Previous Article | Next Article ![]()
Journal of Virology, December 2002, p. 12646-12653, Vol. 76, No. 24
0022-538X/02/$04.00+0 DOI: 10.1128/JVI.76.24.12646-12653.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Jorge L. Martínez-Torrecuadrada,2,
Fernando Roncal,1 Elvira Domínguez,1 and Juan Antonio García1*
Centro Nacional de Biotecnología (C.S.I.C.), Campus de la Universidad Autónoma de Madrid, 28049 Madrid,1 Ingenasa, 28037 Madrid, Spain2
Received 5 July 2002/ Accepted 13 September 2002
|
|
|---|
, turned the derived chimeras into efficient immunogens. Vectors expressing foreign peptides at different positions within a highly immunogenic region (amino acids 43 to 52) in the N-terminal domain of CP were the most effective at inducing specific antibody responses against the foreign sequence. |
|
|---|
Characterization of the antigenic determinants of pathogens has led to the concept of peptide vaccines. It has been reported that the immunogenicity of these peptides is increased by the use of epitope-presentation systems (10, 14). Engineering virus coat proteins to function as carrier molecules for immunogenic peptides has been one of the approaches exploited (18). These carrier proteins have the potential to assemble and form recombinant virus particles displaying the desired epitopes on their surfaces. Both filamentous and icosahedral plant viruses have been successfully developed as epitope presentation systems (13, 14, 20, 21, 30, 38, 40, 42, 43) and in some cases as an alternative to previous tissue culture-derived vaccines (9, 25).
Plum pox virus (PPV) belongs to the Potyvirus genus of plant viruses. The potyvirus genome consists of a single-stranded messenger polarity RNA molecule of about 10 kb, with a VPg protein at its 5' end and a poly(A) tail at its 3' end (Fig. 1). This genome is translated into a large polyprotein that is further processed by three virus-encoded proteases (32, 33, 41). The genome is encapsidated by
2,000 U of a single type of capsid protein (CP), encoded at the 3' end of the genome (37).
![]() View larger version (23K): [in a new window] |
FIG. 1. (A) Genome organization of PPV, with the viral open reading frame depicted as a box divided into the different viral products. (B) Schematic representation of PPV CP, showing its different domains. The gray boxes represent the N-terminal and C-terminal domains, and the white box represents the well-conserved core region. A black box indicates the localization of the DAG triad involved in aphid transmission. (C) Detailed representation of the N-terminal domain of PPV CP. The insertion points of the PPV- , - , - , -i1, -i2, -g1, -g2, -g3, and -g4 antigen presentation vectors are indicated by arrowheads. The region deleted in NAT mutants is also indicated.
|
Although promising results have been obtained with a PPV-derived antigen presentation vector, PPV-NATMluI (13), expressing different forms of a 15-aa peptide from the N terminus of the canine parvovirus (CPV) VP2 protein, this vector showed some restriction for the expression of other foreign peptides. Therefore, optimization studies were carried out to determine other appropriate insertion sites in the surface of PPV CP. A first generation of alternative PPV-derived vectors, with different insertion points within the CP N-terminal domain, was developed. Although these vectors were somehow tolerant to insertion of foreign sequences and chimeras derived from them were efficient as antigens, they failed to be good immunogens for evoking a specific response against foreign peptides. A second approach was based on the knowledge acquired from PEPSCAN analysis of PPV CP, particularly of its N-terminal domain. These data helped us to design novel vectors that rendered chimeras efficient at developing specific immune responses against foreign peptides.
|
|
|---|
Binding of specific antibodies to membrane-linked peptides. Specific binding of PPV polyclonal antibodies (13) to membrane-bound PPV CP peptides was tested following the protocol described by R. Frank (15). All reactions were performed in 20 mM Tris (pH 7.5)-0.5 M NaCl. Membranes previously blocked with SuperBlock (Pierce) were incubated for at least 4 h at room temperature with different dilutions of the primary antibodies, depending on their affinities. Secondary antibodies conjugated to alkaline phosphatase were used in 1:10,000 dilutions. A commercial substrate for detection of the alkaline phosphatase enzymatic activity (Bio-Rad) was used. The high stability of the peptide linkages allowed us to reuse the membrane after stripping off all adsorbed material by subsequent treatments with dimethylformamide, 8 M urea, 1% sodium dodecyl sulfate, and 0.1% ß-mercaptoethanol.
Construction of PPV-derived vectors.
Plasmid vectors pGPPV-
, pGPPV-
, and pGPPV-
were constructed according to the following strategy. Mutations that introduced the MluI restriction enzyme recognition sequence at particular positions were performed by PCR-based mutagenesis (19). The mutagenic oligodeoxynucleotides (oligos) used were m
(5'TCTTTCGTCACGCGTAGCTTG GTGC 3'), m
(5'AGTTTGCAGACGCGTTTGAGGTCC 3'), and m
(5'GTTGACTAGACGCGTCGCGTTTGAG 3') (the MluI recognition sequence is shown in bold). Two flanking oligos from nucleotides (nt) 8067 to 8082 and the reverse one from nt 9114 to 9127 of PPV (23) were also used for the PCR amplifications. The ClaI-SacI fragments from the PCR-amplified products holding the respective mutations were introduced in the plasmid pGPPV (containing a PPV full-length cDNA under the control of a phage T7 promoter) (34) by triple ligation using SalI as the third enzyme.
A similar strategy was followed to construct the plasmid vectors pICPPV-g1, pICPPV-g2, pICPPV-g3, pICPPV-g4, pICPPV-i1, and pICPPV-i2. The mutagenic oligos used for the PCR-based mutagenesis were g1 (5'GCAGTTGAGGACGCGTTCCTGACACC 3'), g2 (5' GTTTGCAGTTGACGCGTAGGTCCTGAC 3'), g3 (5' CAAAAGTTTGACGCGTCAGTTGAGG 3'), g4 (5' GTTCCAAAAGTACGCGTTTGCAGTTG 3'), i1 (5' GAAAATGGGGTTACGCGTGAGCATTGACG 3'), and i2 (5' GTTGCTGGCGTACGCGTGAAAATGGG 3'). The flanking oligos were the same as those described above. The mutated PCR fragments, digested with ClaI and SacI, were introduced in the plasmid pICPPV (containing a PPV full-length cDNA clone under the control of cauliflower mosaic virus 35S promoter) (28) by triple ligation using SalI as the third enzyme.
The accuracy of the sequences derived from PCR amplification was verified by DNA sequencing.
Insertion of foreign sequences in PPV-derived vectors. The sequence encoding the 6L15 peptide of the canine parvovirus (CPV) (8) was created by hybridizing complementary oligos CPV-1, 5' CGCGTGCAGTTCAACCAGACGGTGGTCAACCTGCTGTCAGAAATGAACGCG 3' (forward), and CPV-2, 5' CGCGCGCGTTCATTTCTGACAGCAGGTTGACCACCGTCTGGTTGAACTGCA 3', (reverse). The sequence coding for a peptide of the envelope protein of feline immunodeficiency virus (FIV) (6) was created by hybridizing complementary oligos FIV-1, 5' CGCGTGGTTGCAATCAAAACCAGTTCTTCTGCAAAG 3' (forward), and FIV-2, from 5' CGCGCTTTGCAGAAGAACTGGTTTTGATTGCAACCA 3' (reverse). These pairs of oligos created MluI-compatible overhangs. The hybridization was carried out by incubating 1.5 µg of each oligo in a buffer containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 1 mM EDTA at 90°C for 5 min and then cooling the mixture down slowly to room temperature.
The hybridized oligos were cloned directly in the MluI sites of the different pICPPV-derived vectors. For cloning in pGPPV-
, pGPPV-
, and pGPPV-
, the hybridized oligos were inserted in pUC18-derived intermediate plasmids that contained PPV BamHI-SacI fragments holding the
,
, and
mutations. Then, the BamHI-SacI fragments of the resulting plasmids were introduced in pGPPV.
In vitro transcription and plant inoculation. Capped transcripts from full-length cDNA clones derived from pGPPV were synthesized with the T7 Cap Scribe transcription kit (Roche Molecular Biochemicals), following the manufacturer's instructions. Twenty microliters of reaction mixture diluted 1:1 in 5 mM sodium phosphate (pH 7.5) were used to inoculate, by manual rubbing, eight Nicotiana clevelandii plants dusted with carborundum (three leaves per plant).
DNA from pICPPV-derived clones was directly used for mechanical inoculation (28). The plasmid DNA was diluted in 5 mM sodium phosphate (pH 7.5) to a concentration of between 100 and 500 ng/µl. Three leaves per N. clevelandii plant dusted with carborundum were inoculated with 10 µl of the diluted samples.
Viruses were propagated in N. clevelandii plants and were purified according to Laín et al. (24).
Western blot analysis. Samples from infected plants homogenized in 5 mM sodium phosphate (pH 7.5) (2 ml/g) or from purified virions diluted in the same buffer were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to a nitrocellulose membrane, and subjected to immunoreactions as described previously (17). A rabbit anti-PPV polyclonal antibody or a commercial mixture of anti-PPV monoclonal antibodies (MAbs) (Ingenasa, Madrid, Spain) was used for the detection of PPV capsid protein. An anti-CPV polyclonal antibody and the anti-CPV VP2 monoclonal antibody 3C9 (26) were used for detection of the VP2 peptide. Peroxidase-conjugated goat anti-mouse or anti-rabbit immunoglobulins G (IgG) purchased from Jackson ImmunoResearch Laboratories were used as secondary antibodies. The peroxidase reaction was developed either with the ECL kit (Amersham Pharmacia Biotech) or with 4-chloro-1-naphthol (Sigma).
Immunocapture-RT-PCR (IC-PCR). Samples from infected plants homogenized in 5 mM sodium phosphate (pH 7.5) or purified virions diluted in the same buffer were incubated for 2 h at 37°C in tubes previously coated with anti-PPV IgG, and then, after two washing steps with phosphate-buffered saline (PBS)-Tween buffer (1x PBS, 0.5 g of Tween 20 per liter), reverse transcription (RT)-PCR was performed either as previously described (7) or by using the Titan one-tube RT-PCR system (Roche Molecular Biochemicals) according to the manufacturer's instructions.
Immunization of mice. Groups of four 3-week-old BALB/c mice received three injections of 10 µg of protein (purified virions) per mouse intraperitoneally at days 0, 30, and 45. The samples were emulsified in complete Freund's adjuvant for the first inoculation and in incomplete Freund's adjuvant for the boosters. Immunized mice were bled before immunization and on day 60, and the sera were pooled for serological characterization.
ELISAs.
To detect the presence of specific antibodies against FIV in the sera of cats, enzyme-linked immunosorbent assay (ELISA) plates (Nunc) were coated with 100 ng of PPV-
-FIV purified virions diluted in sodium carbonate buffer (50 mM; pH 9.6) overnight at 4°C. Then, they were subsequently incubated for 30 min at 25°C with different dilutions of cat sera in PBS-Tween-350 mM NaCl-1% powdered skim milk and with anti-cat IgGs conjugated with peroxidase (Sigma) diluted 1:20,000 in the same buffer. Washes were performed with PBS-Tween. Peroxidase activity was detected by adding 3,3',5,5',tetramethylbenzidine as a substrate and stopped with sulfuric acid. The optical densities of samples were determined at 405 nm.
To analyze the antibody response in animals immunized with PPV/CPV chimeras, indirect ELISAs were performed according to the protocol described in reference 13.
In vitro neutralization assays. To determine the ability of the specific mouse sera to neutralize CPV in vitro, a CRFK cell monolayer-protection assay was performed as described previously (26).
|
|
|---|
, PPV-
, and PPV-
and of chimeras derived from them.
Initially, three vectors were designed to express foreign sequences as insertions in three different points within the N-terminal domain of PPV CP. The clones pGPPV-
, pGPPV-
, and pGPPV-
have insertions of 6 nt that constitute the recognition sequence of MluI restriction enzyme. This means that mutants PPV-
, PPV-
, and PPV-
have insertions of two amino acids (threonine and arginine) in the corresponding positions within CP (Fig. 1). PPV-
holds the insertion point just after the first CP amino acid, which is known to be important for the cleavage event that splits off CP from the viral polyprotein. PPV-
bears the insertion site between aa 68 and 69. We assumed that this place could be surface exposed because it resides near a site recognized by cellular proteases (24). Finally, the insertion place of PPV-
lies between aa 87 and 88, very close to the beginning of the PPV CP conserved core domain (36). A point mutation, which gives rise to a serine-to-proline change at position 85 of the CP, was accidentally introduced during the construction of pGPPV-
.
PPV-
, PPV-
, and PPV-
were able to establish a systemic infection in N. clevelandii plants. The time course of infection and symptomatology of PPV-
and PPV-
were similar to those of wild-type-PPV. Symptoms of PPV-
were mild and appeared with a delay of 6 to 7 days compared to wild-type virus. In addition, systemic accumulation of PPV-
was quite low (data not shown). For these reasons PPV-
was discarded as a candidate for peptide expression.
As a first attempt to test the capability of PPV-
and PPV-
as antigen presentation vectors, the 6L15 peptide from the N-terminal domain of VP2 protein of CPV was inserted in them. This peptide had previously shown its ability to induce neutralizing antibodies against CPV (8) and had been expressed in former PPV-derived chimeras (13). Capped transcripts synthesized from chimeric clones pGPPV-
-CPV and pGPPV-
-CPV were inoculated onto N. clevelandii plants. Both chimeras were able to infect the plants. The time course of infection and symptomatology were similar to those of wild-type-infected plants. Chimeric particles were good antigens, as they could be detected by a polyclonal antibody against CPV in Western blot assays and ELISA (data not shown). The stability of the mutated sequence in the progeny virus was corroborated by nucleotide sequencing of appropriate IC-PCR-amplified DNA fragments.
To further explore the usefulness of chimeras derived from these vectors as a source of antigen reagents, we decided to express a 10-aa peptide from a transmembrane protein of FIV in the PPV-
vector. Different sequences including this peptide have failed to be expressed in PPV-NATMluI vector (M. R. Fernández-Fernández and J. A. García, unpublished results). There is great interest in the expression of this peptide in heterologous systems for diagnosis, as it contains an epitope that is universally recognized by the sera of FIV-infected cats (6). PPV-
-FIV was infectious, and as is the case for PPV-
-CPV, its infection resembled the wild-type one.
Wells of ELISA plates were coated with virions purified from PPV-
-FIV-infected plants, and sera from FIV-infected and -noninfected animals were used to test the viability of the diagnosis system. Figure 2 shows that the PPV-
-FIV chimera allows clear-cut discrimination between seronegative and seropositive animals even at a 1/200 serum dilution.
![]() View larger version (33K): [in a new window] |
FIG. 2. Detection of FIV-specific antibodies in cat sera. An indirect ELISA was performed by coating the plates with PPV- -FIV purified virions (100 ng per well). Two different dilutions of sera were tested, 1/100 (black bars) and 1/200 (white bars). Dotted lines represent saturation of that sample measurement.
|
and
sites, mice were immunized with PPV-
-CPV and PPV-
-CPV purified virions. No specific anti-CPV antibodies were detected in the immunized animals, despite their developing a strong antibody response against PPV (Table 1 and data not shown). |
View this table: [in a new window] |
TABLE 1. Antibody response to chimeric PPV particles in mice
|
Overlapping peptides covering the full-length PPV CP sequence were synthesized as spots in a cellulose membrane. Sera from rabbits and mice immunized with purified wild-type PPV or chimeric PPV (PPV-CPV and PPV-2CPV) virions were tested for binding to the immobilized peptides. A schematic representation of the amino acids recognized by the different antibodies is shown in Fig. 3. The results confirm that the region of preferential recognition by the sera is the N-terminal domain, although there were also other sequences highly immunogenic in the C-terminal domain, as well as in the central domain, which had usually been considered a nonexposed region (36). As we presumed, the N-terminal domain appeared not to be uniformly immunogenic. Within this region, stretches of preferential recognition alternated with others that were not recognized at all.
![]() View larger version (41K): [in a new window] |
FIG. 3. Reactivity of different sera tested against overlapping PPV CP peptides immobilized in a cellulose membrane. Bars show amino acids that reacted with the serum in at least two consecutive peptides. Black, rabbit 73 immunized with four doses of 200 µg of PPV; dark gray, rabbit 271 immunized with two doses of 50 µg of PPV; gray, rabbit 353 immunized with two doses of 500 µg of PPV; light gray, rabbit 347 immunized with two doses of 500 µg of PPV-CPV chimera (13); white, rabbit 349 immunized with two doses of 500 µg of the chimera PPV-2CPV (13); , group of mice immunized with two doses of 50 µg of PPV; , group of mice immunized with two doses of 5 µg of PPV; , group of mice immunized with two doses of 5 µg of PPV-CPV chimera. All rabbit sera were used at a 1:500 dilution, and the mice sera were used at a 1:1,000 dilution. Sera from animals immunized with PPV-CPV chimeras recognize peptides with CPV sequences that are present in the chimera in positions equivalent to those flanked by asterisks. The serum from a rabbit immunized with a PPV-CPV chimera recognized PPV sequences (flanked by black dots) that are not present in the chimera sequence. The serum from a rabbit immunized with wild-type PPV recognized peptides with CPV sequences (represented by flanking white dots). The 15-aa sequence that is deleted in NAT mutants is boxed. Amino acids forming PRS are signaled by asterisks. The white arrow signals the limit between the N- and C-terminal domains (in italics) and the core domain of the CP sequence. Black arrows show the insertion sites of different PPV antigen presentation vectors.
|
|
View this table: [in a new window] |
TABLE 2. Identification of preferential immunogenic regions in the PPV CP sequencea
|
site, and characterization of chimeras derived from them.
Given the null immunogenicity of PPV-
-CPV and the existence in the neighborhood of the
site (aa 68 to 69) of sequences recognized by anti-PPV sera in the PEPSCAN analysis, it was tempting to speculate that slight displacements of the insertion point from the
site could improve the capability of derived chimeras to induce an efficient B-cell response. Four different mutant clones, pICPPV-g1, -g2, -g3, and -g4, were constructed. These clones have insertions of 6 nt that represent MluI restriction sites between sequences coding for aa 66 to 67 (g1), 67 to 68 (g2), 69 to 70 (g3), and 70 to 71 (g4) of PPV CP (Fig. 1). After direct mechanical inoculation with DNA of these plasmids, systemic infections were established in N. clevelandii plants with time courses and symptomatologies similar to those of wild-type PPV infections. The sequence encoding the CPV 6L15 peptide was cloned in the MluI sites of these vectors. Inoculation of N. clevelandii plants with DNA from the resulting plasmids, pICPPV-g1-CPV, g2-CPV, g3-CPV, and g4-CPV, caused infections indistinguishable from that caused by wild-type PPV.
As expected, Western blot analysis with antibodies against PPV showed that chimeric capsids had a slightly reduced electrophoretic mobility regarding wild-type CP due to the insertion they hold (Fig. 4A). Chimeric capsids were specifically recognized by antibodies against CPV peptide, while wild-type PPV capsids were not (Fig. 4A). The DNA fragments amplified by IC-PCR corresponding to the CP N-terminal domain of the chimeras showed the expected increased size compared to the wild-type one, suggesting that no deletions were taking place in the sequence inserted in the chimeric viruses (Fig. 4B). This conclusion was confirmed by nucleotide sequencing of the IC-PCR-amplified products.
![]() View larger version (32K): [in a new window] |
FIG. 4. Characterization of chimeric PPV of the g series. (A) Western blot analysis with the anti-PPV mixture of monoclonal antibodies Ingezym (Ingenasa) (lanes 1 to 6) and anti-CPV MAb 3C9 (lanes 7 to 12) of plants infected with PPV-g1-CPV (lanes 1 and 7), PPV-g2-CPV (lanes 2 and 8), PPV- -CPV (lanes 3 and 9), PPV-g3-CPV (lanes 4 and 10), PPV-g4-CPV (lanes 5 and 11), and wild-type PPV (lanes 6 and 12). Prestained molecular weight markers (Bio-Rad) were run in lanes M. (B) IC-PCR products (nt 8390 to 8900 of the PPV genome [23]) amplified from a healthy plant (lane 1) and from plants infected with PPV-g1-CPV (lane 3), PPV-g2-CPV (lane 4), PPV- -CPV (lane 5), PPV-g3-CPV (lane 6), PPV-g4-CPV (lane 7), and wild-type PPV (lane 8). HindIII restriction fragments of phage 29 DNA were used as size markers (lane 2).
|
region (PPV-g1-CPV, g2-CPV, g3-CPV, and g4-CPV). As negative controls, mice were inoculated with wild-type PPV and with PPV-
-CPV virions.
The anti-PPV, anti-CPV peptide, and anti-VP2 ELISA titers of the sera of the immunized mice are shown in Table 1. All chimeric viruses, as well as wild-type PPV, developed high antibody titers against PPV, indicating an efficient immunization of the animals. The mice immunized with the four new chimeras, but not those immunized with PPV-
-CPV or wild-type PPV, were able to develop an efficient CPV-specific antibody response. Antibody titers were quite similar for all chimeras, with the best results being obtained for mice immunized with PPV-g4-CPV.
The neutralizing titers were in partial agreement with the ELISA results. The four PPV-gx-CPV chimeras induced detectable levels of CPV-neutralizing antibodies (Table 1). Interestingly, mice immunized with PPV-g2-CPV, which had a lower antibody response than those immunized with PPV-g4-CPV, showed a slightly more efficient neutralizing activity.
Characterization of vectors expressing foreign peptides within the highly immunogenic region spanning aa 43 to 52 of PPV CP. We were interested in addressing whether the highly immunogenic region spanning aa 43 to 52 of PPV CP was tolerant to modifications and whether chimeras derived from insertions in that region could be competent as immunogens. Two clones, pICPPV-i1 and pICPPV-i2, which hold insertions of 6 nt that represent MluI restriction sites between sequences coding for aa 45 to 46 and 49 to 50 of PPV CP, respectively (Fig. 1), were constructed. PPV-i1 and PPV-i2 were able to establish systemic infections in N. clevelandii plants with time courses and symptomatologies similar to those of wild-type infections. Chimeras expressing the 6L15 CPV peptidic sequence in these two vectors, PPV-i1-CPV and PPV-i2-CPV, were constructed. These chimeras were viable and caused infections of N. clevelandii plants also similar to wild-type infections.
Western blot analysis showed that PPV-i1-CPV and PPV-i2-CPV CPs had a slightly reduced mobility compared to that of wild-type CP due to the insertion they hold (Fig. 5). A specific polyclonal antibody against CPV recognized chimeric capsids (Fig. 5). Nucleotide sequencing of IC-PCR-amplified viral cDNA confirmed the stable retention of the foreign inserts in the chimeric viruses (not shown).
![]() View larger version (39K): [in a new window] |
FIG. 5. Characterization of chimeric PPV-i1-CPV and PPV-i2-CPV. Western blot analysis with an anti-PPV polyclonal antibody (lanes 1 to 3) and an anti-CPV polyclonal antibody (lanes 4 to 6) of samples from purified wild-type PPV (lanes 1 and 4), PPV-i1-CPV (lanes 2 and 5) and PPV-i2-CPV (lanes 3 and 6) virions. The sizes (in kilodaltons) of prestained molecular weight markers (Bio-Rad) run in the same gel are indicated beside the panel.
|
|
View this table: [in a new window] |
TABLE 3. Antibody response to chimeric PPV particles in mice
|
|
|
|---|
We started to search for new appropriate cloning sites within the N-terminal region of PPV CP not only in order to overcome the cloning restrictions of the NAT site, but also in an attempt to make available several insertion sites to allow us to develop multivalent antigen presentation systems. The first three new PPV-based vectors that we designed, PPV-
, PPV-
, and PPV-
, were not fully satisfactory. PPV-
itself had infectivity restrictions that prevented it from being a good expression vector.
and
sites appeared to be more tolerant to insertions than the NAT site, and chimeras derived from PPV-
and PPV-
proved to be good antigens that could be useful for diagnostic purposes as shown for PPV-
-FIV (Fig. 2). However, chimeras PPV-
-CPV and PPV-
-CPV failed to develop efficient specific antibody responses against foreign peptides. This may suggest that
and
sites are in hidden locations and unable to trigger an immunogenic response. As demonstrated in the development of expression vectors based on other plant viruses (31), the availability of three-dimensional data on the virion structure facilitates the identification of potentially immunogenic surface-exposed CP regions. The lack of this kind of data for any potyviral CP precluded the use of this approach for the development of PPV vectors. Thus, a PEPSCAN analysis was performed to identify, in a direct way, preferential immunogenic regions within PPV CP (Fig. 3 and Table 2). The results confirm that the C-terminal domain, and especially the N-terminal domain of PPV CP, are immunodominant regions of the protein. However, we were able to localize highly immunogenic regions within the core domain of CP, which were thought not to be exposed on the virion surface (36).
The N-terminal domain of CP is encoded by the most variable region, both in size and sequence, of the potyviral genome and has been described as surface exposed and highly immunogenic (36). Our PEPSCAN analysis shows that, in spite of its immunodominance, the N-terminal domain is not uniformly immunogenic. It includes regions that are preferentially recognized by sera. For instance, sequences around the NAT site are well recognized by anti-PPV antibodies, in concordance with the high immunogenicity of foreign inserts expressed with the PPV-NATMluI vector (13). However, these immunogenic regions alternate with others that are not recognized at all by the sera and consequently are probably not accessible from outside the virion. The N-terminal domain of PPV CP is exceptionally long, and we do not know if our results could be extrapolated to other potyvirus CPs with shorter N-terminal domains.
The PEPSCAN data suggest a possible explanation for the failure of PPV-
-CPV and PPV-
-CPV to induce the production of antibodies against the heterologous peptide. The
and
insertion sites are located in positions not specially recognized by the sera, but in the proximity of highly immunogenic regions. The
site appears to be in a depression of immunogenicity, just in the hinge between two highly immunogenic regions. It is therefore not surprising that displacements of only 1 or 2 aa in the insertion sites could cause the shift from the null immunogenicity of foreign sequences cloned in the
site to the efficient induction of antibodies of sequences cloned in any of the g sites (Table 1). A precedent of minor displacements in the insertion site causing drastic changes in the immunogenicity of the inserted sequences has been previously reported for epitope expression on the surface of chimeric parvovirus (35) and cowpea mosaic virus (39) particles. These results illustrate the utility of structure and immunogenicity predictions and fine-tuning experimental approaches in the development of antigen presentation systems based on virion capsids.
The PEPSCAN analysis showed that, in general, mice rendered poorer immunogenic responses than did rabbits and that some immunogenic regions were recognized exclusively by rabbit sera. However, other regions were recognized by all or almost all sera. The region located around aa 43 to 52 appears to be especially highly immunogenic (Fig. 3). Two positions within this region were selected as insertion sites for new PPV-based expression vectors, and foreign sequences cloned in these sites were shown to be able to mount a relevant and very efficient specific immune response, which, in the case of PPV-i2-CPV has rather improved the best results obtained with chimeras derived from the PPV-NATMluI vector (Table 3) (13). These results further validate the relevance of PEPSCAN analysis in the accurate definition of peptidic immunogenic regions, although it can identify only linear and not conformational epitopes.
It would be interesting to assess the level of tolerance of these successful vectors for the expression of a variety of peptides, as well as to check the feasibility of concurrent expression of different peptides by using several insertion points at the N-terminal domain of PPV CP.
This work was supported by grants BIO2001-1434 from CICYT and QLK2-2000-00739 and QLK2-CT-2002-01050 from the European Union.
Present address: Centre for Protein Engineering-MRC, Cambridge CB2 2QH, United Kingdom. ![]()
Present address: Biotechnology Programme, Spanish National Cancer Center (CNIO), 28029 Madrid, Spain. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»