Journal of Virology, March 2002, p. 2245-2254, Vol. 76, No. 5
0022-538X/02/$04.00+0 DOI: 10.1128/jvi.76.5.2245-2254.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Interaction of the CC-Chemokine RANTES with Glycosaminoglycans Activates a p44/p42 Mitogen-Activated Protein Kinase-Dependent Signaling Pathway and Enhances Human Immunodeficiency Virus Type 1 Infectivity
Theresa Li-Yun Chang,1 Cynthia J. Gordon,2,
Branka Roscic-Mrkic,3 Christine Power,4 Amanda E. I. Proudfoot,4 John P. Moore,1 and Alexandra Trkola3*
Department of Microbiology and Immunology, Weill Medical College of Cornell University,,1
Department of Pathology, New York University School of Medicine, New York, New York,2
Division of Infectious Diseases, Department of Medicine, University Hospital Zurich, Zurich,3
Serono Pharmaceutical Research Institute, 1228 Plan-Les-Ouates, Geneva, Switzerland4
Received 1 August 2001/
Accepted 27 November 2001
 |
ABSTRACT
|
|---|
The interaction of the CC-chemokine RANTES with its cell surface receptors transduces multiple intracellular signals: low concentrations of RANTES (1 to 10 nM) stimulate G-protein-coupled receptor (GPCR) activity, and higher concentrations (1 µM) activate a phosphotyrosine kinase (PTK)-dependent pathway. Here, we show that the higher RANTES concentrations induce rapid tyrosine phosphorylation of multiple proteins. Several src-family kinases (Fyn, Hck, Src) are activated, as is the focal adhesion kinase p125 FAK and, eventually, members of the p44/p42 mitogen-activated protein kinase (MAPK) family. This PTK signaling pathway can be activated independently of known seven-transmembrane GPCRs for RANTES because it occurs in cells that lack any such RANTES receptors. Instead, activation of the PTK signaling pathway is dependent on the expression of glycosaminoglycans (GAGs) on the cell surface, in that it could not be activated by RANTES in GAG-deficient cells. We have previously demonstrated that RANTES can both enhance and inhibit infection of cells with human immunodeficiency virus type 1 (HIV-1). Here we show that activation of both PTK and MAPK is involved in the enhancement of HIV-1 infectivity caused by RANTES in cells that lack GPCRs for RANTES but which express GAGs.
 |
INTRODUCTION
|
|---|
RANTES (now designated CCL5) is a member of the CC-chemokine family, a group of small proteins with chemoattractant activity that have a highly conserved tertiary structure (78). RANTES has a complex influence on the biology of a variety of cell types including T lymphocytes, monocytes, natural killer cells, dendritic cells, basophils, and eosinophils (78). RANTES-induced chemotaxis is associated with receptor dimerization and activation (50, 58), the redistribution of adhesion factors (21, 63), and cytoskeleton rearrangements (61). In addition to these classical chemokine-activated responses, RANTES also induces several biochemical and biological effects that are unique to this chemokine. For example, RANTES causes T-cell activation in a mitogen-like manner, although it is not a T-cell mitogen (5, 6, 7, 19, 70). Furthermore, RANTES induces multiple biochemical signals, some of which are not triggered by other chemokines. Like all chemokines, RANTES at nanomolar concentrations activates a heterotrimeric G
i protein-coupled signaling pathway upon binding to any one of its known seven-transmembrane, G-protein-coupled receptors (GPCRs), including CCR1, CCR3, CCR4, and CCR5 (72). The G-protein-coupled pathway activated by RANTES through chemokine receptors typically involves a transient rise in cytosolic Ca2+ (7, 72), an increase in tyrosine phosphorylation and activation of focal adhesion kinase (p125 FAK) (9, 22), activation of phospholipase D (8), and increases in cytosolic cyclic AMP (21). In addition to these signals, RANTES at micromolar concentrations causes a sustained influx of Ca2+ which is independent of G-protein signaling but is mediated via activation of protein tyrosine kinases (PTKs) (7). Furthermore, RANTES specifically activates phosphatidylinositol 3-kinase (PI3K) (70). The PI3K pathway plays a central role in T-cell activation and is also involved in RANTES-induced chemotaxis and cell polarization (64, 70).
In recent years, the interaction of RANTES with the CCR5 receptor has been of particular interest because CCR5 acts as a coreceptor with CD4 during the entry of human immunodeficiency virus type 1 (HIV-1) into its target cells (11, 13, 25, 51). RANTES, like the other CCR5 ligands MIP-1
and MIP-1ß, can inhibit the entry of CCR5-using (R5) viruses by competing with the virus for binding sites on the same receptor (16, 67, 73; F. Arenzana-Seisdedos, J. L. Virelizier, D. Rousset, I. Clark-Lewis, P. Loetscher, B. Moser, and M. Baggiolini, Letter, Nature 383:400, 1996). Furthermore, these CC-chemokines can also prevent viral entry by causing CCR5 down-regulation (3, 69). Among the CC-chemokines, RANTES is the most potent at inhibiting the replication of R5 viruses, which it does in the nanomolar concentration range (16, 69).
In addition to its inhibitory effects on R5 viruses, RANTES can substantially enhance the replication of HIV-1 viruses that use the CXCR4 coreceptor for entry (X4 strains) (24, 31, 37, 52, 60, 68). The latter effect is usually, but not always, observed at high concentrations of RANTES (micromolar range). This effect of RANTES is independent of known seven-transmembrane GPCRs for RANTES but is dependent on the ability of the chemokine to interact with cell surface glycosaminoglycans (GAGs) and to form multimers (31, 56, 68). Other CC-chemokines such as MIP-1
and MIP-1ß do not enhance HIV-1 infectivity because they do not multimerize, and nonaggregating variants of RANTES are also nonenhancing (18, 68). The enhancement of HIV-1 infectivity by RANTES involves two mechanisms: one is mediated by RANTES oligomers that bind simultaneously to GAGs on virions and target cell membranes, thereby cross-linking the former to the latter and increasing virion attachment and entry. The second mechanism requires a prolonged interaction of RANTES oligomers with cell surface GAGs, which leads to activation of a tyrosine kinase-dependent signal transduction pathway(s) (31, 68).
Here, we analyze the biochemical signals induced by the interaction of RANTES with GAGs on cells that lack GPCRs for RANTES, with emphasis on defining the signals that enhance HIV-1 infectivity. We show that activation of PTKs by RANTES can occur independently of any known GPCR for RANTES, but it requires GAG expression on the target cell. The RANTES-GAG interactions activate several src-family kinases, p125 FAK, and members of the p44/p42 mitogen-activated protein kinase (MAPK) family. These studies help reveal the signaling functions of cell-surface GAGs and the possible involvement these molecules may play in the HIV-1 replication cycle.
 |
MATERIALS AND METHODS
|
|---|
Antibodies and reagents.
Mouse antiphosphotyrosine monoclonal antibodies (MAbs) 4G10 and PY20 were purchased from Upstate Biotechnology Inc. (Lake Placid, N.Y.) and Biomol Inc. (Plymouth Meeting, Pa.). Polyclonal rabbit antibodies (Abs) against p44/p42 MAPKs were from Upstate Biotechnology. MAb against phospho-p44/p42 MAPKs was from New England Biolabs Inc. (Beverly, Mass.). Rabbit polyclonal anti-FAK[pY397] and anti-phospho-Src(418) Abs were from Biosource International (Camarillo, Calif.), rabbit polyclonal anti-FAK Ab was from Pharmingen, goat polyclonal anti-Fyn Ab (FYN3) and goat polyclonal anti-Src Abs (N-16) were from Santa Cruz Biotechnology (Santa Cruz, Calif.), and anti-Hck MAb was from Transduction Laboratories Inc. Recombinant human RANTES and MIP-1
were produced in the bacterial host Escherichia coli as described previously (57). The mutated, nonaggregating RANTES molecule BB-10520 RANTES was provided by British Biotechnology Ltd. (Oxford, United Kingdom) (5, 6, 7, 19, 70). The inhibitors genistein, daidzein, PD98059, and 5-iodotubericidin were obtained from Biomol Inc., herbimycin A was from Calbiochem Inc., and pertussis toxin (Ptx) was from Sigma Chemical Co. (St. Louis, Mo.).
Cell lines.
HeLa-CD4 cells were provided by David Kabat (University of Oregon, Portland). They were maintained in Dulbecco's minimal essential medium (DMEM) containing 10% fetal calf serum (FCS), glutamine, and antibiotics and split twice a week. For use in RANTES stimulation experiments, HeLa-CD4 cells were washed with phosphate-buffered saline (PBS) twice and then maintained in DMEM with 0.1% FCS for 48 h prior to RANTES addition. Chinese hamster ovary (CHO)-K1 cells and chondroitin sulfate-mutant CHO cells (psgA-745 cells) were obtained from the American Type Culture Collection (Rockville, Md.) (26, 27, 44). These lines were maintained in F12K nutrient mixture (Kaighn's modification) supplemented with 10% FCS.
Signal cascade analysis was performed on cells that had been serum starved for 48 h in medium containing 0.1% FCS, a procedure which causes the cells to accumulate at the G0/G1 border. This synchronization of the cells did not directly affect the signals induced by RANTES, but it ensured that the baseline level of activation of the cells was comparable between repeat experiments. We also confirmed that serum starvation had no effect on the HIV-1 infectivity enhancement induced by RANTES. Infection experiments were therefore carried out in the presence of serum, as described previously (31).
Detection of chemokine receptor mRNA in HeLa-CD4 cells.
Total RNA was isolated from 108 HeLa-CD4 cells by using the Trizol reagent according to the manufacturer's instructions (Life Technologies Inc.). cDNA was generated from 5 µg of total RNA in a reaction volume of 20 µl, using the Promega reverse transcription kit with oligo(dT) primers and avian myeloblastosis virus reverse transcriptase according to the protocol supplied by the manufacturer. After incubation for 1 h at 42°C, the reaction mixture was heated at 95°C for 2 min and then diluted to 200 µl with sterile, nuclease-free water. Five-microliter aliquots of each diluted reverse transcription (RT) reaction mixture were then subjected to 30 cycles of PCR (2 min at 95°C, 2 min at 55°C, 2 min at 72°C) in a 50-µl reaction mixture containing 50 pmol each of primers specific for the chemokine receptors D6, Duffy, and CXCR4. The primers were based on the coding sequences in the EMBL database as follows: D6 sense primer, CGTTCATGCTCAGCCCTAC; D6 antisense primer, CTGGAGTGCGTAGTCTAGATGC; DARC sense primer, ACCATGGCCTCCTCTGGGTATGTC; DARC antisense primer, GAACTAGGATTTGCTTCCAAGGG; CXCR4 sense primer, ACCATGGAGGGGATCAGTATATAC; CXCR4 antisense primer, TTAGCTGGAGTGAAAACTTGAAGACTC. As a control for the quality of the input RNA, glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific primers were included in each RT reaction and shown to amplify a specific 1.0-kb product. As a negative control for DNA contamination of HeLa-CD4 cell RNA, the RT reaction was performed in the absence of reverse transcriptase and subjected to PCR amplification as described above. As positive controls for the PCRs, 100 ng of plasmid DNA containing the full coding sequence of each of the chemokine receptors was amplified under the same conditions. (Plasmid DNA containing D6 was kindly provided by Gerry Graham, Cancer Research Campaign Laboratories, The Beatson Institute for Cancer Research, Glasgow, United Kingdom; the other plasmids were generated in our laboratory.) PCR products (10 µl) were analyzed on ethidium bromide-stained, 1% agarose gels for the presence of an approximately 1-kb reaction product corresponding to the full cDNA coding sequence of these receptors.
The expression of chemokine receptors CCR1 through CCR7 and CXCR5 was determined by real-time PCR analysis using the Taqman system (ABI Perkin-Elmer Systems 3700) and predeveloped Taqman assay kits (Perkin-Elmer Inc.) according to the manufacturers' instructions.
Immunoprecipitation and Western blot analysis.
All reagents, unless specified below, were purchased from Sigma Chemical Co. Whole-cell extracts (WCE) were prepared by lysis of serum-starved cells in 20 mM HEPES buffer (pH 7.9) containing 0.2% NP-40, 10% glycerol, 200 mM NaCl, 0.1 mM EDTA, 1 mM dithiothreitol, 1 mM sodium orthovanadate, 0.5 mM phenylmethylsulfonyl fluoride, and a protease inhibitor cocktail (Boehringer Mannheim Inc.). The protein concentration in WCE was determined by the Bradford method using the Bio-Rad protein assay (Bio-Rad, Hercules, Calif.). Antibodies (1 µg) were added to protein G-Sepharose 4 Fast Flow beads (Amersham Pharmacia Biotech, Piscataway, N.J.) and incubated at 4°C for 2 to 4 h. After washing the beads three times with PBS to remove unbound antibody, the beads were incubated with equal amounts of WCE for 3 to 4 h at 4°C. The bound protein complexes were then washed three times with lysis buffer prior to separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Dependent on the proteins being analyzed, either 8, 10, or 12% gels were used as specified in the figure legends. Following electrophoresis, proteins were transferred to polyvinylidene fluoride membranes (Millipore, Bedford, Mass.). The membranes were blocked with 3% bovine serum albumin (BSA) fraction V in rinse buffer (10 mM Tris, 150 mM NaCl, 1 mM EDTA, 0.1% Triton X-100) for 30 min at room temperature and then incubated overnight at 4°C with the appropriate primary antibodies in rinse buffer-BSA. (When phosphotyrosine-specific MAbs 4G10 and PY20 were used, no BSA was added during this incubation step.) After three 15-min washes in rinse buffer, the blots were incubated with horseradish peroxidase-linked secondary antibody (Kirkegaard & Perry Laboratories, Gaithersburg, Md.) at a dilution of 1:10,000 for 1 h at room temperature and then washed three times with rinse buffer for 15 min. The immunoblotted proteins were visualized using the SuperSignal West Pico chemiluminescent substrate according to the manufacturer's specifications (Pierce, Rockford, Ill.). To reprobe blots, membranes were incubated in stripping buffer (100 mM ß-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7) at 55°C for 1 h and rinsed with PBS several times prior to a second Western blot analysis. We have observed that these two antiphosphotyrosine antibodies have different affinities towards different species of tyrosine-phosphorylated proteins activated by RANTES (data not shown). We therefore used a combination of the antibodies PY20 and 4G10 to monitor changes of the phosphorylation status of proteins with a molecular mass between 66 and 220 kDa. Phosphorylated proteins with a molecular mass below 66 kDa were detected using MAb 4G10 only, because MAb PY20 highlighted nonspecific bands of approximately 60 kDa which interfered with the detection of specific phosphorylated proteins in this molecular mass range.
Viruses.
Env-pseudotyped, luciferase-expressing reporter viruses were produced using the calcium phosphate technique (15, 17). Thus, 293T cells were cotransfected with the envelope-deficient HIV-1 NL4-3 construct, pNL-Luc, and a pSV vector expressing viral envelope glycoproteins (15, 17). The pNL-Luc virus carries the luciferase reporter gene; the pSV vectors express envelope glycoproteins derived from amphotropic murine leukemia virus (MuLV). The Env-pseudotyped viruses are designated HIV-1MuLV with the subscript representing the pseudotyped env gene.
Viral infection assay with luciferase readout.
The extent of HIV-1 entry was determined using a single-cycle infection assay as described previously (15, 17). One day before infection, 104 HeLa-CD4 cells were plated onto each well of a 96-well tissue culture plate. The cells were allowed to adhere for 5 h and then treated with inhibitors as indicated. Twenty-four hours prior to infection, 1.28 µM (10.0 µg/ml) RANTES was added to designated cultures. After incubation for 24 h with the chemokine in the presence or absence of inhibitors, the cells were washed with fresh medium and infected with HIV-1MuLV in the absence of inhibitors. This infection step was carried out in a total volume of 200 µl for 2 h at 37°C before removal of the virus and replenishment of the cells with fresh medium. Seventy-two hours postinfection, the cells were lysed in 50 µl of 1x reporter lysis buffer (Promega). The luciferase activity of a mixture of 100 µl of luciferase substrate (Promega) and 30 µl of cell lysate was measured in relative light units (RLU) by using a Dynex MLX microplate luminometer.
 |
RESULTS
|
|---|
RANTES induces multiple phosphorylation and dephosphorylation events in the absence of known RANTES seven-transmembrane GPCRs.
The interaction of RANTES with its cognate chemokine receptors on T cells activates signal transduction pathways that involve the tyrosine phosphorylation of multiple protein species (9, 20, 22, 23, 77). We have previously studied RANTES stimulation of HeLa-CD4 and CHO cells that express neither the high-affinity RANTES receptors CCR1 and CCR5 nor the low-affinity receptors CCR3 and CCR4. Treatment of the cells for several hours with high (1 µM), but not low (0.1 µM), levels of RANTES induced PTK signaling that rendered the cells more susceptible to HIV-1 infection (31, 68). The enhancement of HIV-1 infectivity by RANTES can be inhibited by herbimycin A, a src-kinase inhibitor which also inhibits RANTES-mediated, PTK-dependent Ca2+ influx into T cells (9, 68).
To elucidate the molecular mechanism of RANTES-mediated infectivity enhancement via PTK signaling, we first monitored changes in protein tyrosine phosphorylation of HeLa-CD4 cells upon RANTES treatment.
WCE were prepared from HeLa-CD4 cells incubated with or without RANTES for 1, 5, 15, and 30 min. Tyrosine-phosphorylated proteins were then immunoprecipitated and immunoblotted with the antiphosphotyrosine antibodies PY20 and 4G10 (Fig. 1).
Overall, several proteins became tyrosine phosphorylated or dephosphorylated in response to RANTES, with the extent of tyrosine phosphorylation changing over time (Fig. 1). Changes in the phosphorylation status of seven major protein bands were consistently detected in multiple experiments, with the intensity and timing of the phosphorylation changes differing among them (Fig. 1 and data not shown). Whether or not a specific band represents one or multiple proteins could not be determined from this analysis.

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 1. Induction of tyrosine phosphorylation and dephosphorylation by RANTES. (A) Serum-starved HeLa-CD4 cells were treated with RANTES (0.64 µM [5.0 µg/ml]) for the indicated times. Time zero indicates no RANTES treatment. WCE were immunoprecipitated (IP) with phosphotyrosine-specific MAbs PY20 and 4G10. The IPs were separated on SDS-8% PAGE gels and immunoblotted (IB) using MAbs PY20 and 4G10. (B) Results of an experiment performed as described above, except that only MAb 4G10 was used for IP, since we have found that this allows better resolution of low-molecular-weight proteins. The data shown are representative of one of five individual experiments.
|
|
A detailed analysis indicated that a protein band with a molecular mass of 220 kDa (band I) showed a weak increase in Tyr phosphorylation in response to RANTES within 1 min, and the degree of phosphorylation of this protein band gradually increased over 30 min. A protein band (band II) with an approximate molecular mass between 180 and 200 kDa became phosphorylated within 15 to 30 min in response to RANTES. There was a low-level increase in phosphorylation of a third protein (band III) within 5 min of RANTES treatment, yet its degree of phosphorylation significantly increased after 15 to 30 min. Phosphorylation of protein band IV amplified substantially within 1 min and was sustained for 30 min. Phosphorylation of a protein band with a molecular mass of 66 kDa (band V) became detectable only after 15 to 30 min. Two proteins with an approximate molecular mass of 60 kDa (bands VI and VII) were markedly phosphorylated in untreated cells, but they became dephosphorylated within 1 min of RANTES addition. However, the phosphorylation of these protein bands then increased in intensity after 15 to 30 min (Fig. 1B). Although the magnitude of RANTES-induced protein Tyr phosphorylation responses varied between experiments, the overall pattern shown in Fig. 1 was consistent in multiple experiments. Of note is that a nonaggregating form of RANTES, the BB10520 molecule (5, 6), was a significantly less efficient activator of Tyr phosphorylation than was wild-type RANTES (data not shown).
To determine whether any known GPCRs specific for RANTES were involved in the above protein tyrosine phosphorylation events, we investigated whether mRNAs encoding any of the chemokine receptors CCR1 through CCR7 or CXCR5 were expressed in HeLa-CD4 cells. However, no mRNA for any of the above receptors could be detected using a highly sensitive, real-time PCR assay (data not shown). We further determined by RT-PCR whether the RANTES receptors D6 (55) and Duffy antigen (54) were expressed. As a positive control, RT-PCR products were generated using primers specific for CXCR4, since this receptor is known to be expressed in HeLa-CD4 cells (Fig. 2).
No reaction products were detectable in the negative control for any of the primer pairs tested, whereas all the positive controls yielded a strong band of the appropriate size (Fig. 2 and data not shown). RT-PCR products for neither the Duffy antigen nor the D6 receptor could be generated from mRNA of HeLa-CD4 cells (Fig. 2). DNA sequencing showed that the weak band of the predicted size amplified from HeLa cells using D6 primers was not, in fact, D6 mRNA (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2. GPCRs for RANTES are not expressed in HeLa-CD4 cells. PCR products of HeLa-CD4 cDNA using primers specific for Duffy, D6, and CXCR4 were separated on an ethidium bromide-stained 1% agarose gel. Left lanes, products obtained with HeLa-CD4 cDNA; right lanes, positive controls for the PCRs obtained using 100 ng of plasmid DNA containing the full coding sequence of each receptor.
|
|
RANTES activates src kinases.
Members of the src family of kinases can link activated GPCRs to downstream signaling cascades such as the MAPK pathway (23, 46). In particular, a src kinase is known to be involved in the signaling pathway activated by high (micromolar) concentrations of RANTES (7). The src kinase inhibitor herbimycin A can inhibit both the Ca2+ signals induced by RANTES and its enhancement of HIV-1 infectivity (7, 68). This prompted us to directly investigate the role of src kinases in the GPCR-independent, RANTES-induced signaling events.
We first confirmed our previous observations that the enhancement of HIV-1 infection caused by prolonged treatment of HeLa-CD4 cells with micromolar concentrations of RANTES is reduced by the src kinase inhibitor herbimycin A and the general PTK inhibitor genistein (Fig. 3A)
(1). Since RANTES-induced infectivity enhancement is independent of the route of viral entry, we used HIV-1MuLV Env-pseudotype viruses to avoid any interference of RANTES with viral entry and to exploit the greater variety of cells that can be infected via the amphotropic MuLV envelope than via HIV-1 Env. We chose concentrations of these inhibitors that did not affect HIV-1MuLV infectivity in the absence of RANTES (Fig. 3A). To rule out effects of genistein in these assays via mechanisms other than PTK inhibition, we performed similar experiments with the chemically related compound daidzein; this compound is not a PTK inhibitor (1), and it had no effect on RANTES-mediated enhancement of HIV-1MuLV infectivity (data not shown).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 3. Activation of src kinases. (A) RANTES (1.28 µM [10.0 µg/ml]) was added for 24 h to HeLa-CD4 cells that had been previously incubated for 1 or 2 h without or with inhibitors (herbimycin A, 500 ng/ml, preincubation for 1 h; genistein, 20 µg/ml, preincubation for 2 h). The cells were then washed and infected with HIV-1MuLV (2.5 ng of HIV-1 p24 antigen) in the absence of RANTES. Unbound virus was removed after 2 h and then the cultures were replenished with fresh medium without RANTES. Neither RANTES nor inhibitors were present during the 2-h infection period or thereafter. The extent of viral infection was determined by measuring luciferase expression in quadruplicate cultures on day 3 postinfection; the data are presented as percentages of control (no chemokine = 100%). Viral infection levels in the untreated control cells were equivalent to 723 ± 153 RLU. The data shown are representative of one of three individual experiments. Open bars symbolize cultures where infection was carried out in the absence of RANTES, and hatched bars indicate cultures where RANTES pretreatment was performed. The effect of kinase inhibitors on HIV-1 infectivity in RANTES-treated and control (no RANTES) cultures was examined and compared to the infectivity in the absence of inhibitors. (B) Serum-starved HeLa-CD4 cells were treated with RANTES (0.64 µM [5.0 µg/ml]) for the indicated times. Time zero indicates no RANTES treatment. WCE were immunoprecipitated with anti-Fyn Ab, anti-Hck Ab, or anti-Src Ab. Immunoprecipitates (IPs) were separated on SDS-10% PAGE gels and immunoblotted using the phosphotyrosine-specific MAb 4G10. Blots were then stripped and reprobed with the specific antikinase Abs to confirm equal loading of samples. (C) Results of experiment as described above except that serum-starved CHO-K1 cells were used.
|
|
To determine whether src kinases are activated by RANTES treatment, we measured the extent to which specific members of the src kinase family were tyrosine phosphorylated in response to RANTES, since tyrosine phosphorylation is known to regulate the activity of these kinases (65). We found that RANTES induced tyrosine phosphorylation of the src kinases Fyn (p59), c-Src (p60), and Hck (p59) in HeLa-CD4 cells, with varying kinetics and to different extents (Fig. 3B). Phosphorylation of Fyn was detected approximately 30 min after RANTES addition and increased in intensity for at least a further 30 min. Phosphorylation of Hck was very rapid; an increase was detectable within 1 min, the response was maximal after 5 min, and then the extent of phosphorylation gradually declined. Phosphorylation of c-Src was weakly elevated after 15 min and was maximal at 30 min (Fig. 3B). We further determined that phosphorylation of c-Src was induced at Tyr-418 (see Fig. 8, below, and data not shown); this residue must be phosphorylated for c-Src to have high enzymatic activity (36). Similarly to what was observed in HeLa-CD4 cells, Fyn was also rapidly activated in CHO-K1 cells after RANTES treatment (Fig. 3C).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 8. Activation of p44/p42 MAPK but not of src-kinases by RANTES is dose dependent. (A) Serum-starved HeLa-CD4 cells were treated with the indicated concentrations of RANTES. The duration of treatment was chosen with knowledge of when the individual kinases became maximally phosphorylated. For analysis of Fyn phosphorylation, the cells were treated for 30 min with RANTES, 5 min with Hck, and 30 min with Src. (B) The cells were treated with the indicated concentrations of RANTES. WCE were separated on SDS-12% PAGE gels and immunoblotted using phospho-specific anti-p44/42 MAb. The blots were then stripped and reprobed with anti-p44/42 serum to confirm equal loading of samples. The data shown are representative of one of three individual experiments.
|
|
RANTES induces phosphorylation of the focal adhesion kinase, p125 FAK.
The focal adhesion kinase p125 FAK is a PTK that is regulated by src kinases in response to multiple extracellular stimuli (65). RANTES at 0.5 to 1 µM has been previously shown to cause activation of p125 FAK, the related kinase pyk2, and associated cytoskeletal components such as paxillin and Zap-70 (9, 20, 22, 43). Together, these observations suggest a potential role for RANTES in generating T-cell focal adhesions. The experiments in the above reports, however, were performed on cells that express the RANTES receptors CCR1 and CCR5; activation of p125 FAK by RANTES has therefore been considered to be mediated via these GPCRs (9, 20). Here, we show that p125 FAK can be activated by RANTES treatment of HeLa-CD4 cells that lack known GPCRs for RANTES (Fig. 4).
The activation of p125 FAK involves autophosphorylation of residue Tyr397, an event that creates a binding site for the Src SH2 domain (59, 65). Phosphorylation of Tyr397 on p125 FAK is detectable within 1 min of RANTES addition to HeLa-CD4 cells, and the protein is strongly phosphorylated after 30 to 60 min (Fig. 4). Furthermore, we determined that band III depicted in Fig. 1 is indeed FAK by reprobing the phosphotyrosine blots with a FAK-specific antibody (data not shown).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4. Activation of p125 FAK. Serum-starved HeLa-CD4 cells were treated with RANTES (0.64 µM = 5.0 µg/ml) for the indicated times. Time zero indicates no RANTES treatment. WCE were separated on SDS-8% PAGE gels and immunoblotted using phospho-specific anti-FAK[pY397] polyclonal rabbit serum. The blots were then stripped and reprobed with anti-FAK polyclonal rabbit serum to confirm equal loading of samples. The data shown are representative of one of three individual experiments.
|
|
RANTES induces activation of p44/p42 MAPK.
The p44/p42 MAPK pathway is a critical regulator of cell growth, migration, and differentiation (30, 47). Several chemokines, including RANTES, are known to cause p44/p42 MAPK activation in various cell types (10, 12, 66). Signaling through GPCRs can activate the p44/p42 MAPKs through both G
i-dependent (Ptx-sensitive) and G
i-independent (Ptx-insensitive) mechanisms (45). Here, we show that p44/p42 MAPKs are rapidly activated upon the addition of 0.64 µM (5.0 µg/ml) RANTES to HeLa-CD4 cells that lack known GPCRs for RANTES (Fig. 5).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5. Activation of p44/p42 MAPK by RANTES. (A) Serum-starved HeLa-CD4 cells were treated with RANTES (0.64 µM [5.0 µg/ml]) for the indicated times. Time zero indicates no RANTES treatment. WCE were separated on SDS-12% PAGE gels and immunoblotted using phospho-specific anti-p44/42 polyclonal rabbit serum. The blots were then stripped and reprobed with anti-p44/42 serum to confirm equal loading of samples. (B) Results of experiment performed as described above except that MIP-1 (5 µg/ml) was used. (C) Results of experiment performed as described above except that the cells were treated for 30 min with the nonaggregating RANTES derivative BB10520 (0.64 µM [5.0 µg/ml]) or with wild-type RANTES (0.64 µM [5.0 µg/ml]). (D) Results of experiment performed as described above except that the cells were treated for 30 min with RANTES (0.64 µM [5.0 µg/ml]) in the presence or absence of 50 µg of genistein/ml, which was added to the cells 30 min before RANTES. (E) Results of experiment performed as described above except that the cells were treated for 30 min with RANTES (0.64 µM [5.0 µg/ml]) in the presence or absence of 0.5 µg of Ptx/ml, which was added to the cells 30 min before RANTES. The data shown are representative of one of three individual experiments.
|
|
The activities of p44/p42 MAPK were analyzed by immunoblotting using an antibody specific for phosphorylated p44/p42, the active forms of p44/p42 MAPKs (62). Activation of specific phosphorylation of p44 and p42 MAPKs was detected in HeLa-CD4 cells within 5 to 15 min of RANTES addition. This activation peaked after approximately 30 min (Fig. 5A). In contrast, the same concentration of MIP-1
did MAPK activation in HeLa-CD4 cells (Fig. 5B). Elevated levels of MAPK activation were also detectable after 24 h of treatment with RANTES (data not shown). A RANTES mutant, BB10520, which does not oligomerize and which we previously found not to enhance HIV-1 infectivity (31, 68), was substantially less efficient at inducing tyrosine phosphorylation and MAPK activation in HeLa cells (Fig. 5C and data not shown). Activation of MAPKs by RANTES was inhibited by genistein (Fig. 5D) but not by the G
i inhibitor Ptx (Fig. 5E). Ptx treatment was itself able to induce phosphorylation of p44/p42 MAPK, as has been reported by others in a different experimental system (42). However, RANTES still induced a significant increase in MAPK phosphorylation in the presence of Ptx (Fig. 5E). Thus, tyrosine kinases are involved in this signaling pathway, but G
i-dependent signaling complexes are not.
To test whether MAPKs are involved in transmitting the RANTES signal which causes HIV-1 infectivity enhancement, we used the MEK inhibitor PD98059 (2) and the ERK2 inhibitor 5-iodotubercidin (28). Both inhibitors partially reduced the enhancing effect of RANTES on HIV-1MuLV infection of HeLa-CD4 cells (Fig. 6A).
The residual enhancement of infection in the presence of the various inhibitors (herbimycin A, genistein, PD98059, and 5-iodotubercidin) is probably due to RANTES-mediated cross-linking of virions to cells, a process that does not involve signal transduction (68).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6. MAPK inhibitors reduce RANTES enhancement of infectivity. RANTES (1.28 µM [10.0 µg/ml]) was added for 24 h to HeLa-CD4 cells that had been previously incubated for 1 h without or with inhibitors (PD98059, 10 µg/ml; 5-iodotubericidin, 0.8 µg/ml). The cells were washed and then infected with HIV-1MuLV (0.5 ng of HIV-1 p24 antigen) in the absence of RANTES. Unbound virus was removed after 2 h, and then the cultures were replenished with fresh medium without RANTES. Neither RANTES nor inhibitors were present during the 2-h infection period or thereafter. The extent of viral infection was determined by measuring luciferase expression in quadruplicate cultures on day 3 postinfection; the data are presented as percentages of control (no chemokine = 100%). Viral infection levels in the untreated control cells were equivalent to 2,506 ± 347 RLU (A) and 35,690 ± 1,787 RLU (B). The data shown are representative of one of three individual experiments. Open bars symbolize cultures where infection was carried out in the absence of RANTES, and hatched bars indicate cultures where RANTES pretreatment was performed. The effect of kinase inhibitors on HIV-1 infectivity in RANTES treated and control (no RANTES) cultures was examined and compared to the infectivity in the absence of inhibitors.
|
|
The activation of PTK and MAPK by RANTES is dependent on GAGs.
We have previously demonstrated that RANTES-induced HIV-1 infectivity enhancement is dependent on GAG expression on the target cell surface (68). Here, we investigated whether the PTK and MAPK signals activated by RANTES are also GAG dependent by comparing GAG-expressing CHO-K1 cells and GAG-deficient psgA-745 cells. The latter are CHO cell mutants which express neither heparan sulfates nor chondroitin sulfates (26, 27, 44). RANTES induced a strong and rapid activation of both PTK and MAPK in cells expressing GAGs but did not do so in the GAG-deficient cells (Fig. 7).
In CHO-K1 cells, tyrosine phosphorylation of three protein bands at approximately 90, 60, and 50 kDa was rapidly induced by RANTES and could be detected directly in whole cell lysates without prior immune precipitation (Fig. 7A). The protein band at 90 kDa was strongly phosphorylated within 1 min of RANTES addition to the cells, and the intensity peaked at 5 min. However, after 15 to 30 min this protein band became dephosphorylated to background levels. The protein band at 60 kDa underwent an increase in tyrosine phosphorylation after 1 min of RANTES treatment, followed by a decrease from 5 min onwards. A third protein band of approximately 50 kDa became weakly and transiently phosphorylated after 5 min of RANTES treatment (Fig. 7A). In marked contrast with what was observed in CHO-K1 cells, RANTES induced only the phosphorylation of the 90-kDa protein band in the GAG-deficient mutant CHO cells (Fig. 7A, right panel). Moreover, this band was much less strongly phosphorylated in the mutant cells than in the CHO-K1 cells.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 7. GAG dependency of MAPK activation. (A) Serum-starved CHO-K1 and CHO-K1 pgsA 745 cells were treated with RANTES (0.64 µM = 5.0 µg/ml) for the indicated times. Time zero indicates no RANTES treatment. WCE were analyzed for protein content according to the Bradford method, and equal amounts of protein (45 µg) were loaded to each lane. WCE were then separated on SDS-10% PAGE gels and immunoblotted using phophotyrosine-specific MAb 4G10. (B) Results of experiment performed as described above except that the immunoblotting (IB) was performed using the phospho-specific anti-p44/42 polyclonal MAb. The blots were then stripped and reprobed with anti-p44/42 serum to confirm equal loading of samples. The data shown are representative of one of three individual experiments.
|
|
We next investigated the influence of GAG expression on MAPK activation by RANTES. A rapid activation of the p44/p42 MAPK was induced by RANTES in CHO-K1 cells (Fig. 7B). The GAG-deficient cells had a higher baseline level of MAPK phosphorylation than the parental CHO-K1 cells, but no increase was observed upon RANTES treatment (Fig. 7B).
The activation of MAPK, but not the activation of src kinases, by RANTES is dose dependent.
RANTES enhances the infectivity of HIV-1 at high concentrations (1 µM), whereas lower concentrations (0.1 µM) either have no effect or are inhibitory if viral entry is via CCR5 (31, 68). Moreover, micromolar concentrations of RANTES are required to induce a PTK-dependent Ca2+ influx (9). We therefore investigated the dose dependency of the RANTES-activated PTK signaling pathway in HeLa-CD4 cells.
Both low (0.013 µM [0.1 µg/ml]) and high (0.64 µM [5.0 µg/ml]) concentrations of RANTES stimulated the phosphorylation of src kinases in HeLa-CD4 cells to an equal extent (Fig. 8A).
However, the activation of p44/p42 MAPK was clearly dependent on the RANTES concentration (Fig. 8B). The low concentration of RANTES caused weak p44/p42 MAPK activation after 15 min, and no further increase in p44/p42 MAPK phosphorylation occurred thereafter. In contrast, the high concentration of RANTES induced p44/p42 MAPK activation strongly within 5 min, and the extent of phosphorylation continued to increase with time.
 |
DISCUSSION
|
|---|
The principal observation we have made in this study is that the interaction of RANTES with cell surface GAGs activates a PTK- and MAPK-dependent signaling pathway. These signals are activated in HeLa-CD4 cells that lack any known GPCRs for RANTES, and they are activated in CHO-K1 cells but not in mutant CHO cells that are defective for GAG expression. Thus, we can find no evidence that the PTK- and MAPK-dependent signals are transduced via the interaction of RANTES with known, specific chemokine receptors of the GPCR superfamily.
The importance of GAG-chemokine interactions is becoming increasingly apparent. RANTES is not unique in being able to interact with GAGs, since other chemokines, growth factors, extracellular matrix proteins, adhesion molecules, and protease inhibitors can all do so (33). However, the true biological function of chemokine-GAG interactions is yet to be determined (4, 32, 38, 40, 41, 56). It has been suggested that the attachment of chemokines to GAGs leads to the formation of immobilized chemokine gradients in the extracellular matrix and on the surface of several cell types--a process which is believed to be pivotal for triggering cell migration (33). There have been conflicting reports as to whether or not the binding of chemokines to cell surface GAGs is necessary for them to signal through their specific GPCRs (14, 56). We now provide biochemical evidence that the interaction of RANTES with GAGs goes beyond a mere anchoring or sequestration of the chemokine. Instead, the presence of GAGs is necessary for the induction of specific, PTK-dependent transmembrane signals. Thus, the activation of Src kinases, p125 FAK, and MAPK by RANTES is mediated by both GPCR-dependent and -independent signaling pathways, the latter being GAG dependent.
The GAG-dependent pathway we have been studying may account for the sustained, PTK-dependent influx of Ca2+ into T lymphocytes that occurs at high RANTES concentrations (7). It is formally possible that an as-yet-unidentified, low-affinity GPCR for RANTES is also involved, although the signals we observed in HeLa-CD4 cells were insensitive to pertussis toxin and so are unlikely to be mediated via a classical G
i-dependent signaling receptor. It is also conceivable that G-protein signaling via Ptx-insensitive G-protein complexes could play a role (7). We have not yet determined whether RANTES binds solely to GAGs or if a specific proteoglycan(s) binds RANTES. A proteoglycan could serve as both a binding and signaling receptor for RANTES, or it could function as an anchor, with the tethered chemokine then interacting with a third molecule through which signals are transmitted.
We have also obtained evidence that the PTK-dependent, GAG-mediated signaling pathway is involved in the enhancement of HIV-1 infectivity that is stimulated by high, micromolar concentrations of RANTES in vitro. Whether RANTES enhancement of HIV-1 infectivity has any direct physiological relevance remains to be determined. In our in vitro experiments, infectivity enhancement is only observed at RANTES concentrations greater than 100 nM, whereas plasma concentrations of RANTES rarely exceed 20 nM in both healthy and HIV-1-infected individuals (35, 39, 49, 53). Local concentrations of chemokines in tissues are unknown but are likely to be elevated during inflammation, and the sequestration of RANTES by GAGs in lymphoid tissues could increase its local concentration. A recent study has also suggested that high levels of RANTES may potentially play a role in promoting HIV-1 transmission (48). Several groups have previously reported HIV-1 infectivity-enhancing activities of chemokines at physiological concentrations (nanomolar range) in primary cell culture systems (24, 31, 37, 52, 60, 68). Furthermore, RANTES has been shown to cause T-cell activation at these concentrations (5, 6, 7, 19, 70). To investigate the mechanisms underlying RANTES-induced HIV-1 infectivity enhancement, we had to use cell systems that allowed us to discriminate between GPCR-dependent and -independent effects. The same concentration ranges will not necessarily apply to these cell systems and to primary cells. However, in vitro experiments using primary CD4+ T cells and macrophages do show that both high (micromolar) and low (nanomolar) concentrations of RANTES enhance HIV-1 infectivity, suggesting a possible role for these phenomena in vivo. We are presently investigating further the effects of the RANTES-mediated signals on primary CD4+ T cells and macrophages.
Irrespective of whether RANTES can enhance HIV-1 infection in vivo, our experiments with RANTES in vitro have provided information on how transmembrane signaling events can affect the viral life cycle. The RANTES concentrations that enhance HIV-1 infectivity also activate the MAPK pathway, which could have an impact on HIV-1 infectivity in several ways. MAPKs, which are activated by a variety of stimuli, are known to phosphorylate various cytoplasmic and membrane-bound cellular substrates, and they are also rapidly translocated to the nucleus, where they phosphorylate and activate transcription factors. Moreover, the MAPK pathway directly interacts with steps in the HIV-1 life cycle by regulating reverse transcription and integration events through the direct phosphorylation of viral proteins (29, 34, 75, 76). Hence, the early phase of virus infection could be accelerated by such signals. Furthermore, MAPKs, through their activation by cytokine signals, have been implicated in the induction of HIV-1 replication in latently infected cells by stimulating activator protein 1 (AP-1) and then inducing the interaction of AP-1 with NF-
B (74). We do not yet understand why a prolonged interaction of RANTES with GAGs on the target cell surface is necessary for the PTK and MAPK signal-dependent enhancement of HIV-1 infectivity, as activation of MAPK by RANTES is a rapid process. One possibility is that MAPKs, activated by RANTES, can directly interact with one or more regulators of the viral life cycle. Alternatively, infectivity enhancement may be conferred by up-regulation of other cellular factors downstream of the MAPK signal. Nevertheless, the induction of MAPK activation should be considered as a potential mechanism that directly increases HIV-1 infectivity. In quiescent T cells, the early, postentry events of the viral life cycle are inefficient, so signaling, whether mediated by viral proteins or host cell factors, may help prime the cell for HIV-1 replication (20, 71). To what extent signaling-dependent and cross-linking-dependent mechanisms contribute to the enhancement effect cannot be determined in inhibitor studies, because these blocking agents can only be tested at concentrations that do not themselves interfere with HIV-1 infection (Fig. 6). It is, therefore, likely that the approximately 50% reduction in infectivity enhancement we observed in the presence of inhibitors does not reflect the full contribution of the signaling-dependent pathway to this enhancement.
Taken together, our studies suggest that RANTES, at both low, physiologically relevant concentrations and at higher, probably supraphysiological concentrations, can activate signaling pathways through an alternative receptor(s) that is GAG dependent, but which is probably not a known, specific GPCR chemokine receptor. The ensuing activation of MAPK at high RANTES concentrations can increase the efficiency of HIV-1 replication at a postentry stage of the viral life cycle. Whether such signaling events might occur in vivo, perhaps as part of an innate or inflammatory immune response, bears further investigation, in case such responses might actually promote HIV-1 infection rather than reducing it. We are presently investigating the influence these GAG-dependent signals have on the general functions of RANTES as a chemokine.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Fiona Kouyoumdjian and Frédéric Borlat for technical assistance and Timothy N. Wells for helpful discussions.
This work was funded by the Swiss National Science Foundation (grant 3100-62030.00 to A.T.), grants of the Olga Mayenfisch Stiftung and the Gebert Rüf Stiftung (to A.T.), and National Institutes of Health grant R37 AI41420 (to J.P.M.). J.P.M. is an Elizabeth Glaser Scientist of the Pediatric AIDS Foundation and a Stavros S. Niarchos Scholar. The Department of Microbiology and Immunology at the Weill Medical College gratefully acknowledges the support of the William Randolph Hearst Foundation.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Division of Infectious Diseases, Department of Medicine, University Hospital Zurich, Ramistrasse 100 E RAE 3, 8091 Zurich, Switzerland. Phone: 41-1-255-5976. Fax: 41-1-255-3291. E-mail: alexandra.trkola{at}DIM.usz.ch. 
Present address: CNS News, New York, NY 10036. 
 |
REFERENCES
|
|---|
-
Akiyama, T., J. Ishida, S. Nakagawa, H. Ogawara, S. Watanabe, N. Itoh, M. Shibuya, and Y. Fukami. 1987. Genistein, a specific inhibitor of tyrosine-specific protein kinases. J. Biol. Chem. 262:5592-5595.[Abstract/Free Full Text]
-
Alessi, D. R., A. Cuenda, P. Cohen, D. T. Dudley, and A. R. Saltiel. 1995. PD 098059 is a specific inhibitor of the activation of mitogen- activated protein kinase kinase in vitro and in vivo. J. Biol. Chem. 270:27489-27494.[Abstract/Free Full Text]
-
Amara, A., S. L. Gall, O. Schwartz, J. Salamero, M. Montes, P. Loetscher, M. Baggiolini, J. L. Virelizier, and F. Arenzana-Seisdedos. 1997. HIV coreceptor downregulation as antiviral principle: SDF-1
-dependent internalization of the chemokine receptor CXCR4 contributes to inhibition of HIV replication. J. Exp. Med. 186:139-146.[Abstract/Free Full Text]
-
Amara, A., O. Lorthioir, A. Valenzuela, A. Magerus, M. Thelen, M. Montes, J. L. Virelizier, M. Delepierre, F. Baleux, H. Lortat-Jacob, and F. Arenzana-Seisdedos. 1999. Stromal cell-derived factor-1
associates with heparan sulfates through the first beta-strand of the chemokine. J. Biol. Chem. 274:23916-23925.[Abstract/Free Full Text]
-
Appay, V., A. Brown, S. Cribbes, E. Randle, and L. G. Czaplewski. 1999. Aggregation of RANTES is responsible for its inflammatory properties. Characterization of nonaggregating, noninflammatory RANTES mutants. J. Biol. Chem. 274:27505-27512.[Abstract/Free Full Text]
-
Appay, V., P. R. Dunbar, V. Cerundolo, A. McMichael, L. Czaplewski, and S. Rowland-Jones. 2000. RANTES activates antigen-specific cytotoxic T lymphocytes in a mitogen-like manner through cell surface aggregation. Int. Immunol. 12:1173-1182.[Abstract/Free Full Text]
-
Bacon, K., B. Premack, P. Gardner, and T. Schall. 1995. Activation of dual T cell signaling pathways by the chemokine RANTES. Science 269:1727-1729.[Abstract/Free Full Text]
-
Bacon, K. B., T. J. Schall, and D. J. Dairaghi. 1998. RANTES activation of phospholipase D in Jurkat T cells: requirement of GTP-binding proteins ARF and RhoA. J. Immunol. 160:1894-1900.[Abstract/Free Full Text]
-
Bacon, K. B., M. C. Szabo, H. Yssel, J. B. Bolen, and T. J. Schall. 1996. RANTES induces tyrosine kinase activity of stably complexed p125FAK and ZAP-70 in human T cells. J. Exp. Med. 184:873-882.[Abstract/Free Full Text]
-
Bates, M. E., V. L. Green, and P. J. Bertics. 2000. ERK1 and ERK2 activation by chemotactic factors in human eosinophils is interleukin 5-dependent and contributes to leukotriene C4 biosynthesis. J. Biol. Chem. 275:10968-10975.[Abstract/Free Full Text]
-
Berger, E. A., P. M. Murphy, and J. M. Farber. 1999. Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu. Rev. Immunol. 17:657-700.[CrossRef][Medline]
-
Brill, A., R. Hershkoviz, G. G. Vaday, Y. Chowers, and O. Lider. 2001. Augmentation of RANTES-induced extracellular signal-regulated kinase mediated signaling and T cell adhesion by elastase-treated fibronectin. J. Immunol. 166:7121-7127.[Abstract/Free Full Text]
-
Broder, C. C., and R. G. Collman. 1997. Chemokine receptors and HIV. J. Leukoc. Biol. 62:20-29.[Abstract]
-
Burns, J. M., R. C. Gallo, A. L. DeVico, and G. K. Lewis. 1998. A new monoclonal antibody, mAb 4A12, identifies a role for the glycosaminoglycan (GAG) binding domain of RANTES in the antiviral effect against HIV-1 and intracellular Ca2+ signaling. J. Exp. Med. 188:1917-1927.[Abstract/Free Full Text]
-
Chen, B. K., K. Saksela, R. Andino, and D. Baltimore. 1994. Distinct modes of human immunodeficiency virus type 1 proviral latency revealed by superinfection of nonproductively infected cell lines with recombinant luciferase-encoding viruses. J. Virol. 68:654-660.[Abstract/Free Full Text]
-
Cocchi, F., A. L. DeVico, A. Garzino-Derno, S. K. Arya, R. C. Gallo, and P. Lusso. 1995. Identification of RANTES, MIP-1
and MIP-1ß as the major HIV-suppressive factors produced by CD8+ T cells. Science 270:1811-1815.[Abstract/Free Full Text]
-
Connor, R. I., K. E. Sheridan, D. Ceradini, S. Choe, and N. R. Landau. 1997. Change in coreceptor use correlates with disease progression in HIV-1-infected individuals. J. Exp. Med. 185:621-628.[Abstract/Free Full Text]
-
Czaplewski, L. G., J. McKeating, C. J. Craven, L. D. Higgins, V. Appay, A. Brown, T. Dudgeon, L. A. Howard, T. Meyers, J. Owen, S. R. Palan, P. Tan, G. Wilson, N. R. Woods, C. M. Heyworth, B. I. Lord, D. Brotherton, R. Christison, S. Craig, S. Cribbes, R. M. Edwards, S. J. Evans, R. Gilbert, P. Morgan, M. G. Hunter, et al. 1999. Identification of amino acid residues critical for aggregation of human CC chemokines macrophage inflammatory protein (MIP)-1
, MIP-1ß, and RANTES. Characterization of active disaggregated chemokine variants. J. Biol. Chem. 274:16077-16084.[Abstract/Free Full Text]
-
Dairaghi, D. J., K. S. Soo, E. R. Oldham, B. A. Premack, T. Kitamura, K. B. Bacon, and T. J. Schall. 1998. RANTES-induced T cell activation correlates with CD3 expression. J. Immunol. 160:426-433.[Abstract/Free Full Text]
-
Davis, C. B., I. Dikic, D. Unutmaz, C. M. Hill, J. Arthos, M. A. Siani, D. A. Thompson, J. Schlessinger, and D. R. Littman. 1997. Signal transduction due to HIV-1 envelope interactions with chemokine receptors CXCR4 or CCR5. J. Exp. Med. 186:1793-1798.[Abstract/Free Full Text]
-
del Pozo, M. A., P. Sanches-Matos, M. Nieto, and F. Sanchezx-Madrid. 1995. Chemokines regulate cellular polarization and adhesion receptor redistribution during lymphocyte interaction with endothelium and extracellular matrix. Involvement of cAMP signaling pathway. J. Cell Biol. 131:495-508.[Abstract/Free Full Text]
-
Dikic, I., and J. Schlessinger. 1998. Identification of a new Pyk2 isoform implicated in chemokine and antigen receptor signaling. J. Biol. Chem. 273:14301-14308.[Abstract/Free Full Text]
-
Dikic, I., G. Tokiwa, S. Lev, S. Courtneidge, and J. Schlessinger. 1996. A role of Pyk2 and Src in linking G-protein-coupled receptors with MAP kinase activation. Nature 383:547-550.[CrossRef][Medline]
-
Dolei, A., A. Biolchini, C. Serra, S. Curreli, E. Gomes, and F. Dianzani. 1998. Increased replication of T-cell-tropic HIV strains and CXC-chemokine receptor-4 induction in T cells treated with macrophage inflammatory protein (MIP)-1
, MIP-1ß and RANTES ß-chemokines. AIDS 12:183-190.[CrossRef][Medline]
-
Doms, R. W., and J. P. Moore. 1997. HIV-1 coreceptor use: a molecular window into viral tropism, p. 1-12. In B. T. M. Korber et al. (ed.), HIV molecular immunology database. Los Alamos National Laboratory Theoretical Biology and Biophysics, Los Alamos, N.Mex.
-
Esko, J. D. 1989. Replica plating of animal cells. Methods Cell Biol. 32:387-422.[Medline]
-
Esko, J. D., T. E. Stewart, and W. H. Taylor. 1985. Animal cell mutants defective in glycosaminoglycan biosynthesis. Proc. Natl. Acad. Sci. USA 82:3197-3201.[Abstract/Free Full Text]
-
Fox, T., J. T. Coll, X. Xie, P. J. Ford, U. A. Germann, M. D. Porter, S. Pazhanisamy, M. A. Fleming, V. Galullo, M. S. Su, and K. P. Wilson. 1998. A single amino acid substitution makes ERK2 susceptible to pyridinyl imidazole inhibitors of p38 MAP kinase. Protein Sci. 7:2249-2255.[Abstract]
-
Gallay, P., S. Swingler, J. Song, F. Bushman, and D. Trono. 1995. HIV nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase. Cell 83:569-576.[CrossRef][Medline]
-
Garrington, T. P., and G. L. Johnson. 1999. Organization and regulation of mitogen-activated protein kinase signaling pathways. Curr. Opin. Cell Biol. 11:211-218.[CrossRef][Medline]
-
Gordon, C. J., M. A. Muesing, A. E. Proudfoot, C. A. Power, J. P. Moore, and A. Trkola. 1999. Enhancement of human immunodeficiency virus type 1 infection by the CC-chemokine RANTES is independent of the mechanism of virus-cell fusion. J. Virol. 73:684-694.[Abstract/Free Full Text]
-
Hoogewerf, A. J., G. S. Kuschert, A. E. Proudfoot, F. Borlat, I. Clark-Lewis, C. A. Power, and T. N. Wells. 1997. Glycosaminoglycans mediate cell surface oligomerization of chemokines. Biochemistry 36:13570-13578.[CrossRef][Medline]
-
Jackson, R. L., S. J. Busch, and A. D. Cardin. 1991. Glycosaminoglycans: molecular properties, protein interactions, and role in physiological processes. Physiol. Rev. 71:481-539.[Free Full Text]
-
Jacque, J. M., A. Mann, H. Enslen, N. Sharova, B. Brichacek, R. J. Davis, and M. Stevenson. 1998. Modulation of HIV-1 infectivity by MAPK, a virion-associated kinase. EMBO J. 17:2607-2618.[CrossRef][Medline]
-
Kakkanaiah, V. N., E. A. Ojo-Amaize, and J. B. Peter. 1998. Concentrations of circulating beta-chemokines do not correlate with viral load in human immunodeficiency virus-infected individuals. Clin. Diagn. Lab. Immunol. 5:499-502.[Abstract/Free Full Text]
-
Kefalas, P., T. R. Brown, and P. M. Brickell. 1995. Signalling by the p60c-src family of protein-tyrosine kinases. Int. J. Biochem. Cell Biol. 27:551-563.[CrossRef][Medline]
-
Kinter, A., A. Catanzaro, J. Monaco, M. Ruiz, J. Justement, S. Moir, J. Arthos, A. Oliva, L. Ehler, S. Mizell, R. Jackson, M. Ostrowski, J. Hoxie, R. Offord, and A. S. Fauci. 1998. CC-chemokines enhance the replication of T-tropic strains of HIV-1 in CD4+ T cells: role of signal transduction. Proc. Natl. Acad. Sci. USA 95:11880-11885.[Abstract/Free Full Text]
-
Koopman, W., and M. Krangel. 1997. Identification of a glycosaminoglycan-binding site in chemokine macrophage inflammatory protein 1
. J. Biol. Chem. 272:10103-10109.[Abstract/Free Full Text]
-
Krowka, J. F., M. L. Gesner, M. S. Ascher, and H. W. Sheppard. 1997. Lack of associations of chemotactic cytokines with viral burden, disease progression, or lymphocyte subsets in HIV-infected individuals. Clin. Immunol. Immunopathol. 85:21-27.[CrossRef][Medline]
-
Kuschert, G. S., F. Coulin, C. A. Power, A. E. Proudfoot, R. E. Hubbard, A. J. Hoogewerf, and T. N. Wells. 1999. Glycosaminoglycans interact selectively with chemokines and modulate receptor binding and cellular responses. Biochemistry 38:12959-12968.[CrossRef][Medline]
-
Kuschert, G., A. Hoogewerf, A. Proudfoot, C. Chung, R. Cooke, R. Hubbard, T. Wells, and P. Sanderson. 1998. Identification of a glycosaminoglycan binding surface on human interleukin-8. Biochemistry 37:11193-11201.[CrossRef][Medline]
-
Li, H., and W. S. Wong. 2001. Pertussis toxin activates tyrosine kinase signaling cascade in myelomonocytic cells: a mechanism for cell adhesion. Biochem. Biophys. Res. Commun. 283:1077-1082.[CrossRef][Medline]
-
Li, X., D. Hunter, J. Morris, J. S. Haskill, and H. S. Earp. 1998. A calcium-dependent tyrosine kinase splice variant in human monocytes. Activation by a two-stage process involving adherence and a subsequent intracellular signal. J. Biol. Chem. 273:9361-9364.[Abstract/Free Full Text]
-
Lidholt, K., J. L. Weinke, C. S. Kiser, F. N. Lugemwa, K. J. Bame, S. Cheifetz, J. Massague, U. Lindahl, and J. D. Esko. 1992. A single mutation affects both N-acetylglucosaminyltransferase and glucuronosyltransferase activities in a Chinese hamster ovary cell mutant defective in heparan sulfate biosynthesis. Proc. Natl. Acad. Sci. USA 89:2267-2271.[Abstract/Free Full Text]
-
Luttrell, L. M., Y. Daaka, and R. J. Lefkowitz. 1999. Regulation of tyrosine kinase cascades by G-protein-coupled receptors. Curr. Opin. Cell Biol. 11:177-183.[CrossRef][Medline]
-
Ma, Y. C., J. Huang, S. Ali, W. Lowry, and X. Y. Huang. 2000. Src tyrosine kinase is a novel direct effector of G proteins. Cell 102:635-646.[CrossRef][Medline]
-
Marshall, C. J. 1995. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80:179-185.[CrossRef][Medline]
-
McDermott, D. H., M. J. Beecroft, C. A. Kleeberger, F. M. Al-Sharif, W. E. R. Ollier, P. E. Zimmerman, B. A. Boatin, S. F. Leitman, R. Detels, A. H. Hajeer, and P. M. Murphy. 2000. Chemokine RANTES promotor polymorphism affects risk of both HIV infection and disease progression in the Multicenter AIDS Cohort Study. AIDS 14:2671-2678.[CrossRef][Medline]
-
McKenzie, S. W., G. Dallalio, M. North, P. Frame, and R. T. Means, Jr. 1996. Serum chemokine levels in patients with non-progressing HIV infection. AIDS 10:29-33.
-
Mellado, M., J. M. Rodriguez-Frade, S. Manes, and A. Martinez. 2001. Chemokine signaling and functional responses: the role of receptor dimerization and TK pathway activation. Annu. Rev. Immunol. 19:397-421.[CrossRef][Medline]
-
Moore, J. P., A. Trkola, and T. Dragic. 1997. Co-receptors for HIV-1 entry. Curr. Opin. Immunol. 9:551-562.[CrossRef][Medline]
-
Moriuchi, H., M. Moriuchi, and A. S. Fauci. 1998. Factors secreted by human T lymphotropic virus type I (HTLV-I)-infected cells can enhance or inhibit replication of HIV-1 in HTLV-I-uninfected cells: implications for in vivo coinfection with HTLV-I and HIV-1. J. Exp. Med. 187:1689-1697.[Abstract/Free Full Text]
-
Muller, P., M. Engelstadter, A. Werner, J. Braner, S. Staszewski, V. Miller, H. W. Doerr, R. Kurth, and K. Cichutek. 1997. Increased serum and mRNA levels of RANTES associated with elevated levels of activated CD8+CD38+ T cells in HIV-1 infected individuals. Intervirology 40:263-270.[Medline]
-
Neote, K., J. Y. Mak, L. F. Kolakowski, Jr., and T. J. Schall. 1994. Functional and biochemical analysis of the cloned Duffy antigen: identity with the red blood cell chemokine receptor. Blood 84:44-52.[Abstract/Free Full Text]
-
Nibbs, R. J. B., S. M. Wylie, I. B. Pragnell, and G. J. Graham. 1997. Cloning and characterization of a novel murine beta chemokine receptor, D6. Comparison to three other related macrophage inflammatory protein-1
receptors, CCR-1, CCR-3, and CCR-5. J. Biol. Chem. 272:12495-12504.[Abstract/Free Full Text]
-
Proudfoot, A. E., S. Fritchley, F. Borlat, J. P. Shaw, F. Vilbois, C. Zwahlen, A. Trkola, D. Marchant, P. R. Clapham, and T. N. Wells. 2001. The BBXB motif of RANTES is the principal site for heparin binding and controls receptor selectivity. J. Biol. Chem. 276:10620-10626.[Abstract/Free Full Text]
-
Proudfoot, A. E., C. A. Power, A. Hoogewerf, M. O. Montjovent, F. Borlat, and T. N. Wells. 1995. Characterisation of the RANTES/MIP-1
receptor (CC CKR-1) stably transfected in HEK 293 cells and the recombinant ligands. FEBS Lett. 376:19-23.[CrossRef][Medline]
-
Rodriguez-Frade, J. M., A. J. Vila-Coro, A. M. de Ana, J. P. Albar, A. Martinez, and M. Mellado. 1999. The chemokine monocyte chemoattractant protein-1 induces functional responses through dimerization of its receptor CCR2. Proc. Natl. Acad. Sci. USA 96:3628-3633.[Abstract/Free Full Text]
-
Schaller, M. D., and J. T. Parsons. 1994. Focal adhesion kinase and associated proteins. Curr. Opin. Cell Biol. 6:705-710.[CrossRef][Medline]
-
Schmidtmayerova, H., B. Sherry, and M. Bukrinsky. 1996. Chemokines and HIV replication. Nature 382:767.[CrossRef][Medline]
-
Serrador, J. M., J. L. Alonso-Lebrero, M. A. del Pozo, H. Furthmayr, R. Schwartz-Albiez, J. Calvo, F. Lozano, and F. Sanchez-Madrid. 1997. Moesin interacts with the cytoplasmic region of intercellular adhesion molecule-3 and is redistributed to the uropod of T lymphocytes during cell polarization. J. Cell Biol. 138:1409-1423.[Abstract/Free Full Text]
-
Sturgill, T. W., L. B. Ray, E. Erikson, and J. L. Maller. 1988. Insulin-stimulated MAP-2 kinase phosphorylates and activates ribosomal protein S6 kinase II. Nature 334:715-718.[CrossRef][Medline]
-
Szabo, M. C., E. C. Butcher, B. W. McIntyre, T. J. Schall, and K. B. Bacon. 1997. RANTES stimulation of T lymphocyte adhesion and activation: role for LFA-1 and ICAM-3. Eur. J. Immunol. 27:1061-1068.[Medline]
-
Taylor, M. V., J. C. Metcalfe, T. R. Hesketh, G. A. Smith, and J. P. Moore. 1984. Mitogens increase phosphorylation of phosphoinositides in thymocytes. Nature 312:462-465.[CrossRef][Medline]
-
Thomas, S. M., and J. S. Brugge. 1997. Cellular functions regulated by Src family kinases. Annu. Rev. Cell Dev. Biol. 13:513-609.[CrossRef][Medline]
-
Tilton, B., L. Ho, E. Oberlin, P. Loetscher, F. Baleux, I. Clark-Lewis, and M. Thelen. 2000. Signal transduction by CXC chemokine receptor 4. Stromal cell-derived factor 1 stimulates prolonged protein kinase B and extracellular signal-regulated kinase 2 activation in T lymphocytes. J. Exp. Med. 192:313-324.[Abstract/Free Full Text]
-
Trkola, A., T. Dragic, J. Arthos, J. Binley, W. Olson, G. Allaway, C. Cheng-Mayer, J. Robinson, P. Maddon, and J. Moore. 1996. CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR-5. Nature 384:184-187.[CrossRef][Medline]
-
Trkola, A., C. Gordon, J. Matthews, E. Maxwell, T. Ketas, L. Czaplewski, A. E. Proudfoot, and J. P. Moore. 1999. The CC-chemokine RANTES increases the attachment of human immunodeficiency virus type 1 to target cells via glycosaminoglycans and also activates a signal transduction pathway that enhances viral infectivity. J. Virol. 73:6370-6379.[Abstract/Free Full Text]
-
Trkola, A., W. A. Paxton, S. P. Monard, J. A. Hoxie, M. A. Siani, D. A. Thompson, L. Wu, C. R. Mackay, R. Horuk, and J. P. Moore. 1998. Genetic subtype-independent inhibition of human immunodeficiency virus type 1 replication by CC and CXC chemokines. J. Virol. 72:396-404.[Abstract/Free Full Text]
-
Turner, L., S. G. Ward, and J. Westwick. 1995. RANTES-activated human T lymphocytes. A role for phosphoinositide 3-kinase. J. Immunol. 155:2437-2444.[Abstract]
-
Unutmaz, D., V. N. Kewal Ramani, S. Marmon, and D. R. Littman. 1999. Cytokine signals are sufficient for HIV-1 infection of resting human T lymphocytes. J. Exp. Med. 189:1735-1746.[Abstract/Free Full Text]
-
Ward, S. G., K. Bacon, and J. Westwick. 1998. Chemokines and T lymphocytes: more than an attraction. Immunity 9:1-11.[CrossRef][Medline]
-
Wu, L., N. Gerard, R. Wyatt, H. Choe, C. Parolin, N. Ruffing, A. Borsetti, A. Cardoso, E. Desjardin, W. Newman, C. Gerard, and J. Sodroski. 1996. CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5. Nature 384:179-183.[CrossRef][Medline]
-
Yang, X., Y. Chen, and D. Gabuzda. 1999. ERK MAP kinase links cytokine signals to activation of latent HIV-1 infection by stimulating a coope