Coding Sequences Upstream of the Human Immunodeficiency Virus Type 1 Reverse Transcriptase Domain in Gag-Pol Are Not Essential for Incorporation of the Pr160gag-pol into Virus Particles

Incorporation of the human immunodeficiency virus type 1 (HIV-1)Gag-Pol into virions is thought to be mediated by the N-terminalGag domain via interaction with the Gag precursor. However,one recent study has demonstrated that the murine leukemia virusPol can be incorporated into virions independently of Gag-Polexpression, implying a possible interaction between the Poland Gag precursor. To test whether the HIV-1 Pol can be incorporatedinto virions on removal of the N-terminal Gag domain and todefine sequences required for the incorporation of Gag-Pol intovirions in more detail, a series of HIV Gag-Pol expression plasmidswith various extensive deletions in the region upstream of thereverse transcriptase (RT) domain was constructed, and viralincorporation of the Gag-Pol deletion mutants was examined bycotransfecting 293T cells with a plasmid expressing Pr55^gag.Analysis indicated that deletion of the N-terminal two-thirdsof the gag coding region did not significantly affect the incorporationof Gag-Pol into virions. In contrast, Gag-Pol proteins withdeletions covering the capsid (CA) major homology regions andthe adjacent C-terminal CA regions were impaired with respectto assembly into virions. However, Gag-Pol with sequences deletedupstream of the protease, or of the RT domain but retaining15 N-terminal gag codons, could still be rescued into virionsat a level about 20% of the wild-type level. When assayed ina nonmyristylated Gag-Pol context, all of the Gag-Pol deletionmutants were incorporated into virions at a level comparableto their myristylated counterparts, suggesting that the incorporationof the Gag-Pol deletion mutants into virions is independentof the N-terminal myristylation signal.

INTRODUCTION

Top

Introduction

During the late stage of the human immunodeficiency virus (HIV)life cycle, viral capsid protein precursor Pr55^gag is transportedto the plasma membranes, where the Pr55^gag molecules self-assembleinto virus particles and bud out from the cell membrane (6,10, 34). After virus budding, the Pr55^gag is cleaved by thevirus-encoded protease (PR) into matrix (MA; p17), capsid (CA;p24), p2, nucleocapsid (NC; p7), p1, and the C-terminal p6 domain(8, 12, 15, 18). PR-mediated Gag processing is not requiredfor particle assembly and release but is essential for bothvirus maturation and infectivity (7, 13, 25, 26). Apart fromthe PR, the reverse transcriptase (RT) and integrase (IN) requiredfor virus replication are also encoded by pol. HIV Pol is translatedinitially as a Pr160^gag-pol by a ribosomal -1 frameshift eventwhich occurs at a frequency of about 5% during gag encoding(11). Within the Gag-Pol, the p6 domain is truncated and replacedby a transframe domain referred to as p6* (23).

The Pr160^gag-pol is thought to be incorporated into virus particlesby interaction with assembling Pr55^gag through its N-terminalgag domain (9, 22, 27, 28). To identify which regions in Pr160^gag-polare responsible for its incorporation into virions, a systeminvolving transient coexpression of Pr55^gag and Pr160^gag-polfrom separate plasmids has been used widely (9, 17, 22, 27,28). In this system, PR in the encoded Pr160^gag-pol would cleavethe coexpressed Pr55^gag in trans, and the incorporation of Gag-Polinto virus particles would then be monitored by the appearanceof the particle-associated p24^gag. The level of incorporatedGag-Pol was quantified by in vitro RT assays. One of these studiesshowed that substitution mutations in the CA major homologyregion (MHR) of Pr160^gag-pol have no detectable effects on Gag-Polincorporation into the Pr55^gag particles (17). Different resultswere reported by another group, demonstrating that deletionof the whole MHR significantly impaired the incorporation ofGag-Pol into virus particles (28). Another study using a chimericHIV/MLV (murine leukemia virus) Gag-Pol expression system showedthat both the HIV type 1 (HIV-1) CA MHR and adjacent CA terminalsequences are required for efficient incorporation of Gag-Polinto virus particles (9).

Interestingly, HIV RT and IN proteins fused to the Vpr, an HIVaccessory protein, could be rescued into virus particles, presumablyvia interaction with Pr55^gag through the fusion Vpr (5, 24,35, 36). Although these results strongly suggest that the incorporationof HIV pol-encoded products into virus particles can be independentof Pr160^gag-pol expression, a certain protein sequence likeVpr, which can interact with Pr55^gag, is required to be presentin order to mediate the incorporation of pol gene products intovirions. However, one more recent study has shown that the MLVPol could be incorporated into virus particles, implying thatthe Gag domain in MLV Gag-Pol is not absolutely required forits assembly into particles and raising the hypothesis thatputative interactions between the Pol and Gag precursors mayexist to facilitate the incorporation of Gag-Pol into virusparticles (3).

It is not known whether HIV Gag-Pol can be incorporated intoparticles without any need for the presence of the N-terminalGag domain. It remains controversial whether the CA MHR in Pr160^gag-polis essential for viral incorporation of Pr160^gag-pol. To addressthis issue and to map the sequences responsible for the Pr160^gag-polincorporation in more detail, we constructed a series of HIVGag-Pol constructs with various deletion mutations in the gag-polcoding region. The incorporation of the mutant Gag-Pol productinto virus particles was assayed by coexpressing the mutantswith the Pr55^gag. We found that HIV Gag-Pol, with coding sequencesdeleted upstream of the PR or RT regions but retaining only15 N-terminal MA residues, could still be incorporated intovirus independently of the N-terminal myristylation signal.

MATERIALS AND METHODS

Top

Materials and Methods

Plasmid construction. The parental HIV-1 proviral plasmid DNA in this study was HXB2.All the plasmids were expressed in the HIVgpt backbone, whichcarries a simian virus 40 ori and gpt gene in the env region(19). To construct the Gag-Pol frameshift mutant, five T nucleotideswere deleted in the gag and pol overlap region by PCR-mediatedmutagenesis. This resulted in placing pol and gag in the samereading frame, leading to expression of the Pr160^gag-pol only.The sequence in the region of the juncture was nucleotide (nt)2070-5' GAGAGACAGGCTAATAGGGAA 3'. This Pr160^gag-pol-expressingplasmid designated GPfs was used as a wild-type (wt) control,and all the other Gag-Pol fusion constructs were derived fromthe GPfs (Fig. 1). To make a series of deletion mutations inthe GPfs, we initially created a BamHI site at the followingnucleotide positions: 835, 1222, 1423, 1630, 1705, 1753, 1876,2071, and 2538. Replacement of the fragment nt 831-ClaI to nt1705-BamHI with the fragment nt 831-ClaI to nt 1630-BamHI resultedin a complete deletion of the MHR (nt 1641 to 1694), yieldingthe construct ${Delta}$ MHR. Similarly, deletion of the BamHI fragmentnt 1876 to 2071 generated ${Delta}$ NC. Recombination of the BamHI linkerconstructs 1423 and 1753, 1222 and 1753, 1423 and 1876, and1222 and 1876 yielded the capsid deletion mutants ${Delta}$ CA-1, ${Delta}$ CA-2, ${Delta}$ CA-3, and ${Delta}$ CA-4, respectively. The more extensive deletion mutants ${Delta}$ (CA+NC), ${Delta}$ (MA+2/3 CA), ${Delta}$ (MA+CA), and ${Delta}$ Gag were made by deletionof the fragments BamHI-1222 to BamHI-2071, BamHI-835 to BamHI-1876,and BamHI-835 to BamHI-2071, respectively. The ${Delta}$ MA mutation,as described previously (33), was generated by deletion of thefragment nt 831-ClaI to nt 1147-PvuII and insertion of a SalIlinker in the deleted region. The Pr55^gag-expressing constructpGAG was created by deletion of the pol gene fragment from BclI-2429to SalI-5786. To block the N-terminal myristylation of Pr160^gag-pol,a myristylation-deficient mutation (Myr^-) (29), in which thesecond amino acid, glycine, of Gag was changed to alanine, wasintroduced into each of the Gag-Pol fusion constructs. The juncturesequences for the Gag-Pol deletion mutants are shown in Fig.1B. Each mutant construct was confirmed by DNA sequencing.

View larger version (22K):
[in this window]
[in a new window]
FIG. 1. HIV-1 Pr160^gag-pol mutations. (A) Mature Gag protein domains and pol-encoded p6*, PR, and RT domains. The name of each construct is shown at the left. pGAG was constructed by deletion of the pol gene. GPfs was engineered by placing the gag and pol in the same open reading frame via a five-T nucleotide deletion in the overlap region of gag-pol. The other mutants were derived from GPfs by deletion of gag-pol sequences to different extents (see Materials and Methods for specific details). The pGAG and the wt and mutant GPfs were all expressed on the HIVgpt backbone. ${Delta}$ MA contains a deletion of 105 codons and a replacement of 4 codons in the MA protein. For ${Delta}$ NC, sequences encoding the p2 and most of NC were deleted and replaced by two amino acid residues. Combination of the ${Delta}$ MA and ${Delta}$ NC mutations generated the construct ${Delta}$ (MA+NC). In the construct ${Delta}$ MHR, 28 codons of the CA domain (CA codon 148 to 177), covering the major homology region (codon 153 to 172) were deleted and replaced by three amino acid residues. ${Delta}$ CA-1 contains a deletion of 111 codons (codon 81 to 191) and insertion of one amino acid residue into the deleted region. ${Delta}$ CA-2 is identical to ${Delta}$ CA-1 except that it contains a further 3' deletion downstream of the N terminus of p2. A further 5' deletion in ${Delta}$ CA-1, deleted from CA codons 81 to 12, yielded ${Delta}$ CA-3. Combination of the ${Delta}$ CA-2 and ${Delta}$ CA-3 mutations generated the ${Delta}$ CA-4, and introduction of the ${Delta}$ NC mutation to the ${Delta}$ CA-4 yielded ${Delta}$ (CA+NC). ${Delta}$ (MA+2/3 CA) contains a deletion of gag coding sequences including the N-terminal two-thirds of CA and most of the MA (deletion from MA codon 17 to CA codon 150). Constructs ${Delta}$ (MA+CA) and ${Delta}$ GAG were derived from combinations of ${Delta}$ (MA+2/3 CA) with ${Delta}$ CA-4 or with ${Delta}$ (CA+NC), respectively. ${Delta}$ (NC+PR) has a deletion of sequences encoding the NC, p2, and the PR, and ${Delta}$ (GAG+PR) was derived from a combination of ${Delta}$ (NC+PR) and ${Delta}$ GAG. (B) Viral DNA sequences and encoded protein sequences of mutated HIV regions. HIV nucleotide positions are indicated, and inserted or altered amino acid residues are shown in boldface.

Cell culture and transfection. 293T cells were maintained in Dulbecco's modified Eagle's mediumsupplemented with 10% fetal calf serum. Confluent 293T cellswere trypsinized, split 1:10, and seeded onto 10-cm plates 24h before transfections. For each construct, 293T cells weretransfected with 15 µg of plasmid DNA by the calcium phosphateprecipitation method, with the addition of 50 µM chloroquineto enhance transfection efficiency. When the wt or mutant GPfswas cotransfected with the pGAG, 2 µg of each constructand 10 µg of pGAG were used, with addition of 8 µgof pBlueScript SK to a final amount of 20 µg of plasmidDNA. For cotransfection of PR-defective (PR^-) GPfs constructswith the pGAG, 1 µg of each construct and 10 µgof pGAG were used, with addition of 9 µg of pBlueScriptSK to a total amount of 20 µg of plasmid DNA. Culturemedia and cells were harvested for protein analysis or RT activityassays at 48 h posttransfection.

Western immunoblot analysis. Culture media from transfected 293T cells were filtered through0.45-µm-pore-size filters, followed by centrifugationthrough 2 ml of 20% sucrose in TSE (10 mM Tris-HCl [pH 7.5],100 mM NaCl, 1 mM EDTA) plus 0.1 mM phenylmethylsulfonyl fluoride(PMSF) at 4°C for 40 min at 274,000 x g (SW41 rotor at 40,000rpm). Viral pellets then were suspended in IPB (20 mM Tris-HCl[pH 7.5], 150 mM NaCl, 1 mM EDTA, 0.1% sodium dodecyl sulfate[SDS], 0.5% sodium deoxycholate, 1% Triton X-100, 0.02% sodiumazide) plus 0.1 mM PMSF. Cells were rinsed with ice-cold PBS(phosphate-buffered saline), scraped from the plates, collectedin 1 ml of PBS, and pelleted at 1,000 x g for 5 min. The cellpellets were resuspended in 250 µl of IPB plus 0.1 mMPMSF and then subjected to microcentrifugation at 4°C for15 min at 13,700 x g (14,000 rpm) to remove cell debris. Supernatantand cell samples were mixed with equal volumes of 2x samplebuffer (12.5 mM Tris-HCl [pH 6.8], 2% SDS, 20% glycerol, 0.25%bromophenol blue) and ß-mercaptoethanol to 5% andboiled for 5 min. Samples were subjected to SDS-polyacrylamidegel electrophoresis (PAGE) and electroblotted onto nitrocellulosemembranes. The membranes were blocked with 3% gelatin in Tris-bufferedsaline containing 0.05% Tween 20 (TBST), followed by incubationwith the primary antibody in 1% gelatin-TBST for 1 h on a rockingplatform at room temperature. The membranes were then washedthree times for 10 min each with TBST and rocked for 30 minwith the secondary antibody in 1% gelatin-TBST. The blots wereagain washed three times in TBST for 10 min each, and the membrane-boundantibody-conjugated enzyme activity was detected by an enhancedchemiluminescence detection system or by a colorimetric method.For detection of HIV Gag proteins, we used an anti-p24^gag (mousehybridoma clone 183-H12-5C) or anti-p17^gag (catalog no. HB-8975;American Type Culture Collection, Rockville, Md.) monoclonalantibody at a 1:5,000 dilution from ascites. The secondary antibodywas a horse anti-mouse immunoglobulin G (IgG)-alkaline phosphataseconjugate at a 1:5,000 dilution (Vector Laboratories), and theGag proteins were visualized by a color reaction solution ofnitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (Promega).For detection of the HIV Gag-Pol, an HIV-positive human serumwas used at 1:10,000 dilution as the primary antibody. The secondaryantibody was a goat anti-human IgG horseradish peroxidase (HRP)-conjugatedantibody at 1:10,000 dilution, and the procedures used for HRPactivity detection followed the manufacturer's protocol (AmershamPharmacia).

In vitro RT assay. Culture supernatants of transfected 293T cells were harvested,filtered, and pelleted as described above. Viral pellets wereresuspended in 30 µl of TSE buffer. A 10-µl aliquotof each sample was used for Western immunoblot analysis. Theremaining samples were further diluted with TSE, and a 10-µlaliquot of each of the diluted samples was mixed with 40 µlof reaction cocktail containing 0.1% Triton X-100, 5 mM dithiothreitol,10 mM MgCl₂, 50 mM Tris-HCl (pH 8.0), 1.2 mM poly(rA)-(dT)₁₅(Amersham Pharmacia), and 25 µCi of [³H]TTP/ml (30). Reactionswere allowed to proceed at 37°C for 2 h, followed by theaddition of 5 µl of tRNA (10 mg/ml). The reaction mixturesthen were precipitated with ice-cold 10% trichloroacetic acidand filtered with GF/C filters. After washing and drying, thefilters were counted in a Beckman scintillation counter to determineRT activity.

Sucrose density gradient fractionation. Culture supernatants of transfected 293T cells were collected,filtered, and centrifuged through a 2-ml 20% sucrose cushionas described above. Viral pellets were suspended in TSE bufferand layered on top of premade 20-to-60% sucrose gradients consistingof 1-ml layers of 20, 30, 40, 50, and 60% sucrose in TSE, whichhad been allowed to mix by sitting for 2 h. Gradients were centrifugedat 274,000 x g (SW50.1 rotor; 40,000 rpm) for 16 to 18 h at4°C, and 500-µl fractions were collected from topto bottom. Each fraction was measured for density and analyzedfor Gag proteins and RT activity.

RESULTS

Top

Results

Pr160^gag-pol mutants with extensive deletions in the gag coding sequence, or in combination with additional removal of the N-terminal myristic acid moiety, could still be incorporated into virus particles. To define more completely the boundaries of HIV gag-pol sequencesrequired for its incorporation into virus particles, a seriesof HIV Gag-Pol fusion constructs containing various deletionmutations in the gag coding sequences was engineered and introducedinto an HIV Pr160^gag-pol-expressing plasmid, GPfs. GPfs, derivedfrom an HIV replication-defective vector HIVgpt (19), had gagand pol positioned in the same reading frame due to a frameshiftmutation at the gag-pol junction. Figure 1A shows a schematicrepresentation of the GPfs construct and its derivatives withgag-pol sequences deleted to different extents. Except for ${Delta}$ (NC+PR)and ${Delta}$ (GAG+PR), all constructs retained an intact PR and shouldhave been able to cleave the coexpressed Pr55^gag in trans, yieldingthe mature Gag protein p24CA. Thus, incorporation of the Pr160^gag-polinto virus particles could be monitored by Western immunoblotanalysis of the culture medium. However, it should be notedthat a very low level of incorporated Gag-Pol might provideenough PR activity to process the Gag. It is also not knownwhether PR action on Gag requires normal incorporation of Polproteins. Therefore, this is only a measure of the incorporationof some minimal amount of PR.

We transfected 293T cells with each of the wt or mutant GPfsconstructs alone or together with a Pr55^gag expression plasmid,pGAG. At 48 h posttransfection, cells and culture supernatantswere collected and subjected to Western immunoblot analysisas described in Materials and Methods. Expressed and releasedGag proteins were probed with an anti-p24^gag and/or an anti-p17^gagmonoclonal antibody. As shown in Fig. 2A, bands correspondingto the intermediate p41^gag and mature p24^gag and p17^gag weredetected in the GPfs transfectants (lane 1) while the Pr55^gagwas, as expected, assembled and released from cells transfectedwith pGAG (lanes 9 and 19). Bands corresponding to the p17^gagwere not seen in cells transfected with the ${Delta}$ MA or ${Delta}$ (MA+NC), consistentwith a deletion of the MA domain (lanes 2 and 4). Both ${Delta}$ NC and ${Delta}$ (MA+NC) transfectants produced a p24-associated Gag productmigrating slower than the p24^gag (Fig. 2A). This incompletelyprocessed Gag product might correspond to the CA- ${Delta}$ NC-p6*, butfurther experiments were required to test this hypothesis. Inagreement with the previous observation (27, 28), the Pr160^gag-polor its deletion mutation derivatives could not form virus particlesby themselves, and Gag proteins were not detected in the mediumof cells transfected with the GPfs, ${Delta}$ MA, ${Delta}$ NC, or ${Delta}$ (MA+NC) (Fig.2A, lanes 11 to 14). Mature processed Gag proteins were onlyobserved when the wt and mutant GPfs were cotransfected withpGAG (lanes 15 to 18). This indicates that the Gag-Pol of thewt and mutant GPfs was incorporated into virus particles andprovided a functional PR to cleave the Pr55^gag in trans intomature Gag products. The levels of Pr55^gag and mature p24^gagproduced by the mutant GPfs cotransfectants were roughly comparableto those of wt GPfs cotransfectants (lanes 15 to 18). Removalof the MHR alone or together with the adjacent CA sequence fromthe Pr160^gag-pol did not block its incorporation into virusparticles, as the p24^gag and p17^gag were clearly detected inthe media from cells cotransfected with pGAG plus the ${Delta}$ MHR orthe ${Delta}$ CA-1 (Fig. 2B). The absence of p24-associated Gag productsin both ${Delta}$ MHR and ${Delta}$ CA-1 transfectants (Fig. 2B, lanes 3 and 4)was not due to expression problems but was most likely due toa deletion of the antigen epitopes, since the mature p17^gagcould be detected readily when probed with an anti-p17^gag monoclonalantibody (data not shown).

View larger version (106K):
[in this window]
[in a new window]
FIG. 2. Western immunoblotting analysis of HIV proteins expressed and released from cells coexpressing Pr55^gag and Pr160^gag-pol. 293T cells were transfected or cotransfected with the designated plasmids. Fifteen micrograms of each plasmid was used for individual transfections, and 10 µg of pGAG and 2 µg for each of the GPfs constructs were used for cotransfection. At 48 h posttransfection, cells and supernatants were collected and prepared for protein analysis as described in Materials and Methods. Cell samples corresponding to 4% of the total samples and supernatant samples corresponding to 50% of the total samples were fractionated by SDS-10% PAGE and electroblotted onto a nitrocellulose filter. HIV Gag proteins were detected with an anti-p24^gag monoclonal antibody (B) or together with an additional anti-p17^gag monoclonal antibody (A, C, and D) at 1:5,000 dilution, followed by a secondary alkaline phosphatase-conjugated horse anti-mouse antibody at 1:5,000 dilution, and alkaline phosphatase activity was determined. The positions of molecular size markers (Std.) and those of HIV Gag proteins Pr55, p41, p24, and p17 are indicated. The arrow in panel A indicates the p24-associated Gag product produced by both ${Delta}$ NC and ${Delta}$ (MA+NC) that migrated slower than the p24^gag.

When the GPfs constructs with more extensive deletions in theGag region were cotransfected with pGAG, p24^gag and p17^gag werestill readily detected in the cotransfectant medium (Fig. 2C).Moreover, one mutant ( ${Delta}$ GAG), in which the whole gag coding sequenceupstream of the gag/pol junction was deleted except for theN-terminal 15 codons, could still be rescued into Gag particlesat least at some minimal level, since some PR function was presentto form to process the Pr55^gag (lane 18). That the band of p24^gagwas derived from cleavage of Pr55^gag by the GPfs deletion mutantswas evident because it was not seen either intracellularly orextracellularly when each mutant was expressed alone (data notshown).

Although the N-terminal myristylation signal has been shownto be essential for Pr55^gag plasma membrane targeting and assembly(2, 7, 20), it is dispensable for Pr160^gag-pol incorporationinto particles (22, 27), and it is unknown whether the Myr^-mutation has any adverse effects on Gag-Pol incorporation inthe presence of large sequence deletions downstream. To addressthis issue, we introduced the Myr^- mutation into the wt andmutant GPfs constructs and transfected 293T cells with eachof the resulting plasmids alone or together with pGAG. We foundthat mature p24^gag could be readily detected in the medium ofcells cotransfected with each of the nonmyristylated mutantsplus pGAG (Fig. 2D, lanes 12 to 20). Consistent with previousreports (22, 27), cotransfection of the Myr^- GPfs and pGAG mainlyproduced p24^gag (lane 12), suggesting an efficient incorporationof the Myr^- Pr160^gag-pol. Myr^- ${Delta}$ CA-4, Myr^- ${Delta}$ (MA+CA), and Myr^- ${Delta}$ GAG, with more extensive deletion mutations, were still capableof being incorporated into virus particles when cotransfectedwith pGAG (lanes 17, 19, and 20), since at least some PR wasavailable to form to process the Pr55^gag. Cotransfections ofpGAG plus the Myr^- ${Delta}$ CA-1, -2, or -3, or the Myr^- ${Delta}$ (CA+NC) alsoproduced an extracellular Pr55^gag processing pattern similarto that of their myristylated counterparts (data not shown).These results suggest that removal of the N-terminal myristylationsignal has no markedly adverse effects on incorporation of GPfsdeletion mutants into virus particles.

The amount of GPfs plasmid DNA used for cotransfection could significantly affect the level of particle production and Gag-Pol incorporation. It is interesting that Pr160^gag-pol with the gag coding sequencealmost deleted ( ${Delta}$ GAG) was still capable of being incorporatedinto virus particles (Fig. 2C, lane 18, and 2D, lane 20). Theresults shown in Fig. 2 suggest that Gag-Pol products of theGPfs derivatives could be recruited into virions when cotransfectedwith pGAG. However, the level of particle-associated p24^gagproduced by the cotransfectants cannot reflect the level ofincorporated Pr160^gag-pol because the expression level of theGag-Pol carrying an active PR could affect virus assembly andbudding (1, 14, 21, 31). To test this possibility, various quantities(10, 5, 1, and 0.5 µg) of GPfs or ${Delta}$ GAG were cotransfectedwith 10 µg of pGAG. Figure 3A shows that the level ofPr55^gag and p24^gag recovered in the medium was inversely proportionalto the quantity of GPfs DNA (lanes 10 to 13) or ${Delta}$ GAG DNA (lanes14 to 17) present in the cotransfection mixture. A relativelyhigher level of p24^gag was detected in the cotransfection mediumsamples when the DNA ratio of Pr55^gag-to-Pr160^gag-pol-expressingplasmids was kept at 10:1 or 20:1 (lanes 12 to 13 and lanes16 to 17). Both GPfs and ${Delta}$ GAG also displayed a relatively higherlevel of particle-associated RT activity under these cotransfectionconditions. The particle-associated RT activity of ${Delta}$ GAG was about10% ± 2% (mean ± standard deviation) of wt (GPfs)activity in parallel experiments. These data suggest that thePr160^gag-pol would be more efficiently incorporated into virusparticles when the ratio of Pr55^gag-to-Pr160^gag-pol-expressingplasmids resembles the physiological expression ratios of Pr55^gagand Pr160^gag-pol in host cells.

View larger version (48K):
[in this window]
[in a new window]
FIG. 3. Pr160^gag-pol lacking most of the gag coding sequence could be incorporated into virus particles. (A) 293T cells were cotransfected with 10 µg of pGAG plus the indicated amount of GPfs or ${Delta}$ GAG plasmid DNA. The total DNA in each transfection mixture was kept constant by addition of pBlueScript SK. At 48 h posttransfection, culture supernatants and cells were collected, prepared, and resolved on SDS-10% (A) or SDS-8% (B) PAGE gels. Viral proteins were probed with an anti-p24^gag monoclonal antibody (A) or an HIV-positive human serum (B). The positions of molecular size markers (Std.) and those of HIV Gag-Pol precursor and Gag proteins Pr55, p41, and p24 are indicated.

Quantification of Gag-Pol incorporation by in vitro RT activity assay. The results shown above indicated that the ${Delta}$ GAG with a nativePR could be incorporated into virions at about 1/10 of the wtlevel. However, the extent to which the PR affects particlebudding and Gag-Pol incorporation is not known. To avoid theeffects of PR activity on particle production, GPfs and ${Delta}$ GAGconstructs were introduced into a PR-inactivated mutant in whichthe Asp residue for proteolytic activity had been replaced byan Arg residue (31). When cotransfected with pGAG plasmid DNAat various DNA ratios, the Gag-Pol of GPfs and ${Delta}$ GAG could beclearly detected in the medium (Fig. 3B). Based on the resultsof RT assays, the level of incorporated Gag-Pol for ${Delta}$ GAG wasabout 20% ± 5% of the wt GPfs level in parallel experiments.We observed repeatedly that the PR-inactivated ${Delta}$ GAG exhibiteda slightly higher level of efficiency of entry into virus particlesthan its PR-native counterpart when cotransfected with pGAGat a DNA ratio of 1:10 or 1:20. This discrepancy could be duein part to a differential PR activity between GPfs and ${Delta}$ GAG,which might result in virus assembly and budding being affectedto different extents.

The results shown in Fig. 3B indicate that the level of virus-associatedPr160^gag-pol for GPfs and ${Delta}$ GAG increased when the amounts ofDNA used for cotransfection were increased; however, no significantdifferences in the efficiency of ${Delta}$ GAG incorporation were detectedamong the different DNA ratio-cotransfection experiments whenthe particle-associated RT activity for ${Delta}$ GAG had been normalizedto that of GPfs in parallel experiments. Nevertheless, to minimizethe effect of protein expression level on the specific incorporationof the Pr160^gag-pol into virus particles, each of the GPfs constructswas cotransfected with pGAG at a DNA ratio of 1:10. Aliquotsof cotransfection supernatant samples were analyzed by bothWestern blotting and in vitro RT assays.

As shown in Fig. 4A, Gag-Pol of the mutants ${Delta}$ MA and ${Delta}$ NC was releasedinto the medium at a level comparable to that of wt GPfs (lanes10 to 12) when cotransfected with pGAG, suggesting efficientincorporation of the mutants into virus particles. Similarly,Gag-Pol of ${Delta}$ (MA+NC) was also readily detected in the cotransfectionmedium sample (lane 13). Surprisingly, a significant amountof ${Delta}$ MHR Gag-Pol was released into the medium on cotransfectionwith pGAG (lane 14). In contrast, Gag-Pol in the medium wasbarely detectable when cells were cotransfected with pGAG andmutants lacking the central CA portion including the MHR [ ${Delta}$ CA-1, ${Delta}$ CA-2, ${Delta}$ CA-3, ${Delta}$ CA-4, ${Delta}$ (MA+CA), and ${Delta}$ GAG] (Fig. 4A, lanes 15 to 18,and B, lanes 15 to 16). Nevertheless, these mutant Gag-Pol productsin the cotransfection medium could still be detected occasionally,as in the case of ${Delta}$ (CA+NC) (Fig. 4B, lane 13), or they becamevisible after a longer exposure of the blots (data not shown).Interestingly, cells cotransfected with ${Delta}$ (MA+2/3 CA) plus pGAGreleased substantial amounts of Gag-Pol (Fig. 4B, lane 14).It is unclear why the level of intracellular Gag-Pol of ${Delta}$ (MA+2/3CA) was relatively lower than those of the other mutants (Fig.4B). One possibility is that the expressed mutants may, undercertain circumstances, be rapidly transported and incorporatedinto virus particles, resulting in a relatively lower intracellularlevel. Similar phenomena were occasionally observed in the caseof GPfs (Fig. 3B and 4C and D). Another possibility is thatthe mutant was simply degraded very rapidly within the cells.

View larger version (85K):
[in this window]
[in a new window]
FIG. 4. Expression and incorporation of protease-defective (PR^-) Pr160^gag-pol deletion mutants into Pr55^gag particles. (A and B) 293T cells were transfected with the plasmid indicated. The HIV PR in all GPfs constructs was either inactivated or truncated. For cotransfection with pGAG, 1 µg of each plasmid DNA and 10 µg of pGAG were used, with addition of 9 µg of pBlueScript SK to a total amount of 20 µg of plasmid DNA. Two days after transfection, cells and supernatants were collected for protein analysis as described in Materials and Methods. Samples were fractionated by SDS-8% PAGE and then subjected to Western immunoblot analysis. Membrane-bound HIV proteins were probed with an HIV-positive human serum at a dilution of 1:10,000, followed by a secondary goat antihuman HRP-conjugated antibody at 1:10,000 dilution. (C and D) Incorporation of nonmyristylated Gag-Pol into virus particles. Methodology and plasmids used for analysis were identical to those in panels A and B, except that the GPfs constructs were expressed on a nonmyristylated backbone. The positions of the molecular size markers (Std.) and those of the HIV Pr55^gag and Pr160^gag-pol are indicated.

The PR domain is apparently not essential for Gag-Pol incorporation,since Pr160^gag-pol lacking the PR and NC domains was efficientlyreleased from the cotransfectants (Fig. 4B, lane 17). When convertedto a nonmyristylated form and cotransfected with pGAG, someof the mutants could be detected in the medium by Western blotting,with a profile similar to that of their myristylated counterparts(Fig. 4C and D).

To quantify the particle-associated Pr160^gag-pol accurately,aliquots of identical samples for Western blotting were subjectedto in vitro RT activity analysis. To optimize RT assay conditionsand to ensure that the RT level could reflect the level of incorporatedGag-Pol exactly, resuspended supernatant pellets derived fromGPfs (PR^-)-plus-pGAG cotransfection were serially diluted andanalyzed for RT activity as described in Materials and Methods.In one set of experiments, RT reaction mixtures were aliquotedand measured for RT activity at 0, 0.5, 1, 1.5, and 2 h of incubation.We found that RT activities (in counts per minute) increasedlinearly with time and sample concentrations when the readingwas not over 2.4 x 10⁵ cpm. Higher counts-per-minute readingscould be obtained by increasing sample concentrations; however,RT activities were no longer increased in a geometric fashion,possibly due either to limitation of substrate or to inhibitionof reverse transcription by accumulated RT products, or to both.Thus, to hold the detected RT activity within a linear range,we used only 10% of the recovered supernatant pellets for RTassay.

As shown in Fig. 5, mutants ${Delta}$ MA, ${Delta}$ NC, ${Delta}$ (MA+NC), and ${Delta}$ MHR releasedremarkable amounts of RT activity, at a level comparable toor over 50% of the wt GPfs level. The relatively lower levelof particle-associated Gag-Pol of ${Delta}$ (MA+NC) shown in Western blotting(Fig. 4A, lane 13) was due to partial sample loss, since a strongersignal comparable to that of wt was observed in repeat experiments.For mutants with a deletion involving the MHR and the adjacentC-terminal CA region [ ${Delta}$ CA-1, -2, -3, or -4, ${Delta}$ (CA+NC), ${Delta}$ (CA+NC), ${Delta}$ (MA+CA), ${Delta}$ GAG, and ${Delta}$ (GAG+PR)], the released RT activity levelswere all below 30% of that of wt GPfs. This result suggeststhat removal of the CA central portion including the MHR fromthe Gag-Pol product may impair its interaction with Pr55^gag,leading to subsequent deficient incorporation of Gag-Pol intovirus particles. Conversely, the RT level produced by ${Delta}$ (MA+2/3CA) was comparable to that of the wt. This result suggests thatthe N-terminal two-thirds of the Gag in Pr160^gag-pol could bedeleted without significantly affecting the incorporation ofGag-Pol into virus particles. ${Delta}$ (NC+PR) released significant amountsof RT activity, indicating that the NC and PR regions are notessential for Gag-Pol incorporation. In accordance with previousstudies (22, 27), the level of incorporated nonmyristylatedPr160^gag-pol (Fig. 5) was comparable to that of the myristylatedone. Each of the nonmyristylated constructs, when cotransfectedwith pGAG, could also release RT activity at a level comparableto or slightly lower than that of its myristylated counterpart,suggesting that the incorporation of the Gag-Pol mutants intovirus particles is independent of the N-terminal myristylationsignal.

View larger version (27K):
[in this window]
[in a new window]
FIG. 5. Release of HIV RT activity from cells cotransfected with the Pr160^gag-pol deletion mutants and pGAG. 293T cells were cotransfected with 1 µg of each PR-defective GPfs construct and 10 µg of pGAG. At 48 h posttransfection, supernatants were collected, filtered, and pelleted through a 20% sucrose cushion as described in Materials and Methods. Viral pellets were suspended in TSE, and about 40% of the suspensions were subjected to Western immunoblot analysis. The remaining suspensions were further diluted by addition of TSE and were then aliquoted for in vitro RT assays. RT activities (open bars) in each experiment were normalized to that obtained with GPfs plus pGAG, which was set at 100. Relative levels of released RT activity for each nonmyristylated GPfs deletion mutant were determined (shaded bars) by dividing the mutant GPfs RT activity by that of wt GPfs in parallel experiments. Values for each construct are derived from at least three independent experiments. Error bars indicate standard deviations.

Although some mutants, when expressed alone, occasionally secretedRT activity two- to threefold higher than the background level,significant amounts of RT activity were only detected on cotransfectionwith pGAG, with an average level at least 20- to 100-fold higherthan the background level. This suggests that the RT activityrecovered from the cotransfectant medium pellets was particleassociated. To confirm that the RT activity released from thecotransfectants was associated with the virus particles, mediumpellets from the cotransfection were centrifuged through a 20-to-60%sucrose density gradient as described in Materials and Methods.The results showed that both the RT activity and the Pr55^gagpeaked at the same fraction with a density of 1.16 to 1.18 g/ml(data not shown), suggesting that the mutant was indeed associatedwith virus particles.

DISCUSSION

Top

Discussion

We have shown that at least low levels of all the GPfs constructscould be incorporated into virus particles when cotransfectedwith a Pr55^gag expression plasmid at a DNA ratio of 1:5, asjudged by the presence of PR function that processes Gag andreleases p24^gag in the medium (Fig. 2). We have also demonstratedthat the levels of released Pr55^gag and p24^gag were markedlyreduced when the DNA ratio of cotransfected Pr160^gag-pol-to-Pr55^gagexpression plasmids was increased to 2:1 or 1:1 (Fig. 3A). Thisis not surprising, since a number of studies have shown thatoverexpression of the PR or Gag-Pol can suppress virus budding,presumably due to premature cleavage of the Gag precursors (1,4, 14, 21, 31). This result also reflects the fact that it wouldbe inadequate to assess the incorporation of the Gag-Pol carryingan active PR by using the two-plasmid coexpression system, sincethe amount of DNA used or the expression ratio of PR could affectthe level of released Pr55^gag and incorporated Pr160^gag-pol.Additionally, removal of the upstream gag coding sequence mayaffect PR activity (37), resulting in an alteration in the levelof virus production.

The results shown in Fig. 4 and 5 suggest that neither MA norNC is required for efficient incorporation of the Pr160^gag-polinto virus particles. These data agree with a previous studyshowing that replacement of HIV MA or NC with the MLV counterpartshad no detectable effect on the incorporation of chimeric Gag-Polinto HIV particles (9). Efficient incorporation of HIV Gag-Polinto virus particles has been suggested to require the presenceof both the HIV CA MHR and the adjacent C-terminal CA sequences(9). This proposal has been corroborated by our data showingthat both deletion mutants ${Delta}$ (MA+2/3 CA) and ${Delta}$ (NC+PR), which retainan intact MHR and C-terminal CA domain, were more efficientlyincorporated into virus particles than most of the CA deletionmutants. Mutants lacking the MHR could still be rescued intoparticles to about 50% or over 50% of the wt level, which contrastswith one previous study showing that deletion of the MHR cansignificantly impair the incorporation of Pr160^gag-pol intovirus particles (28). This discrepancy may be due to differentsystems employed by different groups. Alternatively, the threeforeign residues Arg-Ile-Arg replacing the deleted sequencein our ${Delta}$ MHR mutant may somehow contribute in a positive senseto the incorporation of Gag-Pol into virus particles.

Our present results indicate that the MHR and the adjacent C-terminalone-third of CA in the Pr160^gag-pol is the most important regionfor incorporation of Gag-Pol into virus particles. However,all of the capsid deletion mutants could release RT activityat least 20-fold higher than the background level when cotransfectedwith pGAG, at a minimum level of about 10% of wt level (Fig.5). Moreover, a deletion that removed all but the 15 N-terminalgag codons did not completely prevent the incorporation of theencoded Gag-Pol into virus particles (Fig. 3). This suggeststhat the gag coding sequence in Pr160^gag-pol is not absolutelyrequired for its incorporation into virus particles. It is possiblethat the expression levels of Gag and Gag-Pol may affect thespecific interaction between the two molecules. There is alsoa possibility that some of the Gag-Pol deletion mutants mayinterfere with the assembly of the coexpressed Pr55^gag, resultingin a reduction in virus budding and Gag-Pol incorporation. Toavoid these effects induced by the overexpressed Gag-Pol, eachof the GPfs constructs was cotransfected with pGAG at a DNAratio of 1:10. However, efficient uptake of the two plasmidsby 293T cells may occur under some circumstances, which couldalso reach a high expression level. Thus, minor but deleteriouseffects of the mutations may be masked by using a high-levelexpression system.

HIV RT and IN have been shown to be capable of being incorporatedinto virus particles independent of Pr160^gag-pol expression(5, 35, 36). In these studies, the RT or IN was fused to Vpr,and the incorporation of fusions Vpr-RT and Vpr-IN into virusparticles presumably depends on interaction of the N-terminalVpr with Pr55^gag (24). It is possible that the N-terminal 15residues may be responsible for rescue of the mutant [ ${Delta}$ GAG or ${Delta}$ (GAG+PR)] into particles via putative interactions with thePr55^gag. This is unlikely, however, because HIV Gag-ß-galactosidase(HIV GBG) fusion proteins, constructed by fusion of the ß-Galgene to HIV gag at the N-terminal 15th codon or at the C terminusof MA, were excluded from HIV particles (32), suggesting thatthe N-terminal 15 residues are not involved in the incorporationof Gag-Pol into virus particles. In contrast, HIV GBG (analogousto the HIV Gag-Pol) fused at the end of the NC domain was efficientlyincorporated into virus particles (32). Perhaps the HIV Polpossesses some uncharacterized property distinct from that ofthe ß-Gal. In support of this hypothesis, it has beendemonstrated clearly that the HIV GBG (32), not HIV Pr160^gag-pol,is severely impaired in its incorporation into virions uponremoval of the N-terminal myristylation signal. Thus, it isconceivable that HIV Pol may have as-yet-undefined functionsassociated with it which are involved in the process of Gag-Poltransport and incorporation.

There is no direct evidence suggesting that an interaction occursbetween the HIV Gag and Pol. However, the human foamy viruspol gene is encoded as Pro-Pol, and the Pol products can beincorporated into virus particles without the formation of aGag-Pol (16). One more recent study also demonstrated that thefree MLV Pol could be incorporated into virus particles whenMLV Pol and MLV Gag were coexpressed from separate plasmids(3). These data lead to the speculation that there may be someunidentified conserved regions residing in the retroviral Pol,which may contribute to facilitating the incorporation of Polinto virions. The HIV PR does not appear to play a crucial rolein the incorporation of Pol into virus particles, since significantamounts of particle-associated ${Delta}$ (NC+PR) could be released intothe medium on cotransfection with pGAG. It would be of interestto test whether the GPfs deletion mutants can complement RT-or IN-deficient HIV virions in trans to produce infectious virusparticles.

ACKNOWLEDGMENTS

We thank C.-C. Chang for technical assistance and Steve S.-L.Chen for helpful discussions and suggestions. The hybridomaclone 183 H12-5C and HIV-positive human serum were providedby the AIDS Research and Reference Reagent Program, Divisionof AIDS, NIAID.

This work was supported by grant NSC89-2320-B-010-106 from theNational Science Council and by grant DOH89-DC-1014 from theDepartment of Health, Taiwan, Republic of China.

FOOTNOTES

* Corresponding author. Mailing address: Department of Medical Research and Education, Taipei Veterans General Hospital, No. 201, Sec. 2, Shih-pai Rd., Shih-pai, Taipei 112, Taiwan. Phone: 886-2-2871-2121, ext. 2655. Fax: 886-2-2874-2279. E-mail: ctwang{at}vghtpe.gov.tw.

REFERENCES

Top