This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanchard, E.
Right arrow Articles by Roingeard, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanchard, E.
Right arrow Articles by Roingeard, P.

 Previous Article  |  Next Article 

Journal of Virology, April 2002, p. 4073-4079, Vol. 76, No. 8
0022-538X/02/$04.00+0     DOI: 10.1128/JVI.76.8.4073-4079.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Hepatitis C Virus-Like Particle Morphogenesis

Emmanuelle Blanchard,1 Denys Brand,1 Sylvie Trassard,2 Alain Goudeau,1 and Philippe Roingeard1,2*

Laboratoire de Virologie et,1 Laboratoire de Biologie Cellulaire, E3M-EA3250, IFR 82, Faculté de Médecine et Centre Hospitalier Universitaire, Tours, France2

Received 4 October 2001/ Accepted 9 January 2002


arrow
ABSTRACT
 
Although much is known about the hepatitis C virus (HCV) genome, first cloned in 1989, little is known about HCV structure and assembly due to the lack of an efficient in vitro culture system for HCV. Using a recombinant Semliki forest virus replicon expressing genes encoding HCV structural proteins, we observed for the first time the assembly of these proteins into HCV-like particles in mammalian cells. This system opens up new possibilities for the investigation of viral morphogenesis and virus-host cell interactions.


arrow
TEXT
 
Hepatitis C virus (HCV) infection is a major cause of chronic hepatitis and cirrhosis and may lead to hepatocellular carcinoma. With an estimated 170 million people worldwide chronically infected with HCV, this disease has emerged as a serious global health problem since the cloning of the viral genome in 1989 (6). HCV is an enveloped RNA virus belonging to the genus Hepacivirus of the Flaviviridae family. Its genome is a 9.6-kb single-stranded RNA of positive polarity with a 5' untranslated region (UTR) that functions as an internal ribosome entry site, a single long open reading frame encoding a polyprotein of approximately 3,000 amino acids (aa) and a 3' UTR (1). This polypeptide is posttranslationally cleaved by host cell peptidases to yield three structural proteins and by viral proteases, which generate the five nonstructural proteins. The structural proteins, which are located in the amino-terminal region of the polyprotein, include the core protein and the envelope glycoproteins E1 and E2. The nonstructural proteins (NS) 2 to 5B are separated from the structural proteins by the short hydrophobic polypeptide p7, the function of which is unknown (1). By analogy to related positive-strand RNA viruses, replication occurs by means of a negative-strand RNA intermediate and is catalyzed by the NS proteins, which form a cytoplasmic membrane-associated replicase complex.

Several entire cloned HCV genomes are able to initiate infection when introduced directly into chimpanzee livers (11). However, the transfection of cell lines with constructs containing these genomes does not result in HCV replication in vitro (1). Similarly, the use of infected sera to infect cell lines or primary cell cultures has yielded disappointing results because infection and replication are very inefficient (2). Molecular studies of the HCV infectious cycle in the host cell and the development of specific anti-HCV agents have been considerably hampered by the inability to achieve propagation of the virus in cultured cells in vitro. A significant advance in HCV research was recently made with the development of subgenomic HCV RNAs consisting of sequences encoding nonstructural proteins flanked by the 5' and 3' UTRs, which self-replicate in hepatoma cells (4, 18). However, this model cannot be used to address the structural features of the virion or its assembly pathway. In addition, viral particles are difficult to observe by electron microscopy in the plasma or liver tissues of infected patients. A number of attempts have been made to obtain recombinant HCV particles, but only Baumert et al. (3) have reported the obtainment of HCV-like particles in insect cells, using recombinant baculoviruses expressing genes for HCV structural proteins. However, although particles containing the three HCV structural proteins were generated, they were unstructured and heterogeneous.

As flaviviruses and alphaviruses have similar structural features (12) and aspects of their replication strategies in common, we thought that expression from an alphavirus expression vector, such as the Semliki forest virus (SFV) vector (25), might result in the production of HCV-like particles (Fig. 1). Due to the self-amplifying nature of the vector RNA, the SFV vector is constructed in a format known as a replicon, which combines a large host spectrum and the production of large amounts of proteins in transfected cells. Replicons contain both the cis and trans alphavirus genetic elements required for RNA replication and heterologous gene expression via the native subgenomic promoter. Upon introduction into various mammalian cells, the replicon RNA is translated to produce the four nonstructural SFV proteins, which together comprise the alphaviral replicase. Replication proceeds through a minus-strand RNA intermediate and generates two different positive-strand RNA species, corresponding to a genome-length vector RNA and an abundant subgenomic RNA encoding the heterologous proteins.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1. Organization of SFV and HCV RNA genomes and description of our SFV-HCVdj DNA construct encoding HCV structural proteins. Flaviviruses differ from alphaviruses in genome structure (structural genes situated at the 5' end of the genome) and in the absence of subgenomic RNA.

The HCV C-E1-E2 sequence was amplified from the serum of a patient chronically infected with HCV genotype 1a before antiviral treatment. Briefly, viral RNA was reverse transcribed with SuperScript II (Invitrogen, Carlsbad, Calif.) in the presence of the ext 3' primer (5'ATAAACATAGGTGCCAGTAAGCG 3'). The products of this reaction were incubated for 20 min at 37°C with 2 U of RNase H and were then used for the first PCR with the ext 3' and ext 5' (5' GGAGAGCCATAGTGGTCTGCG 3') primers using Taq polymerase (Applied-Biosystems/Roche, Branchburg, N.J.). We used 35 cycles of 94°C for 15 s, 59°C for 30 s, and 72°C for 3 min. DNA from this first PCR was used as a template for a second reaction using primers flanked by BamHI sites: int 5' (5' GTGGATCCTGCACCATGAGCACGAATCCT 3') and int 3' (5' GAGGATCCCCATTACCGCCTCCGCTTGGGATAT 3') containing a stop codon introduced at the 3' end of the E2 protein coding region. After 35 cycles as described above, the PCR product (2,270 bp) was inserted into the BamHI site of the expression vector pSFV1 (Life Technologies, Rockville, Md.), which contains an SP6 RNA polymerase promoter upstream from the 5' SFV UTR.

The electroporation of BHK-21 cells with RNA produced by transcription of this construct, according to standard protocols provided by the manufacturer (Life Technologies), led to the production of large amounts of the three HCV structural proteins. More than 90% of the cells tested positive for these proteins by immunocytochemistry performed with previously described protocols (21) and monoclonal antibodies described elsewhere (8) (Fig. 2A). Staining patterns were consistent with those of previous studies based on the expression of individual genes encoding these structural proteins in mammalian cells, showing a cytoplasmic and granular distribution for the core protein (20) and a more homogeneous cytoplasmic distribution for the E1 and E2 proteins (8). For Western blot analysis, transfected BHK-21 cells were lysed with 1% Triton X-100, 140 mM NaCl, 10 mM Tris-HCl (pH 8), 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mM phenylmethylsulfonyl fluoride, 2 µg of aprotinin/ml, and 2 µg of leupeptin/ml. The lysed cells were subjected to low-speed centrifugation, and the proteins they contained were separated by electrophoresis in a sodium dodecyl sulfate-12% polyacrylamide gel and transferred to polyvinylidene difluoride membranes. Blots were incubated overnight at 4°C with the various monoclonal antibodies diluted 1/1,000 in 50 mM Tris-HCl-150 mM NaCl (pH 7.5)-0.1% Tween buffer, and antibody binding was detected by incubation with horseradish peroxidase-conjugated anti-mouse immunoglobulin G antibodies followed by diaminobenzidine staining. This Western blotting showed that the partial polyprotein encoded by the HCVdj construct was correctly processed by host-cell enzymes, leading to the detection of viral proteins of the expected sizes (Fig. 2B). Monoclonal antibody directed against the HCV core protein detected similar amounts of two species, approximately 22 and 24 kDa in size. Previous studies have suggested that the larger of these two molecules is a 191-aa core precursor and that the smaller molecule is generated by cleavage of the larger molecule, at around aa 174, by a host signal peptidase on the endoplasmic reticulum (ER) (17, 24). The 22-kDa protein (p22 here but p21 in other studies) was the only protein detected in the sera of chronically infected HCV patients and is believed to correspond to the mature form of the HCV core protein (27). Monoclonal antibody directed against the HCV E1 protein detected two major bands, 32 and 35 kDa in size, corresponding to the two main glycosylation forms of the E1 protein (8). Some minor bands, probably corresponding to other glycoforms of the E1 protein, were also observed in this blot. Monoclonal anti-E2 antibody detected a major band at 70 kDa, corresponding to the glycosylated form of the E2 protein, as well as a minor band at 38 kDa that probably corresponds to an unglycosylated form of E2 (8). In addition, both anti-E1 and anti-E2 monoclonal antibodies identified a band of around 100 kDa in size which may correspond to E1-E2 heterodimers, as previously described (8). This is important because the E1 and E2 proteins form not only a disulfide-linked heterodimer corresponding to misfolded aggregates (8, 9) but also a noncovalently linked heterodimer that probably corresponds to the native prebudding complex (7). Alternatively, we cannot exclude the possibility that incomplete cleavage at site between E1 and E2 in the polyprotein generated this 100-kDa band. Interestingly, the level of E1 and E2 proteins obtained with our SFV expression system in mammalian cells seems to be higher than for the baculovirus expression system that allows production of virus-like particles in insect cells (3, 19). However, the core protein amount was much lower with the SFV expression system, confirming the previous observation that showed important differences between mammalian and insect cells for the core protein expression (3).



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 2. Production of HCV structural proteins in BHK-21 cells following electroporation. After linearization by digestion with SpeI, the SFV-HCVdj vector was used as a template for the in vitro synthesis of recombinant RNA. For the negative control, recombinant ß-Gal RNA, which encodes the ß-Gal protein, was synthesized from the expression vector pSFV3 (Life Technologies). After electroporation and culture for 24 h, transfected cells were analyzed by immunofluorescence staining (A) and Western blotting (B) with monoclonal antibodies against HCV capsid protein (MAB8424 from Chemicon, Temecula, Calif.), E1 (A4; gift from Harry Greenberg) (7), and E2 (H52; gift from Jean Dubuisson) (7); size markers (SM) were from Bio-Rad (Hercules, Calif.).

The most original data concerning HCV structural protein production from the SFV vector were provided by our electron microscopy (EM) analysis. Transfected cells were fixed in 4% paraformaldehyde and 1% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) for 48 h and were then postfixed with 1% osmium tetroxide for 1 h. They were then dehydrated in a graded acetone series, and cell pellets were embedded in epon resin that was allowed to polymerize for 24 h at 60°C. Ultrathin sections were cut and stained with 1% uranyl acetate-1% lead citrate. At low magnification (Fig. 3), major ER morphological differences were observed between most of the cells transfected with HCVdj RNA cells and cells transfected with ß-Gal (ß-galactosidase) RNA. In the control cells, the ER was homogeneously distributed throughout the cytoplasm (Fig. 3B), whereas areas of convoluted membranes were present in the HCVdj-transfected cells (Fig. 3A). The self-assembly of proteins at these convoluted membranes was observed as electron-dense hemispherical structures. This phenomenon, which was not detected in cells transfected with ß-Gal RNA or in the various SFV expression experiments performed in our laboratory (5, 13), was clearly due to production of the HCV structural proteins. Higher magnifications (Fig. 4) of this electron-dense material revealed budding of virus-like particles 50 nm in diameter towards the dilated ER lumen. In some electron micrographs (particularly Fig. 4B, C, and D), core-like particles 30 nm in diameter surrounded by an ER-derived envelope, yielding a particle with a total diameter of 50 nm, were observed. In some electron micrographs (Fig. 4D), we observed the dual packaging of capsids into the same portion of the envelope as seen for other viruses, such as the hepatitis B virus (22). To confirm the specificity of these observations, we carried out immunogold labeling with the various monoclonal antibodies and the transfected cell sections. Cells were fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2) for 3 h. They were then dehydrated in a graded series of alcohol solutions, and cell pellets were embedded in London resin white (Taab Lab Equipment, Aldermaston, United Kingdom). The resin was allowed to polymerize at -25°C for 72 h. Ultrathin sections were cut and incubated with the various monoclonal antibodies diluted 1/400 in phosphate-buffered saline. Immunolabeling was detected by incubation with gold-conjugated goat anti-mouse immunoglobulin G antibodies diluted 1/100 in phosphate-buffered saline. Due to the modifications of the fixation and embedding procedures necessary for this specific immunostaining method (particularly the absence of glutaraldehyde and osmium tetroxide), the cell structures were less well preserved than those of cells subjected to the regular EM method described above (Fig. 5). However, intense gold labeling, restricted to the convoluted ER membranes of the HCVdj RNA-transfected cells, was clearly observed with the three monoclonal antibodies (Fig. 5A). Prebudding or budding structures at these ER membranes were strongly labeled with both anti-E1 and anti-core antibodies (Fig. 5A and C, arrows). Cells transfected with the ß-Gal RNA showed no gold labeling (Fig. 5B).



View larger version (165K):
[in this window]
[in a new window]
  		FIG. 3. Electron micrographs at low magnification of ultrathin sections of BHK-21 cells electroporated with the HCVdj RNA (A) or ß-Gal RNA (B). Bar, 500 nm. Arrows indicate the ER structures, normally distributed in the cytoplasm in panel B but forming areas of convoluted membranes in panel A. n, nucleus.



View larger version (188K):
[in this window]
[in a new window]
  		FIG. 4. Electron micrographs at high magnification of ultrathin sections of BHK-21 cells electroporated with the HCVdj RNA. Bars, 100 nm (A) and 50 nm (B, C, and D). Arrows indicate virus-like particles budding towards the ER lumen. The two particles in panel B may represent different steps for this phenomenon, from early (small arrow) to late (larger arrow) events. c, cytoplasm; lu, lumen.



View larger version (173K):
[in this window]
[in a new window]
  		FIG. 5. Immunogold labeling of ultrathin section of BHK-21 cells electroporated with the HCVdj RNA (A and C) and ß-Gal RNA (B) and stained with anti-E1 (A and B) or anti-core (C) antibodies. Arrows indicate prebudding or budding structures in which gold labeling was particularly concentrated. Bars, 200 nm (A and B) and 50 nm (C). c, cytoplasm; lu, lumen.

These EM observations demonstrate that the HCV core proteins self-assemble at the ER-membrane rather than in the cytoplasm and form a structured capsid rather than a nonstructured ribonucloprotein complex. This is consistent with a recent report showing that, in a cell-free assay, HCV core proteins produced in bacteria self-assemble into nucleocapsids in the presence of viral or nonviral RNA molecules with secondary structures (16). It is unclear whether the SFV replication complex recently found to be associated with internal host-cell membranes (15) is involved in the assembly of the HCV capsid in a cellular system. At this time, it is also unclear whether our HCV-like particles contain RNA. As our construct contained no 5' HCV UTR sequence, virus-like particle assembly may in this case involve the region of the HCV RNA encoding the core, which is believed to be involved in encapsidation (26). Our observations strongly suggest that the HCV capsid acquires its envelope by budding through ER membranes, as for other members of the flavivirus family. This was already suspected because the HCV envelope proteins are retained in the ER compartment when produced by various heterologous expression systems in cell cultures (8, 10), but our experiments provide the first visualization of this process.

Our EM observations also suggest that most of the particles formed in transfected BHK-21 cells have an abortive or slow budding process. Indeed, few particles were fully released from the ER membrane. This observation is consistent with the fact that no HCV structural proteins were detected in the transfected cell supernatant by Western blotting, even after the concentration of the supernatant by ultracentrifugation. This contrasts with the large amount of viral proteins detected within cells and the frequent observation of viral budding on cell sections. Despite the inefficiency of particle secretion, our system remains an important and original tool for studies of virus assembly mechanisms and virus-host cell interactions. We now need to identify the host cell or virus factors required for particle secretion in this system. For instance, viral accessory proteins, such as p7 or NS2 (1), and/or host cell factors, such as apolipoprotein AII (23), may be involved in virus secretion.

By analogy with another flavivirus, the Kunjin virus (KUN), it will also be of interest to investigate whether our system transcomplements the replicating HCV subgenomic RNAs described elsewhere (4, 18). In this model, virus-like particles containing a KUN RNA replicon are secreted from BHK-21 cells sequentially cotransfected with a KUN replicon RNA and an SFV vector expressing genes encoding the KUN structural proteins (14). Interestingly, transfection with an SFV vector encoding the KUN structural proteins alone does not lead to the secretion of virus-like particles in this model (14). This suggests that the presence of an efficient HCV RNA replicon may be required for particle release from the host cell in our SFV-HCVdj expression system. The simultaneous use of these two systems in the same cells, as for the KUN model, may be the way to establish the long-awaited in vitro culture system for HCV. However, HCV RNA replicons have been shown only to replicate in clones of the hepatoma Huh-7 cell line, and the efficiency of HCV-like particle formation in these Huh-7 clones remains to be addressed.


arrow
ACKNOWLEDGMENTS
 
We thank C. Sureau for critical reading of the manuscript and helpful discussions and F. Dubois and F. Barin for stimulating discussions. We are indebted to Harry Greenberg and Jean Dubuisson for providing us with the anti-E1 antibody and the anti-E2 antibody, respectively.

This work was supported by grant "Hépatite C" from the "Agence Nationale pour la Recherche sur le Sida (ANRS)," France. E. Blanchard is supported by a fellowship provided by the Région Centre.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Laboratoire de Biologie Cellulaire, Faculté de Médecine, 2 bis Boulevard Tonnellé, 37032 Tours, France. Phone: (33) 2 47 36 60 71. Fax: (33) 2 47 36 60 90. E-mail: roingeard{at}med.univ-tours.fr. Back


arrow
REFERENCES
 
    1
  1. Bartenschlager, R., and V. Lohman. 2000. Replication of hepatitis C virus. J. Gen. Virol. 81:1631-1648.[Free Full Text]
    2. 2
  2. Bartenschlager, R., and V. Lohman. 2001. Novel cell culture systems for the hepatitis C virus. Antivir. Res. 52:1-17.[CrossRef][Medline]
    3. 3
  3. Baumert, T. F., S. Ito, D. T. Wong, and T. J. Liang. 1998. Hepatitis C virus structural proteins assemble into virus-like particles in insect cells. J. Virol. 72:3827-3836.[Abstract/Free Full Text]
    4. 4
  4. Blight, K.-J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation of HCV RNA replication in cell culture. Science 290:1972-1974.[Abstract/Free Full Text]
    5. 5
  5. Brand, D., F. Lemiale, G. Thibault, B. Verrier, S. Lebigot, P. Roingeard, L. Buzelay, and F. Barin. 2000. Antigenic properties of recombinant envelope glycoproteins derived from T-cell-line adapted isolates or primary human immunodeficiency virus isolates and their relationship to immunogenicity. Virology 271:350-362.[CrossRef][Medline]
    6. 6
  6. Choo, Q. L., G. Kuo, A. J. Weiner, L. R. Overby, D. W. Bradley, and M. Houghton. 1989. Isolation of a cDNA clone derived from a blood-borne non-A non-B viral hepatitis genome. Science 244:359-362.[Abstract/Free Full Text]
    7. 7
  7. Deleersnyder, V., A. Pillez, C. Wychowski, K.-J. Blight, J. Xu, Y. S. Hahn, C. M. Rice, and J. Dubuisson. 1997. Formation of native hepatitis C virus complexes. J. Virol. 71:697-704.[Abstract]
    8. 8
  8. Dubuisson, J., H. H. Hsu, R. C. Cheung, H. B. Greenberg, D. G. Russell, and C. M. Rice. 1994. Formation and intracellular localization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia and sindbis viruses. J. Virol. 68:6147-6160.[Abstract/Free Full Text]
    9. 9
  9. Dubuisson, J., and C. M. Rice. 1996. Hepatitis C virus glycoproteins folding: disulfide bond formation and association with calnexin. J. Virol. 70:778-786.[Abstract]
    10. 10
  10. Duvet, S., L. Cocquerel, A. Pillez, R. Cacan, A. Verbert, D. Morapdour, C. Wychowski, and J. Dubuisson. 1998. Hepatitis C virus glycoprotein complex localization in the endoplasmic reticulum involves a determinant for retention and not retrieval. J. Biol. Chem. 273:32088-32095.[Abstract/Free Full Text]
    11. 11
  11. Grakoui, A., H. L. Hanson, and C. Rice. 2001. Experimental models of hepatitis C virus infection, replication, and pathogenesis. Hepatology 33:489-495.[CrossRef][Medline]
    12. 12
  12. Helenius, A. 1995. Alphavirus and flavivirus glycoproteins: structures and functions. Cell 81:651-653.[CrossRef][Medline]
    13. 13
  13. Hourioux, C., D. Brand, P.-Y. Sizaret, F. Lemiale, S. Lebigot, F. Barin, and P. Roingeard. 2000. Identification of the glycoprotein 41TM cytoplasmic tail domains of human immunodeficiency virus type 1 that interact with Pr 55 gag particles. AIDS Res. Hum. Retrovir. 16:1141-1147.[CrossRef][Medline]
    14. 14
  14. Khromikh, A., A. N. Varnavski, and E. Westaway. 1998. Encapsidation of the flavivirus Kunjin replicon RNA by using a complementation system providing Kunjin virus structural proteins in trans. J. Virol. 72:5967-5977.[Abstract/Free Full Text]
    15. 15
  15. Kujala, P., A. Ikaheimonen, N. Ehsani, H. Vihinen, P. Auvinene, and L. Kaariainen. 2001. Biogenesis of the Semliki forest virus RNA replication complex. J. Virol. 75:3873-3884.[Abstract/Free Full Text]
    16. 16
  16. Kunkel, M., M. Lorinczi, R. Rijnbrand, S. Lemon, and S. J. Watowich. 2001. Self-assembly of nucleocapsid-like particles from recombinant hepatitis C virus core protein. J. Virol. 75:2119-2129.[Abstract/Free Full Text]
    17. 17
  17. Liu, Q., C. Tackney, R. A. Bhat, A. M. Prince, and P. Zhang. 1997. Regulated processing of hepatitis C virus core protein is linked to subcellular localization. J. Virol. 71:657-662.[Abstract]
    18. 18
  18. Lohman, V., F. Körner, J. O. Koch, U. Herian, L. Theilman, and R. Bartenschlager. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110-113.[Abstract/Free Full Text]
    19. 19
  19. Maillard, P., K. Krawczynski, J. Nitkiewicz, C. Bronnert, M. Sidorkiewicz, P. Gounon, J. Dubuisson, G. Faure, R. Crainic, and A. Budkowska. 2001. Nonenveloped nucleocapsids of hepatitis C virus in serum of infected patients. J. Virol. 75:8240-8250.[Abstract/Free Full Text]
    20. 20
  20. Moradpour, D., C. Englert, T. Wakita, and J. R. Wands. 1996. Characterization of cell lines allowing tightly regulated expression of hepatitis C virus core protein. Virology 222:51-63.[CrossRef][Medline]
    21. 21
  21. Roingeard, P., S. Lu, C. Sureau, M. Freschlin, B. Arbeille, M. Essex, and J.-L. Romet-Lemonne. 1990. Immunocytochemical and electron microscopic study of hepatitis B virus antigen and complete particle production in hepatitis B virus DNA transfected HepG2 cells. Hepatology 11:277-285.[CrossRef][Medline]
    22. 22
  22. Roingeard, P., and C. Sureau. 1998. Ultrastructural analysis of hepatitis B virus in HepG2-transfected cells with special emphasis on subviral filament morphogenesis. Hepatology 28:1128-1133.[CrossRef][Medline]
    23. 23
  23. Sabile, A., G. Perlemuter, F. Bono, K. Kohara, F. Demaugre, M. Kohara, Y. Matsura, T. Miyamura, C. Brechot, and G. Barba. 1999. Hepatitis C virus core protein binds to apolipoprotein AII and its secretion is modulated by fibrates. Hepatology 30:1064-1076.[CrossRef][Medline]
    24. 24
  24. Santolini, E., G. Migliaccio, and N. La Monica. 1994. Biosynthesis and biochemical properties of the hepatitis C virus core protein. J. Virol. 68:3631-3641.[Abstract/Free Full Text]
    25. 25
  25. Schlesinger, S., and T. M. Dubensky, Jr. 1999. Alphavirus vectors for gene expression and vaccines. Curr. Opin. Biotechnol. 10:434-439.[CrossRef][Medline]
    26. 26
  26. Shimoike, T., S. Mimori, H. Tani, Y. Matsuura, and T. Miyamura. 1999. Interaction of hepatitis C virus core protein with viral sense RNA and suppression of its translation. J. Virol. 73:9718-9725.[Abstract/Free Full Text]
    27. 27
  27. Yasui, K., T. Wakita, K. K. Tsukiyama, S. I. Funahashi, M. Ichikawa, T. Kajita, D. Moradpour, J. R. Wands, and M. Kohara. 1998. The native form and maturation process of hepatitis C virus core protein. J. Virol. 72:6048-6055.[Abstract/Free Full Text]

Journal of Virology, April 2002, p. 4073-4079, Vol. 76, No. 8
0022-538X/02/$04.00+0     DOI: 10.1128/JVI.76.8.4073-4079.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Ai, L.-S., Lee, Y.-W., Chen, S. S.-L. (2009). Characterization of Hepatitis C Virus Core Protein Multimerization and Membrane Envelopment: Revelation of a Cascade of Core-Membrane Interactions. J. Virol. 83: 9923-9939 [Abstract] [Full Text]  
  • Aizaki, H., Morikawa, K., Fukasawa, M., Hara, H., Inoue, Y., Tani, H., Saito, K., Nishijima, M., Hanada, K., Matsuura, Y., Lai, M. M. C., Miyamura, T., Wakita, T., Suzuki, T. (2008). Critical Role of Virion-Associated Cholesterol and Sphingolipid in Hepatitis C Virus Infection. J. Virol. 82: 5715-5724 [Abstract] [Full Text]  
  • Hourioux, C, Patient, R, Morin, A, Blanchard, E, Moreau, A, Trassard, S, Giraudeau, B, Roingeard, P (2007). The genotype 3-specific hepatitis C virus core protein residue phenylalanine 164 increases steatosis in an in vitro cellular model. Gut 56: 1302-1308 [Abstract] [Full Text]  
  • Patient, R., Hourioux, C., Sizaret, P.-Y., Trassard, S., Sureau, C., Roingeard, P. (2007). Hepatitis B Virus Subviral Envelope Particle Morphogenesis and Intracellular Trafficking. J. Virol. 81: 3842-3851 [Abstract] [Full Text]  
  • Breiman, A., Vitour, D., Vilasco, M., Ottone, C., Molina, S., Pichard, L., Fournier, C., Delgrange, D., Charneau, P., Duverlie, G., Wychowski, C., Maurel, P., Meurs, E. F. (2006). A hepatitis C virus (HCV) NS3/4A protease-dependent strategy for the identification and purification of HCV-infected cells. J. Gen. Virol. 87: 3587-3598 [Abstract] [Full Text]  
  • Gastaminza, P., Kapadia, S. B., Chisari, F. V. (2006). Differential Biophysical Properties of Infectious Intracellular and Secreted Hepatitis C Virus Particles. J. Virol. 80: 11074-11081 [Abstract] [Full Text]  
  • Vauloup-Fellous, C., Pene, V., Garaud-Aunis, J., Harper, F., Bardin, S., Suire, Y., Pichard, E., Schmitt, A., Sogni, P., Pierron, G., Briand, P., Rosenberg, A. R. (2006). Signal Peptide Peptidase-catalyzed Cleavage of Hepatitis C Virus Core Protein Is Dispensable for Virus Budding but Destabilizes the Viral Capsid. J. Biol. Chem. 281: 27679-27692 [Abstract] [Full Text]  
  • Ait-Goughoulte, M., Hourioux, C., Patient, R., Trassard, S., Brand, D., Roingeard, P. (2006). Core protein cleavage by signal peptide peptidase is required for hepatitis C virus-like particle assembly.. J. Gen. Virol. 87: 855-860 [Abstract] [Full Text]  
  • Griffin, S., Clarke, D., McCormick, C., Rowlands, D., Harris, M. (2005). Signal Peptide Cleavage and Internal Targeting Signals Direct the Hepatitis C Virus p7 Protein to Distinct Intracellular Membranes. J. Virol. 79: 15525-15536 [Abstract] [Full Text]  
  • Sandrin, V., Boulanger, P., Penin, F., Granier, C., Cosset, F.-L., Bartosch, B. (2005). Assembly of functional hepatitis C virus glycoproteins on infectious pseudoparticles occurs intracellularly and requires concomitant incorporation of E1 and E2 glycoproteins. J. Gen. Virol. 86: 3189-3199 [Abstract] [Full Text]  
  • Majeau, N., Gagne, V., Bolduc, M., Leclerc, D. (2005). Signal peptide peptidase promotes the formation of hepatitis C virus non-enveloped particles and is captured on the viral membrane during assembly. J. Gen. Virol. 86: 3055-3064 [Abstract] [Full Text]  
  • Klein, K. C., Dellos, S. R., Lingappa, J. R. (2005). Identification of Residues in the Hepatitis C Virus Core Protein That Are Critical for Capsid Assembly in a Cell-Free System. J. Virol. 79: 6814-6826 [Abstract] [Full Text]  
  • Ogino, T., Fukuda, H., Imajoh-Ohmi, S., Kohara, M., Nomoto, A. (2004). Membrane Binding Properties and Terminal Residues of the Mature Hepatitis C Virus Capsid Protein in Insect Cells. J. Virol. 78: 11766-11777 [Abstract] [Full Text]  
  • Steinmann, D., Barth, H., Gissler, B., Schurmann, P., Adah, M. I., Gerlach, J. T., Pape, G. R., Depla, E., Jacobs, D., Maertens, G., Patel, A. H., Inchauspe, G., Liang, T. J., Blum, H. E., Baumert, T. F. (2004). Inhibition of Hepatitis C Virus-Like Particle Binding to Target Cells by Antiviral Antibodies in Acute and Chronic Hepatitis C. J. Virol. 78: 9030-9040 [Abstract] [Full Text]  
  • Klein, K. C., Polyak, S. J., Lingappa, J. R. (2004). Unique Features of Hepatitis C Virus Capsid Formation Revealed by De Novo Cell-Free Assembly. J. Virol. 78: 9257-9269 [Abstract] [Full Text]  
  • Ghibaudo, D., Cohen, L., Penin, F., Martin, A. (2004). Characterization of GB Virus B Polyprotein Processing Reveals the Existence of a Novel 13-kDa Protein with Partial Homology to Hepatitis C Virus p7 Protein. J. Biol. Chem. 279: 24965-24975 [Abstract] [Full Text]  
  • Majeau, N., Gagne, V., Boivin, A., Bolduc, M., Majeau, J.-A., Ouellet, D., Leclerc, D. (2004). The N-terminal half of the core protein of hepatitis C virus is sufficient for nucleocapsid formation. J. Gen. Virol. 85: 971-981 [Abstract] [Full Text]  
  • Barth, H., Schafer, C., Adah, M. I., Zhang, F., Linhardt, R. J., Toyoda, H., Kinoshita-Toyoda, A., Toida, T., van Kuppevelt, T. H., Depla, E., von Weizsacker, F., Blum, H. E., Baumert, T. F. (2003). Cellular Binding of Hepatitis C Virus Envelope Glycoprotein E2 Requires Cell Surface Heparan Sulfate. J. Biol. Chem. 278: 41003-41012 [Abstract] [Full Text]  
  • Blanchard, E., Hourioux, C., Brand, D., Ait-Goughoulte, M., Moreau, A., Trassard, S., Sizaret, P.-Y., Dubois, F., Roingeard, P. (2003). Hepatitis C Virus-Like Particle Budding: Role of the Core Protein and Importance of Its Asp111. J. Virol. 77: 10131-10138 [Abstract] [Full Text]  
  • Gaudy, C., Moreau, A., Veillon, P., Temoin, S., Lunel, F., Goudeau, A. (2003). Significance of Pretreatment Analysis of Hepatitis C Virus Genotype 1b Hypervariable Region 1 Sequences To Predict Antiviral Outcome. J. Clin. Microbiol. 41: 3615-3622 [Abstract] [Full Text]  
  • Lozach, P.-Y., Lortat-Jacob, H., De Lacroix De Lavalette, A., Staropoli, I., Foung, S., Amara, A., Houles, C., Fieschi, F., Schwartz, O., Virelizier, J.-L., Arenzana-Seisdedos, F., Altmeyer, R. (2003). DC-SIGN and L-SIGN Are High Affinity Binding Receptors for Hepatitis C Virus Glycoprotein E2. J. Biol. Chem. 278: 20358-20366 [Abstract] [Full Text]  
  • Lorenz, I. C., Kartenbeck, J., Mezzacasa, A., Allison, S. L., Heinz, F. X., Helenius, A. (2003). Intracellular Assembly and Secretion of Recombinant Subviral Particles from Tick-Borne Encephalitis Virus. J. Virol. 77: 4370-4382 [Abstract] [Full Text]  
  • Blanchard, E., Brand, D., Roingeard, P., Ezelle, H. J., Markovic, D., Barber, G. N. (2003). Endogenous Virus and Hepatitis C Virus-Like Particle Budding in BHK-21 Cells. J. Virol. 77: 3888-3889 [Full Text]  
  • Molenkamp, R., Kooi, E. A., Lucassen, M. A., Greve, S., Thijssen, J. C. P., Spaan, W. J. M., Bredenbeek, P. J. (2002). Yellow Fever Virus Replicons as an Expression System for Hepatitis C Virus Structural Proteins. J. Virol. 77: 1644-1648 [Abstract] [Full Text]  
  • Ezelle, H. J., Markovic, D., Barber, G. N. (2002). Generation of Hepatitis C Virus-Like Particles by Use of a Recombinant Vesicular Stomatitis Virus Vector. J. Virol. 76: 12325-12334 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanchard, E.
Right arrow Articles by Roingeard, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanchard, E.
Right arrow Articles by Roingeard, P.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»