is most likely due to a loss of interactions with the HveA-Y23 phenyl group. However, since gD-M11A remains functional for HSV entry, the failure of HveA-Y23A to mediate HSV entry must be due to more than a loss of interactions with the gD-M11 side chain, such as the additional loss of interactions with gD-L25 (Fig. 7A).

Substitution of gD-L25 with alanine disrupted HveA binding but not HSV entry mediated by HveA. This phenotype may be due to the disruption of a hydrogen bond formed between the carbonyl group of gD-L25 and the hydroxyl group of HveA-Y23 via a water molecule (Fig. 7A). The importance of this hydroxyl group to HveA function as an entry receptor was previously indicated by the mutant HveA-Y23F, which shows reduced HSV entry activity (12). Alternatively, since the side chain of gD-L25 faces away from HveA and contacts an {alpha}-helix that supports the N-terminal loop, the gD-L25A phenotype may result from a disruption of these {alpha}-helix interactions (Fig. 1B and 7A) (6). The subsequent local structural disturbance could contribute to the loss of the AP7 conformational epitope on this mutant, as discussed below.

Thus, individual mutations in two gD residues that contact HveA-Y23 disrupt HveA binding without impeding HSV entry. We propose that combining these two gD mutations on one molecule would prevent the interaction of gD with HveA.

Category 2 includes two other gD residues, gD-N15 and gD-L28. As mentioned previously, gD-N15 contacts HveA CRD2. We propose that the failure of gD-N15A to bind HveA is due to a loss of extensive interactions between gD-N15 and HveA CRD2, including a hydrogen bond with HveA-T76 (Table 1; Fig. 7A). In contrast, the failure of gD-L28A to bind HveA is likely due to partial disruption of an intermolecular ß-sheet that includes gD-L28, as described in detail below (Fig. 1D and 7A).

Category 3 mutants. This study identified three mutations in gD (Q27A, T29A, and D30A) that resulted in the complete loss of HveA binding and the failure to mediate fusion of and HSV entry into cells expressing HveA (Table 1). All of these mutations lie within or adjacent to an intermolecular antiparallel ß-sheet formed between residues T35, V36, and C37 of HveA and Q27, L28, and T29 of gD. This ß-sheet augments a two-stranded ß-sheet in HveA CRD1 (Fig. 1D) (6). All of the category 3 gD residues contact HveA residues that were previously shown to contribute to gD binding (12). In fact, since six HveA residues that contribute to gD binding cluster near this gD ß-strand (Fig. 6C), its importance was previously suggested in the HveA mutagenesis study.

Disruption of the intermolecular ß-sheet was previously suggested to be responsible for the failure of existing gD mutants gD-Q27P and gD-Q27R to interact with HveA (6). Like that of gD-L25, the side chains of gD-Q27 and gD-D30 face away from HveA and towards an {alpha}-helix (Fig. 1B). Thus, these residues contact HveA solely via main chain atoms and mutating these residues may disrupt HveA binding indirectly by altering the conformation or position of the gD ß-strand.

The crystal structure of gD in the absence of HveA shows that the gD N terminus does not bend at residue 21 to form a loop but instead has an extended conformation up to residue 16 (residues 1 to 15 are disordered) (6). Mutation of gD residue 25, 27, or 30 could block HveA binding by preventing N-terminal loop formation. Notably, mutations at these three residues disrupt AP7 binding. In contrast, the side chain of gD-T29 faces HveA and mutation of this residue did not prevent AP7 binding. The phenotype of gD-T29A may be due to direct loss of multiple side chain interactions with HveA, including a hydrogen bond with HveA-T35. Although AP7 is a neutralizing MAb (38), retention of the AP7 epitope is not required for HveA binding, as demonstrated by gD-D26A, a category 1 mutant (Table 2).

Three critical regions at the gD-HveA interface. The residues on gD that contribute to complex formation complement those on HveA; i.e., the important regions on each molecule face one another (Fig. 6A), as has been reported for other protein-protein complexes (1, 8). Taken together, this study and previous studies (6, 12) identify three regions at the gD-HveA binding interface that contribute to function: the intermolecular ß-sheet; the central region of the interface that includes HveA-Y23, gD-M11, and gD-L25; and the region encompassing HveA CRD2 and gD-N15 (Fig. 7A). HveA-Y23 was previously identified as a hot spot, and it was proposed that a small molecule inhibitor could be designed to prevent gD interactions with the phenol ring of HveA-Y23 (6, 12). This study provides additional targets for inhibitor design.

Nectin-1 interaction. All the gD mutants retained the ability to bind nectin-1 and mediate infection of cells expressing nectin-1 as the sole receptor (Table 1). Thus, this study supports the notion that nectin-1 and HveA bind gD at distinct sites (28, 63). Previous studies showed that an HSV deletion mutant lacking gD residues 7 to 21 was able to enter VD60 cells (18, 43). We propose that this gD deletion mutant exhibits a category 3 phenotype and gains entry into VD60 cells via nectin-1. The usage of nectin-1 as a functional receptor on VD60 cells is consistent with the fact that, for the entire panel of gD mutants, the levels of entry into cells expressing nectin-1 mirrored the titers on VD60 cells.

Epitope mapping of neutralizing anti-gD antibodies indicated that the binding sites on gD for HveA and nectin-1 partially overlap (28, 46, 63). Correspondingly, soluble forms of both receptors can block HSV entry mediated by either receptor (22) and the gD rid1 mutation simultaneously affects gD interactions with both receptors (28). In this study, gD-Q27A and gD-Q27P lost HveA binding and exhibited increased binding to nectin-1. However, neither mutant mediated increased levels of virus entry into or cell-cell fusion of nectin-1-bearing cells. Earlier studies also demonstrated wild-type levels of entry and fusion for gD-Q27P (14, 22, 51).

Previous studies have demonstrated similarities between virus strains carrying the gD mutations Q27P and L25P (4, 14, 32, 56); however, gD-L25P did not exhibit increased nectin-1 binding (32). This is consistent with the gD-L25A phenotype seen in the present study.

Nectin-2 interaction. Four HSV-1 strains that mediate infection via nectin-2 have been identified (32, 60). Three of these are lab-adapted strains that were selected for resistance to gD-mediated interference to infection and carry the gD mutation Q27P (strain rid1), Q27R (strain rid2), or L25P (strain U10) (4, 14). The fourth is a clinical isolate (strain ANG) that was plated under agar overlay and carries the triple gD mutation L25P-Q27P-T230I as well as mutations in other genes (27). The present study identified two new gD mutations (Q27A and L28A) that confer the ability to fuse nectin-2-expressing cells. gD-Q27A displayed the same phenotype as gD-Q27P, interacting with nectin-1 and nectin-2 but not HveA. To our surprise, gD-L28A mediated fusion of cells expressing any of the three HSV receptors. gD-L28A is the only mutant yet described with this phenotype, and it demonstrates that nectin-2 usage does not necessarily preclude HveA usage.

Despite the fact that a virus carrying the gD mutation L25P can enter cells expressing nectin-2 (32), the gD-L25A mutant in this study did not gain the ability to use this receptor. The reason for this difference may be that the restricted geometry of a proline ring at this position results in a more drastic structural change than does substitution with alanine.

Receptor usage. HSV has evolved to use multiple entry receptors, yet the significance of each of these receptors during HSV infection is unknown. All primary isolates of HSV tested can use both HveA and nectin-1 as entry receptors (G. H. Cohen and R. J. Eisenberg, unpublished data), and the affinities of gD for these receptors are equivalent (Kd = 3 x 10-6 M) (28, 65). Some have proposed that nectin-1 is the primary HSV receptor because it is expressed on neurons (34, 53) and functions as a receptor for multiple alphaherpesviruses (9, 22). However, HveA mRNA is found in a variety of tissues (24, 25, 30, 33, 39, 57) and HveA mediates infection of human fibroblasts that lack nectin-1 (C. Krummenacher et al., unpublished data). HveA expression is strongest in lymphoid tissues, where it may mediate infection to facilitate immune system evasion (52).

This study produced a panel of gD mutants with altered receptor usage. Mutations in four adjacent gD residues (D26A, Q27A, L28A, and T29A) resulted in four distinct receptor usage phenotypes (Table 1). These mutants will be useful for determining what receptors are used during infection of commonly used cell lines. The mutants may also address the role played by the various receptors during HSV infection and pathogenesis. We plan to develop virus recombinants bearing the various gD mutations to determine the effect of the mutations on virus infection and reactivation in a murine model (49, 54, 55). We anticipate that the gD mutants will perform similarly with human and murine nectins, since nectin-1 is highly conserved among species (37). On the contrary, HveA is less well conserved (19, 25), so it will be of interest to determine how the gD mutants interact with murine HveA.

In summary, we determined the contribution of specific gD residues within the HveA binding site to HSV entry. We found that most of the gD contact residues contribute collectively rather than individually to the interaction between HveA and gD. The results defined three critical regions at the gD-HveA interface and demonstrated that residues within an intermolecular ß-sheet are as critical for complex formation as HveA-Y23 was previously shown to be (12). Thus, this study provides additional targets for the design of inhibitors to block the gD-HveA interaction and thereby prevent HSV infection mediated by HveA.


arrow
ACKNOWLEDGMENTS
 
We thank N. W. Fraser, D. C. Johnson, and P. G. Spear for reagents and I. Baribaud, F. C. Bender, T. M. Cairns, C. Krummenacher, R. S. B. Milne, and J. C. Whitbeck for helpful advice.

This investigation was supported by Public Health Service grant AI-18289 to G.H.C. and R.J.E. from the National Institute of Allergy and Infectious Diseases and grants NS-30606 and NS-36731 to R.J.E. and G.H.C. from the National Institute of Neurologic Diseases and Stroke. S.A.C. was a predoctoral trainee supported by grant AI-07325 from the National Institute of Allergy and Infectious Diseases.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, University of Pennsylvania School of Dental Medicine, 4010 Locust St., Levy Building Room 233, Mail Code 6002, Philadelphia, PA 19104. Phone: (215) 898-6558. Fax: (215) 898-8385. E-mail: sconnoll{at}med.upenn.edu. Back

{dagger} Deceased. Back


arrow
REFERENCES
 
  1. 1 Bogan, A. A., and K. S. Thorn. 1998. Anatomy of hot spots in protein interfaces. J. Mol. Biol. 280:1-9.[CrossRef][Medline]
  2. 2 Browne, H., B. Bruun, and T. Minson. 2001. Plasma membrane requirements for cell fusion induced by herpes simplex virus type 1 glycoproteins gB, gD, gH and gL. J. Gen. Virol. 82:1419-1422.[Abstract/Free Full Text]
  3. 3 Campadelli-Fiume, G., F. Cocchi, L. Menotti, and M. Lopez. 2000. The novel receptors that mediate the entry of herpes simplex viruses and animal alphaherpesviruses into cells. Rev. Med. Virol. 10:305-319.[CrossRef][Medline]
  4. 4 Campadelli-Fiume, G., S. Qi, E. Avitabile, L. Foà-Tomasi, R. Brandimarti, and B. Roizman. 1990. Glycoprotein D of herpes simplex virus encodes a domain which precludes penetration of cells expressing the glycoprotein by superinfecting herpes simplex virus. J. Virol. 64:6070-6079.[Abstract/Free Full Text]
  5. 5 Carfi, A., H. Gong, H. Lou, S. H. Willis, G. H. Cohen, R. J. Eisenberg, and D. C. Wiley. 2002. Crystallization and preliminary diffraction studies of the ectodomain of the envelope glycoprotein D from herpes simplex virus 1 alone and in complex with the ectodomain of the human receptor HveA. Acta Crystallogr. Sect. D 58:836-838.[CrossRef][Medline]
  6. 6 Carfi, A., S. H. Willis, J. C. Whitbeck, C. Krummenacher, G. H. Cohen, R. J. Eisenberg, and D. C. Wiley. 2001. Herpes simplex virus glycoprotein D bound to the human receptor HveA. Mol. Cell 8:169-179.[CrossRef][Medline]
  7. 7 Chiang, H.-Y., G. H. Cohen, and R. J. Eisenberg. 1994. Identification of functional regions of herpes simplex virus glycoprotein gD by using linker-insertion mutagenesis. J. Virol. 68:2529-2543.[Abstract/Free Full Text]
  8. 8 Clackson, T., and J. A. Wells. 1995. A hot spot of binding energy in a hormone-receptor interface. Science 267:383-386.[Abstract/Free Full Text]
  9. 9 Cocchi, F., L. Menotti, P. Mirandola, M. Lopez, and G. Campadelli-Fiume. 1998. The ectodomain of a novel member of the immunoglobulin subfamily related to the poliovirus receptor has the attribute of a bona fide receptor for herpes simplex virus types 1 and 2 in human cells. J. Virol. 72:9992-10002.[Abstract/Free Full Text]
  10. 10 Cohen, G. H., B. Dietzschold, M. Ponce de Leon, D. Long, E. Golub, A. Varrichio, L. Pereira, and R. J. Eisenberg. 1984. Localization and synthesis of an antigenic determinant of herpes simplex virus glycoprotein D that stimulates production of neutralizing antibody. J. Virol. 49:102-108.[Abstract/Free Full Text]
  11. 11 Cohen, G. H., V. J. Isola, J. Kuhns, P. W. Berman, and R. J. Eisenberg. 1986. Localization of discontinuous epitopes of herpes simplex virus glycoprotein D: use of a nondenaturing ("native" gel) system of polyacrylamide gel electrophoresis coupled with Western blotting. J. Virol. 60:157-166.[Abstract/Free Full Text]
  12. 12 Connolly, S. A., D. J. Landsburg, A. Carfi, D. C. Wiley, R. J. Eisenberg, and G. H. Cohen. 2002. Structure-based analysis of the herpes simplex virus glycoprotein D binding site present on herpesvirus entry mediator HveA (HVEM). J. Virol. 76:10894-10904.[Abstract/Free Full Text]
  13. 13 Connolly, S. A., J. C. Whitbeck, A. H. Rux, C. Krummenacher, S. van Drunen Littel-van den Hurk, G. H. Cohen, and R. J. Eisenberg. 2001. Glycoprotein D homologues in herpes simplex virus type 1, pseudorabies virus, and bovine herpes virus type 1 bind directly to human HveC (nectin-1) with different affinities. Virology 280:7-18.[CrossRef][Medline]
  14. 14 Dean, H. J., S. S. Terhune, M. Shieh, N. Susmarski, and P. G. Spear. 1994. Single amino acid substitutions in gD of herpes simplex virus 1 confer resistance to gD-mediated interference and cause cell-type-dependent alterations in infectivity. Virology 199:67-80.[CrossRef][Medline]
  15. 15 DeLano, W. L. 2002. Unraveling hot spots in binding interfaces: progress and challenges. Curr. Opin. Struct. Biol. 12:14-20.[CrossRef][Medline]
  16. 16 Eisenberg, R. J., C. P. Cerini, C. J. Heilman, A. D. Joseph, B. Dietzschold, E. Golub, D. Long, M. Ponce de Leon, and G. H. Cohen. 1985. Synthetic glycoprotein D-related peptides protect mice against herpes simplex virus challenge. J. Virol. 56:1014-1017.[Abstract/Free Full Text]
  17. 17 Eisenberg, R. J., D. Long, M. Ponce de Leon, J. T. Matthews, P. G. Spear, M. G. Gibson, L. A. Lasky, P. Berman, E. Golub, and G. H. Cohen. 1985. Localization of epitopes of herpes simplex virus type 1 glycoprotein D. J. Virol. 53:634-644.[Abstract/Free Full Text]
  18. 18 Feenstra, V., M. Hodaie, and D. C. Johnson. 1990. Deletions in herpes simplex virus glycoprotein D define nonessential and essential domains. J. Virol. 64:2096-2102.[Abstract/Free Full Text]
  19. 19 Foster, T. P., V. N. Chouljenko, and K. G. Kousoulas. 1999. Functional characterization of the HveA homolog specified by African green monkey kidney cells with a herpes simplex virus expressing the green fluorescence protein. Virology 258:365-374.[CrossRef][Medline]
  20. 20 Friedman, H. M., G. H. Cohen, R. J. Eisenberg, C. A. Seidel, and D. B. Cines. 1984. Glycoprotein C of herpes simplex virus 1 acts as a receptor for the C3b component of complement on infected cells. Nature 309:633-635.[CrossRef][Medline]
  21. 21 Geraghty, R. J., C. R. Jogger, and P. G. Spear. 2000. Cellular expression of alphaherpesvirus gD interferes with entry of homologous and heterologous alphaherpesviruses by blocking access to a shared gD receptor. Virology 268:147-158.[CrossRef][Medline]
  22. 22 Geraghty, R. J., C. Krummenacher, R. J. Eisenberg, G. H. Cohen, and P. G. Spear. 1998. Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 280:1618-1620.[Abstract/Free Full Text]
  23. 23 Guex, N., and M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714-2723.[CrossRef][Medline]
  24. 24 Harrop, J. A., P. C. McDonnell, M. Brigham-Burke, S. D. Lyn, J. Minton, K. B. Tan, K. Dede, J. Spampanato, C. Silverman, P. Hensley, R. DiPrinzio, J. G. Emery, K. Deen, C. Eichman, M. Chabot-Fletcher, A. Truneh, and P. R. Young. 1998. Herpesvirus entry mediator ligand (HVEM-L), a novel ligand for HVEM/TR2, stimulates proliferation of T cells and inhibits HT29 cell growth. J. Biol. Chem. 273:27548-27556.[Abstract/Free Full Text]
  25. 25 Hsu, S., I. Solovyev, A. Colombero, R. Elliott, M. Kelley, and W. J. Boyle. 1997. ATAR, a novel tumor necrosis factor receptor family member, signals through TRAF2 and TRAF5. J. Biol. Chem. 272:13471-13474.[Abstract/Free Full Text]
  26. 26 Isola, V. J., R. J. Eisenberg, G. R. Siebert, C. J. Heilman, W. C. Wilcox, and G. H. Cohen. 1989. Fine mapping of antigenic site II of herpes simplex virus glycoprotein D. J. Virol. 63:2325-2334.[Abstract/Free Full Text]
  27. 27 Izumi, K. M., and J. G. Stevens. 1990. Molecular and biological characterization of a herpes simplex virus type 1 (HSV-1) neuroinvasiveness gene. J. Exp. Med. 172:487-496.[Abstract/Free Full Text]
  28. 28 Krummenacher, C., A. V. Nicola, J. C. Whitbeck, H. Lou, W. Hou, J. D. Lambris, R. J. Geraghty, P. G. Spear, G. H. Cohen, and R. J. Eisenberg. 1998. Herpes simplex virus glycoprotein D can bind to poliovirus receptor-related protein 1 or herpesvirus entry mediator, two structurally unrelated mediators of virus entry. J. Virol. 72:7064-7074.[Abstract/Free Full Text]
  29. 29 Krummenacher, C., A. H. Rux, J. C. Whitbeck, M. Ponce de Leon, H. Lou, I. Baribaud, W. Hou, C. Zou, R. J. Geraghty, P. G. Spear, R. J. Eisenberg, and G. H. Cohen. 1999. The first immunoglobulin-like domain of HveC is sufficient to bind herpes simplex virus gD with full affinity while the third domain is involved in oligomerization of HveC. J. Virol. 73:8127-8137.[Abstract/Free Full Text]
  30. 30 Kwon, B. S., K. B. Tan, J. Ni, K. O. Oh, Z. H. Lee, K. K. Kim, Y. J. Kim, S. Wang, R. Gentz, G.-L. Yu, J. Harrop, S. D. Lyn, C. Silverman, T. G. Porter, A. Truneh, and P. R. Young. 1997. A newly identified member of the tumor necrosis factor receptor superfamily with a wide tissue distribution and involvement in lymphocyte activation. J. Biol. Chem. 272:14272-14276.[Abstract/Free Full Text]
  31. 31 Ligas, M. W., and D. C. Johnson. 1988. A herpes simplex virus mutant in which glycoprotein D sequences are replaced by ß-galactosidase sequences binds to but is unable to penetrate into cells. J. Virol. 62:1486-1494.[Abstract/Free Full Text]
  32. 32 Lopez, M., F. Cocchi, L. Menotti, E. Avitabile, P. Dubreuil, and G. Campadelli-Fiume. 2000. Nectin2{alpha} (PRR2{alpha} or HveB) and nectin2{Delta} are low-efficiency mediators for entry of herpes simplex virus mutants carrying the Leu25Pro substitution in glycoprotein D. J. Virol. 74:1267-1274.[Abstract/Free Full Text]
  33. 33 Marsters, S. A., T. M. Ayres, M. Skubatch, C. L. Gray, M. Rothe, and A. Ashkenazi. 1997. Herpes virus entry mediator, a member of the tumor necrosis factor receptor (TNFR) family, interacts with members of the TNFR-associated factor family and activates the transcription factors NF-{kappa}B and AP-1. J. Biol. Chem. 272:14029-14032.[Abstract/Free Full Text]
  34. 34 Mata, M., M. Zhang, X. Hu, and D. J. Fink. 2001. HveC (nectin-1) is expressed at high levels in sensory neurons, but not in motor neurons, of the rat peripheral nervous system. J. Neurovirol. 7:476-480.[CrossRef][Medline]
  35. 35 Menotti, L., E. Avitabile, P. Dubreuil, M. Lopez, and G. Campadelli-Fiume. 2001. Comparison of murine and human nectin1 binding to herpes simplex virus glycoprotein D (gD) reveals a weak interaction of murine nectin1 to gD and a gD-dependent pathway of entry. Virology 282:256-266.[CrossRef][Medline]
  36. 36 Miller, C. G., C. Krummenacher, R. J. Eisenberg, G. H. Cohen, and N. W. Fraser. 2001. Development of a syngenic murine B16 cell line-derived melanoma susceptible to destruction by neuroattenuated HSV-1. Mol. Ther. 3:160-168.[CrossRef][Medline]
  37. 37 Milne, R. S. B., S. A. Connolly, C. Krummenacher, R. J. Eisenberg, and G. H. Cohen. 2001. Porcine HveC, a member of the highly conserved HveC/nectin 1 family, is a functional alphaherpesvirus receptor. Virology 281:315-328.[CrossRef][Medline]
  38. 37 Milne, R. S. B., S. L. Hanna, A. H. Rux, S. H. Willis, G. H. Cohen, and R. J. Eisenberg. Function of herpes simplex virus type 1 gD mutants with different receptor-binding affinities in virus entry and fusion. J. Virol., in press.
  39. 38 Minson, A. C., T. C. Hodgman, P. Digard, D. C. Hancock, S. E. Bell, and E. A. Buckmaster. 1986. An analysis of the biological properties of monoclonal antibodies against glycoprotein D of herpes simplex virus and identification of amino acid substitutions that confer resistance to neutralization. J. Gen. Virol. 67:1001-1013.[Abstract/Free Full Text]
  40. 39 Montgomery, R. I., M. S. Warner, B. J. Lum, and P. G. Spear. 1996. Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family. Cell 87:427-436.[CrossRef][Medline]
  41. 40 Muggeridge, M. I. 2000. Characterization of cell-cell fusion mediated by herpes simplex virus 2 glycoproteins gB, gD, gH and gL in transfected cells. J. Gen. Virol. 81:2017-2027.[Abstract/Free Full Text]
  42. 41 Muggeridge, M. I., V. J. Isola, R. A. Byrn, T. J. Tucker, A. C. Minson, J. C. Glorioso, G. H. Cohen, and R. J. Eisenberg. 1988. Antigenic analysis of a major neutralization site of herpes simplex virus glycoprotein D, using deletion mutants and monoclonal antibody-resistant mutants. J. Virol. 62:3274-3280.[Abstract/Free Full Text]
  43. 42 Muggeridge, M. I., S. R. Roberts, V. J. Isola, G. H. Cohen, and R. J. Eisenberg. 1990. Herpes simplex virus, p. 459-481. In M. H. V. Van Regenmortel and A. R. Neurath (ed.), Immunochemistry of viruses, vol. II. The basis for serodiagnosis and vaccines. Elsevier Biochemical Press, Amsterdam, The Netherlands.
  44. 43 Muggeridge, M. I., W. C. Wilcox, G. H. Cohen, and R. J. Eisenberg. 1990. Identification of a site on herpes simplex virus type 1 gD that is essential for infectivity. J. Virol. 64:3617-3626.[Abstract/Free Full Text]
  45. 44 Muggeridge, M. I., T.-T. Wu, D. C. Johnson, J. C. Glorioso, R. J. Eisenberg, and G. H. Cohen. 1990. Antigenic and functional analysis of a neutralization site of HSV-1 glycoprotein D. Virology 174:375-387.[CrossRef][Medline]
  46. 45 Naismith, J. H., T. Q. Devine, T. Kohno, and S. R. Sprang. 1996. Structures of the extracellular domain of the type I tumor necrosis factor receptor. Structure 4:1251-1262.[Medline]
  47. 46 Nicola, A. V., M. Ponce de Leon, R. Xu, W. Hou, J. C. Whitbeck, C. Krummenacher, R. I. Montgomery, P. G. Spear, R. J. Eisenberg, and G. H. Cohen. 1998. Monoclonal antibodies to distinct sites on the herpes simplex virus (HSV) glycoprotein D block HSV binding to HVEM. J. Virol. 72:3595-3601.[Abstract/Free Full Text]
  48. 47 Nicola, A. V., S. H. Willis, N. N. Naidoo, R. J. Eisenberg, and G. H. Cohen. 1996. Structure-function analysis of soluble forms of herpes simplex virus glycoprotein D. J. Virol. 70:3815-3822.[Abstract/Free Full Text]
  49. 48 Okuma, K., M. Nakamura, S. Nakano, Y. Niho, and Y. Matsuura. 1999. Host range of human T-cell leukemia virus type I analyzed by a cell fusion-dependent reporter gene activation assay. Virology 254:235-244.[CrossRef][Medline]
  50. 49 Peng, T., M. Ponce de Leon, H. Jiang, G. Dubin, J. Lubinski, R. J. Eisenberg, and G. H. Cohen. 1998. The gH-gL complex of herpes simplex virus (HSV) stimulates neutralizing antibody and protects mice against HSV type 1 challenge. J. Virol. 72:65-72.[Abstract/Free Full Text]
  51. 50 Pereira, L., T. Klassen, and J. R. Baringer. 1980. Type-common and type-specific monoclonal antibody to herpes simplex virus type 1. Infect. Immun. 29:724-732.[Abstract/Free Full Text]
  52. 51 Pertel, P. E., A. Fridberg, M. L. Parish, and P. G. Spear. 2001. Cell fusion induced by herpes simplex virus glycoproteins gB, gD, and gH-gL requires a gD receptor but not necessarily heparan sulfate. Virology 279:313-324.[CrossRef][Medline]
  53. 52 Raftery, M. J., C. K. Behrens, A. Muller, P. H. Krammer, H. Walczak, and G. Schonrich. 1999. Herpes simplex virus type 1 infection of activated cytotoxic T cells: induction of fratricide as a mechanism of viral immune evasion. J. Exp. Med. 190:1103-1113.[Abstract/Free Full Text]
  54. 53 Richart, S. M., S. A. Simpson, C. Krummenacher, J. C. Whitbeck, L. I. Pizer, G. H. Cohen, R. J. Eisenberg, and C. L. Wilcox. 2003. Entry of herpes simplex virus type 1 into primary sensory neurons in vitro is mediated by nectin-1/HveC. J. Virol. 77:3307-3311.[Abstract/Free Full Text]
  55. 54 Simmons, A., and A. A. Nash. 1985. Role of antibody in primary and recurrent herpes simplex virus infection. J. Virol. 53:944-948.[Abstract/Free Full Text]
  56. 55 Simmons, A., and A. A. Nash. 1984. Zosterform spread of herpes simplex as a model of recrudescence and its use to investigate the role of immune cells in prevention of recurrent disease. J. Virol. 52:816-821.[Abstract/Free Full Text]
  57. 56 Spear, P. G., R. J. Eisenberg, and G. H. Cohen. 2000. Three classes of cell surface receptors for alphaherpesvirus entry. Virology 275:1-8.[CrossRef][Medline]
  58. 57 Tan, K. B., J. Harrop, M. Reddy, P. Young, J. Terrett, J. Emery, G. Moore, and A. Truneh. 1997. Characterization of a novel TNF-like ligand and recently described TNF ligand and TNF receptor superfamily genes and their constitutive and inducible expression in hematopoietic and non-hematopoietic cells. Gene 204:35-46.[CrossRef][Medline]
  59. 58 Terry-Allison, T., R. I. Montgomery, J. C. Whitbeck, R. Xu, G. H. Cohen, R. J. Eisenberg, and P. G. Spear. 1998. HveA (herpesvirus entry mediator A), a coreceptor for herpes simplex virus entry, also participates in virus-induced cell fusion. J. Virol. 72:5802-5810.[Abstract/Free Full Text]
  60. 59 Turner, A., B. Bruun, T. Minson, and H. Browne. 1998. Glycoproteins gB, gD, and gHgL of herpes simplex virus type 1 are necessary and sufficient to mediate membrane fusion in a Cos cell transfection system. J. Virol. 72:873-875.[Abstract/Free Full Text]
  61. 60 Warner, M. S., W. Martinez, R. J. Geraghty, R. I. Montgomery, J. C. Whitbeck, R. Xu, R. J. Eisenberg, G. H. Cohen, and P. G. Spear. 1998. A cell surface protein with herpesvirus entry activity (HveB) confers susceptibility to infection by herpes simplex virus type 2, mutants of herpes simplex virus type 1 and pseudorabies virus. Virology 246:179-189.[CrossRef][Medline]
  62. 61 Wells, J. A. 1991. Systematic mutational analyses of protein-protein interfaces. Methods Enzymol. 202:390-411.[Medline]
  63. 62 Whitbeck, J. C., S. A. Connolly, S. H. Willis, W. Hou, C. Krummenacher, M. Ponce de Leon, H. Lou, I. Baribaud, R. J. Eisenberg, and G. H. Cohen. 2001. Localization of the gD-binding region of the human herpes simplex virus receptor, HveA. J. Virol. 75:171-180.[Abstract/Free Full Text]
  64. 63 Whitbeck, J. C., M. I. Muggeridge, A. Rux, W. Hou, C. Krummenacher, H. Lou, A. van Geelen, R. J. Eisenberg, and G. H. Cohen. 1999. The major neutralizing antigenic site on herpes simplex virus glycoprotein D overlaps a receptor-binding domain. J. Virol. 73:9879-9890.[Abstract/Free Full Text]
  65. 64 Whitbeck, J. C., C. Peng, H. Lou, R. Xu, S. H. Willis, M. Ponce de Leon, T. Peng, A. V. Nicola, R. I. Montgomery, M. S. Warner, A. M. Soulika, L. A. Spruce, W. T. Moore, J. D. Lambris, P. G. Spear, G. H. Cohen, and R. J. Eisenberg. 1997. Glycoprotein D of herpes simplex virus (HSV) binds directly to HVEM, a member of the TNFR superfamily and a mediator of HSV entry. J. Virol. 71:6083-6093.[Abstract/Free Full Text]
  66. 65 Willis, S. H., A. H. Rux, C. Peng, J. C. Whitbeck, A. V. Nicola, H. Lou, W. Hou, L. Salvador, G. H. Cohen, and R. J. Eisenberg. 1998. Examination of the kinetics of herpes simplex virus glycoprotein D binding to the herpesvirus entry mediator, using surface plasmon resonance. J. Virol. 72:5937-5947.[Abstract/Free Full Text]

Journal of Virology, July 2003, p. 8127-8140, Vol. 77, No. 14
0022-538X/03/$08.00+0     DOI: 10.1128/JVI.77.14.8127-8140.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Silverman, J. L., Sharma, S., Cairns, T. M., Heldwein, E. E. (2010). Fusion-Deficient Insertion Mutants of Herpes Simplex Virus Type 1 Glycoprotein B Adopt the Trimeric Postfusion Conformation. J. Virol. 84: 2001-2012 [Abstract] [Full Text]  
  • Hannah, B. P., Cairns, T. M., Bender, F. C., Whitbeck, J. C., Lou, H., Eisenberg, R. J., Cohen, G. H. (2009). Herpes Simplex Virus Glycoprotein B Associates with Target Membranes via Its Fusion Loops. J. Virol. 83: 6825-6836 [Abstract] [Full Text]  
  • Uchida, H., Shah, W. A., Ozuer, A., Frampton, A. R. Jr., Goins, W. F., Grandi, P., Cohen, J. B., Glorioso, J. C. (2009). Generation of Herpesvirus Entry Mediator (HVEM)-Restricted Herpes Simplex Virus Type 1 Mutant Viruses: Resistance of HVEM-Expressing Cells and Identification of Mutations That Rescue Nectin-1 Recognition. J. Virol. 83: 2951-2961 [Abstract] [Full Text]  
  • Sun, C., Zhang, B., Jin, J., Montelaro, R. C. (2008). Binding of equine infectious anemia virus to the equine lentivirus receptor-1 is mediated by complex discontinuous sequences in the viral envelope gp90 protein. J. Gen. Virol. 89: 2011-2019 [Abstract] [Full Text]  
  • Reske, A., Pollara, G., Krummenacher, C., Katz, D. R., Chain, B. M. (2008). Glycoprotein-Dependent and TLR2-Independent Innate Immune Recognition of Herpes Simplex Virus-1 by Dendritic Cells. J. Immunol. 180: 7525-7536 [Abstract] [Full Text]  
  • Lazear, E., Carfi, A., Whitbeck, J. C., Cairns, T. M., Krummenacher, C., Cohen, G. H., Eisenberg, R. J. (2008). Engineered Disulfide Bonds in Herpes Simplex Virus Type 1 gD Separate Receptor Binding from Fusion Initiation and Viral Entry. J. Virol. 82: 700-709 [Abstract] [Full Text]  
  • Li, Q., Krogmann, T., Ali, M. A., Tang, W.-J., Cohen, J. I. (2007). The Amino Terminus of Varicella-Zoster Virus (VZV) Glycoprotein E Is Required for Binding to Insulin-Degrading Enzyme, a VZV Receptor. J. Virol. 81: 8525-8532 [Abstract] [Full Text]  
  • Zhou, G., Roizman, B. (2007). Separation of receptor-binding and profusogenic domains of glycoprotein D of herpes simplex virus 1 into distinct interacting proteins. Proc. Natl. Acad. Sci. USA 104: 4142-4146 [Abstract] [Full Text]  
  • Menotti, L., Cerretani, A., Campadelli-Fiume, G. (2006). A Herpes Simplex Virus Recombinant That Exhibits a Single-Chain Antibody to HER2/neu Enters Cells through the Mammary Tumor Receptor, Independently of the gD Receptors. J. Virol. 80: 5531-5539 [Abstract] [Full Text]  
  • Willett, B. J., McMonagle, E. L., Ridha, S., Hosie, M. J. (2006). Differential Utilization of CD134 as a Functional Receptor by Diverse Strains of Feline Immunodeficiency Virus. J. Virol. 80: 3386-3394 [Abstract] [Full Text]  
  • Compaan, D. M., Gonzalez, L. C., Tom, I., Loyet, K. M., Eaton, D., Hymowitz, S. G. (2005). Attenuating Lymphocyte Activity: THE CRYSTAL STRUCTURE OF THE BTLA-HVEM COMPLEX. J. Biol. Chem. 280: 39553-39561 [Abstract] [Full Text]  
  • Cheung, T. C., Humphreys, I. R., Potter, K. G., Norris, P. S., Shumway, H. M., Tran, B. R., Patterson, G., Jean-Jacques, R., Yoon, M., Spear, P. G., Murphy, K. M., Lurain, N. S., Benedict, C. A., Ware, C. F. (2005). From The Cover: Evolutionarily divergent herpesviruses modulate T cell activation by targeting the herpesvirus entry mediator cosignaling pathway. Proc. Natl. Acad. Sci. USA 102: 13218-13223 [Abstract] [Full Text]  
  • Milne, R. S. B., Nicola, A. V., Whitbeck, J. C., Eisenberg, R. J., Cohen, G. H. (2005). Glycoprotein D Receptor-Dependent, Low-pH-Independent Endocytic Entry of Herpes Simplex Virus Type 1. J. Virol. 79: 6655-6663 [Abstract] [Full Text]  
  • Perez-Romero, P., Perez, A., Capul, A., Montgomery, R., Fuller, A. O. (2005). Herpes Simplex Virus Entry Mediator Associates in Infected Cells in a Complex with Viral Proteins gD and at Least gH. J. Virol. 79: 4540-4544 [Abstract] [Full Text]  
  • Connolly, S. A., Landsburg, D. J., Carfi, A., Whitbeck, J. C., Zuo, Y., Wiley, D. C., Cohen, G. H., Eisenberg, R. J. (2005). Potential Nectin-1 Binding Site on Herpes Simplex Virus Glycoprotein D. J. Virol. 79: 1282-1295 [Abstract] [Full Text]  
  • Yoon, M., Spear, P. G. (2004). Random mutagenesis of the gene encoding a viral ligand for multiple cell entry receptors to obtain viral mutants altered for receptor usage. Proc. Natl. Acad. Sci. USA 101: 17252-17257 [Abstract] [Full Text]  
  • Manoj, S., Jogger, C. R., Myscofski, D., Yoon, M., Spear, P. G. (2004). Inaugural Article: Mutations in herpes simplex virus glycoprotein D that prevent cell entry via nectins and alter cell tropism. Proc. Natl. Acad. Sci. USA 101: 12414-12421 [Abstract] [Full Text]  
  • Silva, A. L., Omerovic, J., Jardetzky, T. S., Longnecker, R. (2004). Mutational Analyses of Epstein-Barr Virus Glycoprotein 42 Reveal Functional Domains Not Involved in Receptor Binding but Required for Membrane Fusion. J. Virol. 78: 5946-5956 [Abstract] [Full Text]  
  • Cocchi, F., Fusco, D., Menotti, L., Gianni, T., Eisenberg, R. J., Cohen, G. H., Campadelli-Fiume, G. (2004). The soluble ectodomain of herpes simplex virus gD contains a membrane-proximal pro-fusion domain and suffices to mediate virus entry. Proc. Natl. Acad. Sci. USA 101: 7445-7450 [Abstract] [Full Text]  
  • Cattaneo, R. (2004). Four Viruses, Two Bacteria, and One Receptor: Membrane Cofactor Protein (CD46) as Pathogens' Magnet. J. Virol. 78: 4385-4388 [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Connolly, S. A.
Right arrow Articles by Eisenberg, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Connolly, S. A.
Right arrow Articles by Eisenberg, R. J.

Copyright © 2010 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»