Previous Article | Next Article 
Journal of Virology, October 2002, p. 10427-10436, Vol. 76, No. 20
0022-538X/02/$04.00+0 DOI: 10.1128/JVI.76.20.10427-10436.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Epstein-Barr Virus-Induced Changes in B-Lymphocyte Gene Expression
Kara L. Carter,
Ellen Cahir-McFarland, and Elliott Kieff*
Departments of Medicine and Microbiology and Molecular Genetics, Harvard Medical School, and The Channing Laboratory, Brigham and Women's Hospital, Boston, Massachusetts 02115
Received 14 February 2002/
Accepted 15 July 2002

ABSTRACT
To elucidate the mechanisms by which Epstein-Barr virus (EBV)
latency III gene expression transforms primary B lymphocytes
to lymphoblastoid cell lines (LCLs), the associated alterations
in cell gene expression were assessed by using 4,146 cellular
cDNAs arrayed on nitrocellulose filters and real-time reverse
transcription-PCR (RT-PCR). A total of 1,405 of the 4,146 cDNAs
were detected using cDNA probes from poly(A)
+ RNA of IB4 LCLs,
a non-EBV-infected Burkitt's lymphoma (BL) cell line, BL41,
or EBV latency III-converted BL41 cells (BL41EBV). Thirty-eight
RNAs were consistently twofold more abundant in the IB4 LCL
and BL41EBV than in BL41 by microarray analysis. Ten of these
are known to be EBV induced. A total of 23 of 28 newly identified
EBV-induced genes were confirmed by real-time RT-PCR. In addition,
nine newly identified genes and CD10 were EBV repressed. These
EBV-regulated genes encode proteins involved in signal transduction,
transcription, protein biosynthesis and degradation, and cell
motility, shape, or adhesion. Seven of seven newly identified
EBV-induced RNAs were more abundant in newly established LCLs
than in resting B lymphocytes. Surveys of eight promoters of
newly identified genes implicate NF-

B or PU.1 as potentially
important mediators of EBV-induced effects through LMP1 or EBNA2,
respectively. Thus, examination of the transcriptional effects
of EBV infection can elucidate the molecular mechanisms by which
EBV latency III alters B lymphocytes.

INTRODUCTION
In primary Epstein-Barr virus (EBV) infection, a substantial
fraction of peripheral blood B lymphocytes are latently infected
and express virus-encoded proteins that are capable of causing
continuous B-cell proliferation. The EBV-encoded proteins engender
an unusually vigorous and large T-cell immune response which
eliminates most of the virus-infected cells. In severely T-cell
immune-compromised or otherwise susceptible people, the EBV-infected
B lymphocytes can malignantly proliferate (reviewed in reference
90).
The EBV gene products that are expressed in primary lymphocyte infection and that stimulate cell proliferation include six nuclear antigen proteins (EBNAs), two latent infection integral membrane proteins (LMPs), two small RNAs (EBERs), and BamA rightward transcripts (BARTs) of uncertain function (reviewed in reference 59). This complex infection, termed latency III, is characteristic of EBV gene expression in EBV-transformed lymphoblastoid cell lines (LCLs) and many lymphoproliferations that occur in immune-deficient humans (23, 95).
Many of the EBV effects on cell growth and survival are likely to be mediated by EBV-induced changes in cell gene transcription. Five of the EBNAs can alter cell gene transcription through their direct or indirect interaction with the cellular DNA sequence-specific transcription factors RBP-j
/CBF1, PU.1, and AUF1 (35, 42, 52, 53, 65, 72, 91, 113, 119, 123). Furthermore, EBV LMP1 is similar to a constitutively activated CD40 receptor and activates NF-
B, Jun/Fos, and AP1 cellular transcription factors (27, 28, 30, 33, 36, 40, 45, 50, 60, 66, 81, 83). Moreover, EBV LMP2 is similar to a constitutively activated B-cell antigen receptor (BCR) in causing a stable small increase in BCR tyrosine kinase signaling and in desensitizing the cell to BCR-type signal transduction (12, 80). Four of the EBNAs that interact with cellular transcription factors and LMP1 are critical for EBV effects on cell growth and survival, while EBNA3B, LMP2, EBERs, and BARTs are not (19, 37, 49, 56, 68, 73, 76, 92, 102, 108, 109).
In the experiments reported here, cDNA arrays were used to investigate the effects of EBV latency III infection on cell gene transcription. cDNA arrays are particularly useful in characterizing changes in expression of large numbers of cellular genes (3, 4, 48, 51, 57, 74, 97, 100). We compared gene expression in BL41, an EBV-negative Burkitt's lymphoma (BL) cell line, with gene expression in two latency III-expressing cell linesBL41 infected in vitro with EBV (BL41EBV) and an LCL (IB4) (18, 62). In contrast to a comparison of LCLs with resting B lymphocytes, which would identify a large number of cell genes whose expression is up-regulated at various points in the cell cycle, comparison with a non-EBV-infected BL cell line will identify genes that are specifically up-regulated by EBV latency III proteins. However, EBV-regulated genes whose transcription is inherent to the BL phenotype, such as c-myc, may escape detection.

MATERIALS AND METHODS
Cell lines.
BL41 and BL30 are EBV-negative B-lymphoma cell lines with c-
myc translocations and p53 point mutations (
18, 28a). BL41EBV and
BL30EBV are the respective BL lines infected in vitro with the
prototypic EBV strain B95-8 (
13,
29). The LCL used, IB4, is
an EBV-transformed B-lymphoblastoid cell line with four integrated
copies of the genome (
41,
46). All cell lines were maintained
in RPMI (Gibco) plus 10% fetal calf serum (HyClone).
Preparation of RNA.
RNAs were extracted from cells maintained in log-phase growth. Cells were seeded at 200,000 cells per ml, 24 h prior to RNA preparation. RNA was prepared using RNAzol (Tel-test) according to the manufacturer's instructions. RNA was resuspended in diethyl pyrocarbonate-treated water, aliquoted, and stored at -80°C. Poly(A)+ RNA was purified using Oligotex (Qiagen) according to the manufacturer's directions.
Filter hybridizations.
Probes were generated by labeling first-strand cDNA from 5 µg of poly(A)+ RNA. Probes were primed with oligo(dT) and extended at 42°C with 1 mM concentrations of deoxynucleoside triphosphates minus dCTP (Gibco), 60 µCi of [33P]dCTP (NEN), 10 mM dithiothreitol (DTT), 1 U of RNasin (Promega), and first-strand buffer (50 mM Tris-HCl [pH 8.3], 75 mM KCl, 3 mM MgCl2 [Gibco]), and 800 U of Superscript II reverse transcriptase (Gibco). RNA was digested from the probes with RNase H (Gibco) followed by 250 mM NaOH (Sigma) at 65°C. Probes were separated from unincorporated nucleotides by using ProbeQuant G-50 Micro columns (Amersham Pharmacia). All probes were analyzed by polyacrylamide gel electrophoresis and autoradiography to ensure that probes of greater than 300 bp had been generated. Probes were heated to 95°C for 5 min and then hybridized with Human Named GeneFilters (Research Genetics) in Microhyb hybridization solution (Research Genetics) plus 25 µg of poly(dA) (Research Genetics) and 5 µg of heat-denatured Cot-1 DNA (Gibco). Hybridizations were carried out at 42°C for 16 to 24 h. Filters were washed twice with 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and 1% sodium dodecyl sulfate (SDS) and once with 0.5x SSC and 1% SDS at 55°C. Filters were exposed to phosphorimager cassettes and analyzed with a Phosphorimager SI (Molecular Dynamics).
Analysis of filter data.
Scanned phosphorimages were analyzed using P-scan 1.1 software from the National Institutes of Health (http://abs.cit.nih.gov/pscan). Cluster analysis and profile images were generated using the software Cluster and Treeview from the Eisen lab (http://rana.lbl.gov/EisenSoftware.htm) (26).
Real-time RT-PCR.
Reverse transcription (RT) was carried out using 400 ng of total RNA and the TaqMan reverse transcription reagents (PE Applied Biosystems) in a 50-µl reaction mixture. Four microliters of the RT reaction mixture was used for real-time PCR using the SYBR green PCR core reagents (PE Applied Biosystems) and sequence-specific primers. The primers used were interferon-inducible 9-27 forward 5'TCAACATCCACAGCGAGACC3' and reverse 5'GAAGAGGGTGTTGAACAGGGAC3', cystatin B forward 5'GAGCGTGCACTTGTGATCCTAA3' and reverse 5'GCCCCTTCCACCCCAA3', enolase 2 forward 5'TAGTTCACCCCCTGAGATCCC3' and reverse 5'CAGCGGAGCAGGTCAATCA3', YMP forward 5'CTATGCCACCGGCCTCTG3' and reverse 5'AGATCAAGGCGCCAGTAAACA3', BASP1 (NAP-22) forward 5'CCCAAGCCGGTGGAGG3' and reverse 5'TGTCCTTGTCACTCTTTCACGG3', NK4 forward 5'AGAAAGAGATGGATTACGGTGCC3' and reverse 5'TCGGTTGCGGGATCCTC3', PAC-1 forward 5'AGGCTTCATTGACTGGGTGAA3' and reverse 5'AGATACCCGCCTGGCAGTG3', phosphoglycerate kinase forward 5'GCTGGCTGGATGGGCTT3' and reverse 5'TTAGCCCGAGTGACAGCCTC3', TRAP delta forward 5'ATTTCCATCATCCCGCCTCT3' and reverse 5'AGGGCCCGTTCCAAGTG3', interferon-inducible IP30 forward 5'CGGAGTGTTTGCTTCGAGTGT3' and reverse 5'AGTTCCCACTCGCCTTCCAT3', ATPase subunit M9.2 forward 5'TACCATGTTGGTGACCTGTTCAG3' and reverse 5'GGGTTGAGTTGGGCCAGAA3', BRF1 forward 5'TCCGGCCCATGTCCG3' and reverse 5'CGAGAGAGAATCCTGAGGGCT3', DNAS1L3 forward 5'CCCCAAGAAGGCCTGGAA3' and reverse 5'TTGGTCCCCGATCAGCC3', HCK forward 5'AGCGCCAACTGCTGGCT3' and reverse 5'TCTCGCTATCCCGGATCATG3', HPK1 forward 5'GGGATCCCAGATGCAGACTG3' and reverse 5'TCTCCATTCCTCGGAGCTTC3', heat shock factor 1 forward 5'AACAGAAAGTCGTCAACAAGCTCAT3' and reverse 5'CTTTCTCTTCACCCCCAGGAT3', human transcription factor forward 5'GGAGGGCAACTTATCAGGCATG3' and reverse 5'TCGGACACTTCCCTTTCTGC3', initiation factor 4B forward 5'CCAATTGACCGTTCCATCCT3' and reverse 5'GGTCGATATTGGGTTCCCG3', interferon-inducible 1-8U forward 5'ATCCACATCCGCAGCGAG3' and reverse 5'AGGGTGTTGAACAGGGACCA3', galectin 9 forward 5'TTACCCAGACAGTCATCCACACA3' and reverse 5'GGGATGGCGGGAGTAGAGAA3', interferon-inducible 1-8D forward 5'ACCGCCAAGTGCCTGAAC3' and reverse 5'GGATGATGACGAGCAGAATGG3', aldolase A forward 5'CACATCTACCTGGAAGGCACC3' and reverse 5'CTTCTGAGTGCAAGCATGGC3', cathepsin C forward 5'TTTCTATGGAGGCTGCAATGAA3' and reverse 5'AGCAACTGCCATGGGCC3', FYN forward 5'ACAAGGTGCAAAGTTCCCCA3' and reverse 5'TGAACCTCCCGTACAGGGC3', interferon-induced microtubule aggregating protein forward 5'CGTTACAGCCCTGCATTTGA3' and reverse 5'ATTGCGGCACACACCAGTACAG3', 40S ribosomal protein S8 forward 5'CATCTCTCGGGACAACTGGC3' and reverse 5'TCTTGTGGTAGGGCTTTCTCTTG3', hepatocyte nuclear factor dimerization factor forward 5'TTGCTGTGGGATGTGCCA3' and reverse 5' GAAGAGAGTGGTGCAGGGAAAA3', alpha 1 interferon forward 5'CCGAACTCTACCAGCAGCTGA3' and reverse 5'GGAGTTTCTCCCACCCTCTCC3', beta interferon forward 5'CTCCGAAACTGAAGATCTCCTAGC3' and reverse 5'TGCTGGTTGAAGAATGCTTGA3', and gamma interferon forward 5'GCAGCTAAAACAGGGAAGCG3' and reverse 5'GGACAACCATTACTGGGATGCT3'. PCRs were cycled in a GeneAmp 5700 sequence detection system and analyzed with GeneAmp 5700 SDS software (version 1.1; PE Applied Biosystems). Cycle times were analyzed at a reading of 0.2 fluorescence units. All reactions were done in duplicate. Cycle times that varied by more than 1.0 between the duplicates were discarded. The duplicate cycle times were then averaged and the cycle time of p100 was subtracted from them for a normalized value. The normalized values for BL41EBV or IB4 were subtracted from values for BL to determine a normalized cycle time difference for the appearance of the transcript. For the comparisons of resting B lymphocytes to LCLs and BL30 to BL30EBV, no normalization to p100 was performed because p100 mRNA levels varied substantially in these comparisons, whereas it does not vary in BL41, BL41EBV, and IB4. Rather, equal masses of total RNA from multiple RNA preparations were used, yielding consistent results.
Promoter analysis.
Five hundred base pairs 5' of the transcriptional start site were identified using TRASER (http://genome-www6.stanford.edu/cgi-bin/Traser/traser) and analyzed using AliBaba2.1 and the Transfac database (http://www.gene-regulation.com).
Establishment of LCLs and purification of resting B cells.
Peripheral blood mononuclear cells (PBMC) from normal donors were infected with the B95-8 strain of EBV in the presence of 0.5 µg of cyclosporine A/ml. Total RNA was extracted from bulk cultures at 3 months (LCL1) and 2 months (LCL2) postinfection. Resting B cells were purified from 108 PBMC by negative selection using a human B-lymphocyte prep column (Caltag) according to the manufacturer's instructions.

RESULTS
Effect of EBV latency III infection on cell gene expression.
Research Genetics gf211 filters that have 4,146 partially redundant
IMAGE cDNA array elements, 178 total genomic control spots,
and 1,436 no-DNA control spots were successively hybridized
to poly(A)
+ RNA-directed first-strand cDNA probes from EBV-negative
BL41 cells, from BL41 stably converted to latency III by EBV
infection (BL41EBV), and from IB4 LCLs. BL41EBV and IB4 cells
express EBNAs and LMP1 that are characteristic of latency III
EBV infection. Poly (A)
+ RNA was used in these experiments because
on average 1,352 cDNAs were detectable at twofold over background
with poly(A)
+ RNA-directed probes, whereas only 930 cDNAs were
detected with total RNA-directed probes (data not shown). Signal
intensities were analyzed by P-SCAN 1.1 software, which normalizes
each cDNA signal to the average signal intensity for all array
elements on the filter. Normalized intensities were then used
to compare hybridizations of different probes to the same filter.
Array elements were considered to have detected RNA if their hybridized radioactivity was at least twice the mean background with probes from BL41, BL41EBV, or IB4 RNAs. Of the 1,436 no-DNA control spots, only 2 to 3% were greater than two times the mean on any filter, whereas of 4,146 cDNA array elements, 34% (1,405) gave a signal that was at least twice the background with repeat hybridizations using probes from BL41, BL41EBV, or IB4 poly(A)+ RNA.
In Fig. 1A, each column represents an individual filter and each row represents a particular array element. The data are presented as the ratio of normalized intensities for each gene with BL41EBV or IB4 cells divided by the normalized intensities with non-EBV-infected BL41 cells on the identical filter. The ratios for BL41EBV to BL41 and IB4 to BL41 were ordered simultaneously using the Cluster self-organizing map (SOM) function (26). A strong red or green signal indicates fourfold higher or lower abundance, respectively, than in BL41. Black is indicative of no difference from the level in uninfected BL41 cells. Many genes were affected by EBV infection, as evidenced by the red or green.
The bars labeled a or b at the right of the SOM in Fig.
1A demarcate
RNAs that are expressed at a higher level in IB4 (group a) or
BL41EBV (group b) relative to BL41 but not in both BL41EBV and
IB4, whereas the bars labeled c or d demarcate RNAs that are
expressed at a lower level in IB4 (group c) or BL41EBV (group
d) relative to BL41 but not in both BL41EBV and IB4. These seeming
inconsistencies may be due to constitutive c-
myc expression
or some other dominant transcription factor effect in the BL
cells that may obscure the effect of EBV on these genes in the
BL41 background or may alter expression in BL41 relative to
IB4. Less likely, some RNAs may be differentially expressed
in BL41EBV or IB4 because BL41EBV lacks EBER expression and
IB4 lacks EBNA3B expression. However, EBERS and EBNA3B are not
critical for B-lymphocyte conversion to LCLs (
102,
108). Interestingly,
a number of genes in group a have related functions, such as
cyclophilin C, cyclophilin B, and FKBP-associated protein 48
or coronin-1 and p40phox.
The red bar to the left of the SOM in Fig. 1A demarcates 195 RNAs that are expressed at least twofold higher in at least two of three hybridizations with BL41EBV and IB4 cDNAs, whereas the green bar indicates 344 RNAs that are expressed at least twofold lower in at least two of three hybridizations with BL41EBV and IB4 cDNAs. The former are likely to be EBV latency III-induced genes, whereas the latter are likely to be EBV latency III-repressed genes. These genes were further investigated.
EBV-induced genes.
Of the 195 putative RNAs indicated with a red bar, 151 in BL41EBV and 58 in IB4 were at least twofold more abundant than in BL41 in three of three hybridizations. Thirty-eight unique genes encoded the RNAs that were twofold more abundant in all experiments with both BL41EBV and IB4 cDNAs (Fig. 1B). Included in the 38 are 10 previously known EBV-induced genes, such as major histocompatibility antigens, vimentin, A20, TRAF1, CD48, and FAS, all of which are LMP1 induced and NF-
B up-regulated (6, 8, 24, 63, 66, 120). Neither A1/Bfl1 nor I
B
were among the 38 because they were more than twofold induced in only five of six filters. ICAM1 was not among the 38 because it was not detected. Of the 28 new candidate EBV-induced genes, NK4 and PAC-1 may have been anticipated to be EBV induced because they were known to be NF-
B regulated (70, 99), and EBV LMP1 strongly up-regulates NF-
B.
Of the genes newly identified as EBV induced, four are known to be interferon (IFN) induced and one, Tyk2, is important in IFN signaling (5, 69, 112). Since IFNs are not among the arrayed cDNAs, real-time RT-PCR was used to quantify steady-state IFN mRNA levels. Although IFN-
1, -ß, and -
were two- to fourfold more abundant in LCLs than in BL41 cells, IFN-
was unaffected by EBV infection in BL41EBV, and IFN-
and IFN-ß were suppressed two- to fourfold. Thus, increased expression of IFN-regulated genes in BL41EBV is not likely to be due to IFN induction (data not shown).
EBV-repressed genes.
Although 344 array elements clustered as EBV repressed (Fig. 1A), most changed less than twofold. Only 29 array elements were less abundant in all three BL41EBV RNA hybridizations, 38 were less abundant in all three IB4, and 10 genes were less abundant in both BL41EBV and IB4 cells (Fig. 1C). The 10 less abundant genes included the gene for CD10; CD10 is known to be repressed by latency III EBV infection in BL cells (25, 115). For the remaining genes, there is no indication of a common pathway that may impact their promoters. However, 14-3-3 epsilon and protein kinase A (PKA) regulatory subunit 2 beta may be functionally related since 14-3-3 proteins can affect the subcellular localization of PKA-phosphorylated proteins (84).
RT-PCR validation of EBV-induced genes.
Expression of EBV-induced genes was validated by real-time RT-PCR with p100 RNA as an internal control; p100 RNA abundance was the same in BL41, BL41EBV, and IB4 by Northern blotting (data not shown). Titration of either first-strand cDNA or plasmid DNA for p100 showed that one cycle change correlates with an approximate twofold difference in RNA abundance (data not shown). For most genes the fold change on profiling correlated with the cycle time change on real-time RT-PCR, but the magnitude of change by real-time RT-PCR was generally greater. GS3686, for example, was 68-fold more abundant in BL41EBV profiling, and the RT-PCR signal appeared 10 cycles earlier with BL41EBV RNA, indicative of a 1,000-fold change. Of 26 genes tested, 13 had replicated changes of at least one cycle for both BL41EBV and IB4 compared to BL, indicating a more than twofold induction (Table 1). Eleven others had positive changes in most experiments, confirming EBV induction. ENO2 failed to confirm in BL41EBV but was 12-fold more abundant in IB4 than in BL cells. IFI30 and ALDOA were four- and threefold increased by array analysis but were minimally increased by RT-PCR. One gene, hUBC12, was incorrectly annotated as HSP1. Real time RT-PCR failed to show EBV induction of HSP1 (data not shown), and hUBC12 has not yet been tested.
EBV-induced genes in LCLs versus primary B lymphocytes.
To investigate the relevance of the newly identified EBV-induced
gene set to EBV latency III effects in primary B-lymphocyte
conversion to LCLs, the abundances of seven induced RNAs were
compared by real time RT-PCR using RNAs from recently established
LCLs and from primary B lymphocytes. GS3686, ENO2, DNASE1L3,
TYK2, HCK, FYN, and MAP4K1(HPK) RNAs were greater than sixfold
more abundant in LCLs than in resting B lymphocytes (Table
2).
Thus, most of the newly identified EBV-induced genes are likely
to be relevant to the effects of latency III EBV infection of
primary B lymphocytes.
EBV-induced genes in BL30EBV versus BL30.
Various BL cell lines differ in their response to EBV latency
III infection; similarities and some differences have been previously
noted between BL41 and BL30 (
13,
14). In real-time RT-PCR assays,
GS3686, ENO2, DNASE1L3, and TYK2 were at least 1.7-fold more
abundant in BL30EBV than in BL30, whereas HCK, FYN, or MAP4K1
were not more abundant in BL30EBV versus BL30 (Table
2). BL30EBV
and BL41EBV cell lines are similar in EBV latency III protein
expression; however, the EBER status of BL30EBV is unknown (data
not shown). Likely, differences between BL41 and BL30 cells
result in disparate effects of EBV latency III on cellular gene
expression.

DISCUSSION
EBV infects resting B lymphocytes and growth transforms them
by altering cellular gene expression through the expression
of the essential viral proteins EBNA2, EBNALP, EBNA3A, EBNA3C,
EBNA1, and LMP1 (reviewed in reference
59). Since most of the
latency III proteins that are required for LCL outgrowth impact
transcriptional pathways, changes in cell gene transcription
are likely to be critical to EBV effects on cell growth and
survival. Indeed, EBV reverse genetic analyses identify the
transcriptional effector domains of EBNA2 and LMP1 as critical
domains for B-lymphocyte conversion to LCLs (
49,
50,
119). EBNA2,
EBNA3A, EBNA3B, and EBNA3C regulate transcription at least in
part through interactions with RBP-J

/CBF1, a transcription factor
that mediates Notch receptor effects (
35,
42,
52,
53,
65,
72,
91,
113,
119,
123). LMP1 is a tumor necrosis factor receptor
analogue which constitutively activates NF-

B, JNK, and p38 signaling
pathways, thereby altering cell gene transcription (
27,
28,
30,
33,
36,
40,
45,
50,
60,
66,
81,
83).
These experiments are the first broad survey of the potential effects of latency III EBV infection on 4,146 cDNAs of known or imputed function. Thus, we were able to identify EBV-regulated genes and compare the transcriptional profile of latency III-infected cells to those profiles established for other B-cell malignancies.
Of the 38 RNAs that are up-regulated by latency III EBV infection in BL41EBV, 11 were known to be up-regulated by EBV. Except for ß-actin, all are induced by LMP1 through NF-
B activation (6, 8, 24, 63, 66, 120). Based on the key role of LMP1 activation of NF-
B in 10 of the 11 previously known EBV-induced genes, many of the 24 newly identified EBV-induced genes are likely to be up-regulated by LMP1. Indeed, NK4 and PAC-1 are known to be NF-
B responsive and are therefore likely to be LMP1 induced (70, 99). Aside from NF-
B, LMP1 can effect transcription through AP-1 and SP1 activation (60, 104). EBNA2 is also a strong activator of cell gene expression, and its effects are potentiated by EBNALP and EBNA3C (38, 72, 85). EBNA2 can up-regulate CD21 and CD23 with LMP1, and it also up-regulates c-myc and c-fgr (2, 20, 54, 64, 115, 116).
HCK and FYN, two other Src family tyrosine kinases (89, 98, 125), have now been found to be induced by latency III EBV infection (Table 1) and may also be EBNA2 up-regulated. HCK and FYN are up-regulated fourfold in BL41EBV and IB4 cells compared to BL41 cells and were induced approximately eightfold in newly established LCLs relative to resting B cells. Up-regulation of specific Src family kinases may affect signal transduction from receptor tyrosine kinases, from receptors which bind Src family tyrosine kinases through their SH2 or SH3 domains, and from GPCRs that stimulate G
s and G
I (1, 9, 96). The Src family kinases can further alter cell transcription, growth, or survival through multiple signal cascades, including the mitogen-activated protein (MAP) kinase pathway. We also identified two regulators of the MAP kinase cascade that are EBV induced. MAP4K1 is expressed at threefold higher levels in BL41EBV and in IB4 cells relative to BL41, and PAC-1 is expressed at sixfold higher levels. MAP4K1 interacts with BLNK and a novel SLP-76-related molecule, CLNK/MIST, to couple BCR signaling to NF-
B activation, interleukin-2 promoter activity, and MAP kinase activation (44, 58, 118, 121). PAC-1 dephosphorylates ERK1 and ERK2, and this may prevent desensitization as a consequence of continuous signaling from latency III EBV infection (94, 117).
Four of the identified EBV-induced genes are also IFN inducible. Latency III EBV infection has been associated with direct IFN-ß induction as well as with cytokine-mediated IFN induction (5, 55, 105). However, IFN-
1, -ß1, and -
1 RNAs were not up-regulated in BL41EBV. IFN-
alpha receptor and Tyk2 were up-regulated in BL41EBV and IB4 and could increase IFN signaling. Latency III EBV infection may up-regulate an IFN that would not have been detected with the probes for IFN-
1, -ß1, or -
1, or the IFN effects may be augmented by signaling from another EBV-inducible cytokine and receptor pathway. Cytomegalovirus, another human herpesvirus, is known to induce IFN response genes immediately following infection of cells in the absence of IFN induction (124).
Five EBV-induced genes, including the IFN-induced gene GS3686, encode proteins that are involved in cell adhesion or structure. LMP1 up-regulates expression of vimentin intermediate filaments, a p55 actin bundling protein, MARCKS, LFA-1, LFA-3, and ICAM-1 (10, 13, 47, 101, 106, 107, 114-116). GS3686, the most highly EBV-induced mRNA, encodes a putative microtubule aggregating protein (43, 103). PSCDBP binds to cytoadhesin 1 (61), and BASP1 is an N-terminally myristolated, Ca+ and calmodulin binding protein found in plasma membrane microdomains. BASP1 colocalizes with MARCKS, another EBV-induced protein (7), and is also a PKC substrate (82, 88). Natural killer cell protein 4 may have a role in cell adhesion (21), whereas galectin 9 has been implicated in eosinophil chemotaxis (77).
Ten other EBV-induced genes are constituents of metabolic pathways, including protein biosynthesis and degradation, PCBD/6-pyruvoly-tetrahydropterin synthase, vacuolar ATPase subunit H, phosphoglycerate kinase 1 (PGK1), enolase 2, DNase I-like elongation and initiation factor 4B, ribosomal protein S8, signal sequence receptor 4, cystatin B, and cathepsin C (11, 17, 22, 31, 39, 67, 75, 78, 79, 86, 93, 111, 122). Up-regulation of these RNAs may enhance the ability of latency III-infected cells to rapidly alter location, metabolism, or proliferation.
Analysis of potential transcriptional regulatory sites near promoters of these new EBV-induced genes may identify new signaling pathways impacted by latency III EBV infection. Programs associated with the Transcription Factor database and the completed human genomic sequences were used to identify putative transcription factor binding sites 500 bases upstream of the Tyk2, PGK1, PCBD, MAP4K1, hUBC12, GS3686, and ENO2 promoters. All except for Tyk2 have predicted NF-
B sites and are therefore likely to be LMP1 responsive. The Tyk2, PGK1, GS3686, and ENO2 promoters have predicted PU.1 sites that may enable EBNA2 responsiveness. These promoters also have predicted AP-1, AP-2, and SP1 binding sites that can be affected by LMP1 (28, 104). Thus, most of the genes identified in this study are likely to be impacted by pathways already known to be EBV induced.
Of the 10 RNAs that were down-regulated twofold or more in BL41EBV and IB4, CD10 is known to be down-regulated by LMP1 (34, 71, 115). CD10 is a neutral endopeptidase that is down-regulated in Alzheimer's disease patients. Potentially of interest is the recent observation that B cells of Alzheimer's disease patients transform more rapidly to LCLs following in vitro infection with EBV than do cells from age-matched controls (87).
BL41EBV and IB4 are good model cell lines for the identification of EBV-induced genes, since EBV has robust effects in BL41. Furthermore, IB4 cell growth is still dependent on EBNA2 interactions with RBP-J
(A. Cooper, submitted for publication). In fact, of the genes tested, all showed EBV induction in the newly established LCLs compared to resting B cells, validating our model. HCK, FYN, and MAP4K1, was not confirmed as being EBV induced in the comparison of BL30EBV to BL30, whereas GS3686, ENO2, DNASE1L3, and TYK2 were. This likely reflects a difference in the basal gene expression between BL41 and BL30, possibly due to variations in accumulated mutations. BL41 and BL30 have c-myc translocations and p53 mutations; their BCL-6 status is unknown.
In studies of diffuse large B-cell lymphomas, some genes are abundant in activated antigen receptor-stimulated B cells and scarce in germinal center (tonsil) B cells. These genes constitute an activated B-cell signature. In contrast, genes that are expressed at a high level in tonsils and at a low level in activated B cells constitute a germinal center signature (4). Five activated and 15 germinal center B-cell signature cDNAs were detected on the Research Genetics gf211 filters (Fig. 2). Two of five activation signature genes, CD44 and c-FLIP, were up-regulated in at least five of six hybridizations with BL41EBV and IB4 RNAs. Three of five activated signature genes, c-myc, phorbol myristate acetate (PMA)-induced 1, and dCMP deaminase, were unaffected by EBV infection. c-myc is constitutively expressed at a high level in BL cells and would not be expected to change in these studies (110). PMA-induced 1 and dCMP deaminase are transiently induced by antigen receptor signaling, with expression returning to resting levels at 48 h (4). Thus, the effect of EBV infection on activated and germinal center genes is difficult to predict.
EBV did not consistently up-regulate any germinal center signature
gene. Rather, the only significant effect of EBV infection on
germinal center signature genes was down-regulation. RGS13,
Spi-B, and CD10 were expressed at a low level in BL41EBV and
in IB4 cells, consistent with active inhibition by latency III
EBV infection. BCL-6 was less abundant in LCLs compared to BL,
as was expected since LMP1 expression can down-regulate BCL-6
(
15,
16). However, BCL-6 levels were unaffected in BL41EBV,
probably due to BL-associated mutations in the BCL-6 promoter
(
32). Overall, latency III EBV-infected BL41EBV and IB4 cells
have increased expression of the activation markers CD44 and
c-FLIP and decreased expression of the germinal center markers
RGS13, Spi-B, and CD10 (Fig.
2).
In this study, we have focused on genes that are robustly induced and highly expressed in latency III EBV-infected cells. Relaxation of these criteria to include genes that are up-regulated twofold in more than half of the repeated hybridizations expands the set of EBV-induced genes to 80 cDNAs, which include almost all previously identified EBV-induced genes. Further studies are necessary to characterize gene expression in EBV-associated malignancies that express latency I or latency II. These future studies, and our present one, may enable the identification of EBV signatures associated with different types of latency that can lead to therapeutic targets for the treatment of EBV-associated diseases.

ACKNOWLEDGMENTS
K. L. Carter and E. Cahir-McFarland contributed equally to this
work.
We thank Peter Munson for providing the PSCAN 1.1 software and for assisting us in its use; Emily Klotz for providing guidance with protocols; Danielle Rizzo for technical help; and Jena Giltnane, Louis Staudt, and the Kieff lab members for helpful discussions.
K.L.C., E.C.-M, and E.K. were supported by Public Health Service grants CA47006, CA85180, CA87661, CA75646, and CA76727. E.C.-M is a Special Fellow of the Leukemia and Lymphoma Society.
K. L. Carter and E. Cahir-McFarland contributed equally to this work.

FOOTNOTES
* Corresponding author. Mailing address: The Channing Laboratory, Brigham and Women's Hospital, 181 Longwood Ave., Boston, MA 02115. Phone: (617) 525-4252. Fax: (617) 525-4257. E-mail:
ekieff{at}rics.bwh.harvard.edu.

Present address: Praecis Pharmaceuticals Incorporated, Waltham, MA 02451. 

REFERENCES
1 - Abu-Ghazaleh, R., J. Kabir, H. Jia, M. Lobo, and I. Zachary. 2001. Src mediates stimulation by vascular endothelial growth factor of the phosphorylation of focal adhesion kinase at tyrosine 861, and migration and anti-apoptosis in endothelial cells. Biochem. J. 360:255-264.[CrossRef][Medline]
2 - Alfieri, C., M. Birkenbach, and E. Kieff. 1991. Early events in Epstein-Barr virus infection of human B lymphocytes. Virology 181:595-608.[CrossRef][Medline]
3 - Alizadeh, A., M. Eisen, R. E. Davis, C. Ma, H. Sabet, T. Tran, J. I. Powell, L. Yang, G. E. Marti, D. T. Moore, J. R. Hudson, Jr., W. C. Chan, T. Greiner, D. Weisenburger, J. O. Armitage, I. Lossos, R. Levy, D. Botstein, P. O. Brown, and L. M. Staudt. 1999. The lymphochip: a specialized cDNA microarray for the genomic-scale analysis of gene expression in normal and malignant lymphocytes. Cold Spring Harbor Symp. Quant. Biol. 64:71-78.
4 - Alizadeh, A. A., M. B. Eisen, R. E. Davis, C. Ma, I. S. Lossos, A. Rosenwald, J. C. Boldrick, H. Sabet, T. Tran, X. Yu, J. I. Powell, L. Yang, G. E. Marti, T. Moore, J. Hudson, Jr., L. Lu, D. B. Lewis, R. Tibshirani, G. Sherlock, W. C. Chan, T. C. Greiner, D. D. Weisenburger, J. O. Armitage, R. Warnke, L. M. Staudt, et al. 2000. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 403:503-511.[CrossRef][Medline]
5 - Andersson, U., O. Martinez-Maza, J. Andersson, S. Britton, H. Gadler, M. De Ley, and S. Modrow. 1984. Secretion of gamma-interferon at the cellular level. Induction by Epstein-Barr virus. Scand. J. Immunol. 20:425-432.[CrossRef][Medline]
6 - Baldwin, A. S., Jr., and P. A. Sharp. 1987. Binding of a nuclear factor to a regulatory sequence in the promoter of the mouse H-2Kb class I major histocompatibility gene. Mol. Cell. Biol. 7:305-313.[Abstract/Free Full Text]
7 - Birkenbach, M., K. Josefsen, R. Yalamanchili, G. Lenoir, and E. Kieff. 1993. Epstein-Barr virus-induced genes: first lymphocyte-specific G protein-coupled peptide receptors. J. Virol. 67:2209-2220.[Abstract/Free Full Text]
8 - Birkenbach, M., D. Liebowitz, F. Wang, J. Sample, and E. Kieff. 1989. Epstein-Barr virus latent infection membrane protein increases vimentin expression in human B-cell lines. J. Virol. 63:4079-4084.[Abstract/Free Full Text]
9 - Bisotto, S., and E. D. Fixman. 2001. Src-family tyrosine kinases, phosphoinositide 3-kinase and Gab1 regulate extracellular signal-regulated kinase 1 activation induced by the type A endothelin-1 G-protein-coupled receptor. Biochem. J. 360:77-85.[CrossRef][Medline]
10 - Bonnefoy, J. Y., T. Defrance, C. Peronne, C. Menetrier, F. Rousset, J. Pene, J. E. De Vries, and J. Banchereau. 1988. Human recombinant interleukin 4 induces normal B cells to produce soluble CD23/IgE-binding factor analogous to that spontaneously released by lymphoblastoid B cell lines. Eur. J. Immunol. 18:117-122.[Medline]
11 - Brenner, V., G. Nyakatura, A. Rosenthal, and M. Platzer. 1997. Genomic organization of two novel genes on human Xq28: compact head to head arrangement of IDH gamma and TRAP delta is conserved in rat and mouse. Genomics 44:8-14.[CrossRef][Medline]
12 - Caldwell, R. G., J. B. Wilson, S. J. Anderson, and R. Longnecker. 1998. Epstein-Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity 9:405-411.[CrossRef][Medline]
13 - Calender, A., M. Billaud, J. P. Aubry, J. Banchereau, M. Vuillaume, and G. M. Lenoir. 1987. Epstein-Barr virus (EBV) induces expression of B-cell activation markers on in vitro infection of EBV-negative B-lymphoma cells. Proc. Natl. Acad. Sci. USA 84:8060-8064.[Abstract/Free Full Text]
14 - Calender, A., M. Cordier, M. Billaud, and G. M. Lenoir. 1990. Modulation of cellular gene expression in B lymphoma cells following in vitro infection by Epstein-Barr virus (EBV). Int. J. Cancer 46:658-663.[Medline]
15 - Carbone, A., G. Gaidano, A. Gloghini, L. M. Larocca, D. Capello, V. Canzonieri, A. Antinori, U. Tirelli, B. Falini, and R. Dalla-Favera. 1998. Differential expression of BCL-6, CD138/syndecan-1, and Epstein-Barr virus-encoded latent membrane protein-1 identifies distinct histogenetic subsets of acquired immunodeficiency syndrome-related non-Hodgkin's lymphomas. Blood 91:747-755.[Abstract/Free Full Text]
16 - Carbone, A., G. Gaidano, A. Gloghini, C. Pastore, G. Saglio, U. Tirelli, R. Dalla-Favera, and B. Falini. 1997. BCL-6 protein expression in AIDS-related non-Hodgkin's lymphomas: inverse relationship with Epstein-Barr virus-encoded latent membrane protein-1 expression. Am. J. Pathol. 150:155-165.[Abstract]
17 - Citron, B. A., S. Kaufman, S. Milstien, E. W. Naylor, C. L. Greene, and M. D. Davis. 1993. Mutation in the 4a-carbinolamine dehydratase gene leads to mild hyperphenylalaninemia with defective cofactor metabolism. Am. J. Hum. Genet. 53:768-774.[Medline]
18 - Cohen, J. H., E. Fischer, M. D. Kazatchkine, G. M. Lenoir, C. Lefevre-Delvincourt, and J. P. Revillard. 1987. Expression of CR1 and CR2 complement receptors following Epstein-Barr virus infection of Burkitt's lymphoma cell lines. Scand. J. Immunol. 25:587-598.[CrossRef][Medline]
19 - Cohen, J. I., F. Wang, J. Mannick, and E. Kieff. 1989. Epstein-Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation. Proc. Natl. Acad. Sci. USA 86:9558-9562.[Abstract/Free Full Text]
20 - Cordier, M., A. Calender, M. Billaud, U. Zimber, G. Rousselet, O. Pavlish, J. Banchereau, T. Tursz, G. Bornkamm, and G. M. Lenoir. 1990. Stable transfection of Epstein-Barr virus (EBV) nuclear antigen 2 in lymphoma cells containing the EBV P3HR1 genome induces expression of B-cell activation molecules CD21 and CD23. J. Virol. 64:1002-1013.[Abstract/Free Full Text]
21 - Dahl, C. A., R. P. Schall, H. L. He, and J. S. Cairns. 1992. Identification of a novel gene expressed in activated natural killer cells and T cells. J. Immunol. 148:597-603.[Abstract]
22 - Davies, B., and M. Fried. 1993. The structure of the human intron-containing S8 ribosomal protein gene and determination of its chromosomal location at 1p32-p34.1. Genomics 15:68-75.[CrossRef][Medline]
23 - Delecluse, H. J., E. Kremmer, J. P. Rouault, C. Cour, G. Bornkamm, and F. Berger. 1995. The expression of Epstein-Barr virus latent proteins is related to the pathological features of post-transplant lymphoproliferative disorders. Am. J. Pathol. 146:1113-1120.[Abstract]
24 - Devergne, O., E. Cahir-McFarland, G. Mosialos, K. M. Izumi, C. F. Ware, and E. Kieff. 1998. Role of the TRAF binding site and NF-
B activation in Epstein-Barr virus latent membrane protein 1-induced cell gene expression. J. Virol. 72:7900-7908.[Abstract/Free Full Text]
25 - Ehlin-Henriksson, B., A. Manneborg-Sandlund, and G. Klein. 1987. Expression of B-cell-specific markers in different Burkitt lymphoma subgroups. Int. J. Cancer 39:211-218.[Medline]
26 - Eisen, M. B., P. T. Spellman, P. O. Brown, and D. Botstein. 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95:14863-14868.[Abstract/Free Full Text]
27 - Eliopoulos, A. G., N. J. Gallagher, S. M. Blake, C. W. Dawson, and L. S. Young. 1999. Activation of the p38 mitogen-activated protein kinase pathway by Epstein-Barr virus-encoded latent membrane protein 1 coregulates interleukin-6 and interleukin-8 production. J. Biol. Chem. 274:16085-16096.[Abstract/Free Full Text]
28 - Eliopoulos, A. G., and L. S. Young. 1998. Activation of the cJun N-terminal kinase (JNK) pathway by the Epstein-Barr virus-encoded latent membrane protein 1 (LMP1). Oncogene 16:1731-1742.[CrossRef][Medline]
28 - Farrell, P. J., G. J. Allan, F. Shanahan, K. H. Vousden, and T. Crook. 1991. p53 is frequently mutated in Burkitt's lymphoma cell lines. EMBO J. 10:2879-2887.[Medline]
29 - Favrot, M. C., O. Maritaz, T. Suzuki, M. Cooper, I. Philip, T. Philip, and G. Lenoir. 1986. EBV-negative and -positive Burkitt cell lines variably express receptors for B-cell activation and differentiation. Int. J. Cancer 38:901-906.[Medline]
30 - Floettmann, J. E., and M. Rowe. 1997. Epstein-Barr virus latent membrane protein-1 (LMP1) C-terminus activation region 2 (CTAR2) maps to the far C terminus and requires oligomerisation for NF-
B activation. Oncogene 15:1851-1858.[CrossRef][Medline]
31 - Freemont, P. S., B. Dunbar, and L. A. Fothergill-Gilmore. 1988. The complete amino acid sequence of human skeletal-muscle fructose-bisphosphate aldolase. Biochem. J. 249:779-788.[Medline]
32 - Gaidano, G., A. Carbone, and R. Dalla-Favera. 1998. Genetic basis of acquired immunodeficiency syndrome-related lymphomagenesis. J. Natl. Cancer Inst. Monogr. 23:95-100.
33 - Gires, O., U. Zimber-Strobl, R. Gonnella, M. Ueffing, G. Marschall, R. Zeidler, D. Pich, and W. Hammerschmidt. 1997. Latent membrane protein 1 of Epstein-Barr virus mimics a constitutively active receptor molecule. EMBO J. 16:6131-6140.[CrossRef][Medline]
34 - Gregory, C. D., C. F. Edwards, A. Milner, J. Wiels, M. Lipinski, M. Rowe, T. Tursz, and A. B. Rickinson. 1988. Isolation of a normal B cell subset with a Burkitt-like phenotype and transformation in vitro with Epstein-Barr virus. Int. J. Cancer 42:213-220.[Medline]
35 - Grossman, S. R., E. Johannsen, X. Tong, R. Yalamanchili, and E. Kieff. 1994. The Epstein-Barr virus nuclear antigen 2 transactivator is directed to response elements by the J
recombination signal binding protein. Proc. Natl. Acad. Sci. USA 91:7568-7572.[Abstract/Free Full Text]
36 - Hammarskjold, M. L., and M. C. Simurda. 1992. Epstein-Barr virus latent membrane protein transactivates the human immunodeficiency virus type 1 long terminal repeat through induction of NF-
B activity. J. Virol. 66:6496-6501.[Abstract/Free Full Text]
37 - Hammerschmidt, W., and B. Sugden. 1989. Genetic analysis of immortalizing functions of Epstein-Barr virus in human B lymphocytes. Nature 340:393-397.[CrossRef][Medline]
38 - Harada, S., and E. Kieff. 1997. Epstein-Barr virus nuclear protein LP stimulates EBNA-2 acidic domain-mediated transcriptional activation. J. Virol. 71:6611-6618.[Abstract]
39 - Hart, T. C., P. S. Hart, D. W. Bowden, M. D. Michalec, S. A. Callison, S. J. Walker, Y. Zhang, and E. Firatli. 1999. Mutations of the cathepsin C gene are responsible for Papillon-Lefevre syndrome. J. Med. Genet. 36:881-887.[Abstract/Free Full Text]
40 - Hatzivassiliou, E., W. E. Miller, N. Raab-Traub, E. Kieff, and G. Mosialos. 1998. A fusion of the EBV latent membrane protein-1 (LMP1) transmembrane domains to the CD40 cytoplasmic domain is similar to LMP1 in constitutive activation of epidermal growth factor receptor expression, nuclear factor-kappa B, and stress-activated protein kinase. J. Immunol. 160:1116-1121.[Abstract/Free Full Text]
41 - Henderson, A., S. Ripley, M. Heller, and E. Kieff. 1983. Chromosome site for Epstein-Barr virus DNA in a Burkitt tumor cell line and in lymphocytes growth-transformed in vitro. Proc. Natl. Acad. Sci. USA 80:1987-1991.[Abstract/Free Full Text]
42 - Henkel, T., P. D. Ling, S. D. Hayward, and M. G. Peterson. 1994. Mediation of Epstein-Barr virus EBNA2 transactivation by recombination signal-binding protein J
. Science 265:92-95.[Abstract/Free Full Text]
43 - Honda, Y., J. Kondo, T. Maeda, Y. Yoshiyama, E. Yamada, Y. K. Shimizu, T. Shikata, and Y. Ono. 1990. Isolation and purification of a non-A, non-B hepatitis-associated microtubular aggregates protein. J. Gen. Virol. 71:1999-2004.[Abstract/Free Full Text]
44 - Hu, M. C., W. R. Qiu, X. Wang, C. F. Meyer, and T. H. Tan. 1996. Human HPK1, a novel human hematopoietic progenitor kinase that activates the JNK/SAPK kinase cascade. Genes Dev. 10:2251-2264.[Abstract/Free Full Text]
45 - Huen, D. S., S. A. Henderson, D. Croom-Carter, and M. Rowe. 1995. The Epstein-Barr virus latent membrane protein-1 (LMP1) mediates activation of NF-
B and cell surface phenotype via two effector regions in its carboxy-terminal cytoplasmic domain. Oncogene 10:549-560.[Medline]
46 - Hurley, E. A., L. D. Klaman, S. Agger, J. B. Lawrence, and D. A. Thorley-Lawson. 1991. The prototypical Epstein-Barr virus-transformed lymphoblastoid cell line IB4 is an unusual variant containing integrated but no episomal viral DNA. J. Virol. 65:3958-3963.[Abstract/Free Full Text]
47 - Hurley, E. A., and D. A. Thorley-Lawson. 1988. B cell activation and the establishment of Epstein-Barr virus latency. J. Exp. Med. 168:2059-2075.[Abstract/Free Full Text]
48 - Iyer, V. R., M. B. Eisen, D. T. Ross, G. Schuler, T. Moore, J. C. Lee, J. M. Trent, L. M. Staudt, J. Hudson, Jr., M. S. Boguski, D. Lashkari, D. Shalon, D. Botstein, and P. O. Brown. 1999. The transcriptional program in the response of human fibroblasts to serum. Science 283:83-87.[Abstract/Free Full Text]
49 - Izumi, K. M., K. M. Kaye, and E. D. Kieff. 1997. The Epstein-Barr virus LMP1 amino acid sequence that engages tumor necrosis factor receptor associated factors is critical for primary B lymphocyte growth transformation. Proc. Natl. Acad. Sci. USA 94:1447-1452.[Abstract/Free Full Text]
50 - Izumi, K. M., and E. D. Kieff. 1997. The Epstein-Barr virus oncogene product latent membrane protein 1 engages the tumor necrosis factor receptor-associated death domain protein to mediate B lymphocyte growth transformation and activate NF-
B. Proc. Natl. Acad. Sci. USA 94:12592-12597.[Abstract/Free Full Text]
51 - Johannes, G., M. S. Carter, M. B. Eisen, P. O. Brown, and P. Sarnow. 1999. Identification of eukaryotic mRNAs that are translated at reduced cap binding complex eIF4F concentrations using a cDNA microarray. Proc. Natl. Acad. Sci. USA 96:13118-13123.[Abstract/Free Full Text]
52 - Johannsen, E., E. Koh, G. Mosialos, X. Tong, E. Kieff, and S. R. Grossman. 1995. Epstein-Barr virus nuclear protein 2 transactivation of the latent membrane protein 1 promoter is mediated by J
and PU.1. J. Virol. 69:253-262.[Abstract]
53 - Johannsen, E., C. L. Miller, S. R. Grossman, and E. Kieff. 1996. EBNA-2 and EBNA-3C extensively and mutually exclusively associate with RBPJ
in Epstein-Barr virus-transformed B lymphocytes. J. Virol. 70:4179-4183.[Abstract]
54 - Kaiser, C., G. Laux, D. Eick, N. Jochner, G. W. Bornkamm, and B. Kempkes. 1999. The proto-oncogene c-myc is a direct target gene of Epstein-Barr virus nuclear antigen 2. J. Virol. 73:4481-4484.[Abstract/Free Full Text]
55 - Kanda, K., B. Kempkes, G. W. Bornkamm, A. von Gabain, and T. Decker. 1999. The Epstein-Barr virus nuclear antigen 2 (EBNA2), a protein required for B lymphocyte immortalization, induces the synthesis of type I interferon in Burkitt's lymphoma cell lines. Biol. Chem. 380:213-221.[CrossRef][Medline]
56 - Kaye, K. M., K. M. Izumi, and E. Kieff. 1993. Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc. Natl. Acad. Sci. USA 90:9150-9154.[Abstract/Free Full Text]
57 - Khan, J., M. L. Bittner, L. H. Saal, U. Teichmann, D. O. Azorsa, G. C. Gooden, W. J. Pavan, J. M. Trent, and P. S. Meltzer. 1999. cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene. Proc. Natl. Acad. Sci. USA 96:13264-13269.[Abstract/Free Full Text]
58 - Kiefer, F., L. A. Tibbles, M. Anafi, A. Janssen, B. W. Zanke, N. Lassam, T. Pawson, J. R. Woodgett, and N. N. Iscove. 1996. HPK1, a hematopoietic protein kinase activating the SAPK/JNK pathway. EMBO J. 15:7013-7025.[Medline]
59 - Kieff, E., and A. B. Rickinson. 2001. Epstein-Barr virus and its replication, p. 2511-2574. In D. Knipe, P. Howley, D. Griffin, M. Martin, R. Lamb, B. Roizman, and S. Straus (ed.), Fields virology, 4th ed., vol. 2. Lippincott-Raven, Philadelphia, Pa.
60 - Kieser, A., E. Kilger, O. Gires, M. Ueffing, W. Kolch, and W. Hammerschmidt. 1997. Epstein-Barr virus latent membrane protein-1 triggers AP-1 activity via the c-Jun N-terminal kinase cascade. EMBO J. 16:6478-6485.[CrossRef][Medline]
61 - Kim, H. S. 1999. Assignment of the human B3-1 gene (PSCDBP) to chromosome 2 band q11.2 by radiation hybrid mapping. Cytogenet. Cell Genet. 84:95.[CrossRef][Medline]
62 - King, W., A. L. Thomas-Powell, N. Raab-Traub, M. Hawke, and E. Kieff. 1980. Epstein-Barr virus RNA. V. Viral RNA in a restringently infected, growth-transformed cell line. J. Virol. 36:506-518.[Abstract/Free Full Text]
63 - Klaman, L. D., and D. A. Thorley-Lawson. 1995. Characterization of the CD48 gene demonstrates a positive element that is specific to Epstein-Barr virus-immortalized B-cell lines and contains an essential NF-
B site. J. Virol. 69:871-881.[Abstract]
64 - Knutson, J. C. 1990. The level of c-fgr RNA is increased by EBNA-2, an Epstein-Barr virus gene required for B-cell immortalization. J. Virol. 64:2530-2536.[Abstract/Free Full Text]
65 - Krauer, K. G., N. Kienzle, D. B. Young, and T. B. Sculley. 1996. Epstein-Barr nuclear antigen-3 and -4 interact with RBP-2N, a major isoform of RBP-J
in B lymphocytes. Virology 226:346-353.[CrossRef][Medline]
66 - Laherty, C. D., H. M. Hu, A. W. Opipari, F. Wang, and V. M. Dixit. 1992. The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expression by activating nuclear factor kappa B. J. Biol. Chem. 267:24157-24160.[Abstract/Free Full Text]
67 - Lay, A. J., X. M. Jiang, O. Kisker, E. Flynn, A. Underwood, R. Condron, and P. J. Hogg. 2000. Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase. Nature 408:869-873.[CrossRef][Medline]
68 - Lee, M. A., M. E. Diamond, and J. L. Yates. 1999. Genetic evidence that EBNA-1 is needed for efficient, stable latent infection by Epstein-Barr virus. J. Virol. 73:2974-2982.[Abstract/Free Full Text]
69 - Lewin, A. R., L. E. Reid, M. McMahon, G. R. Stark, and I. M. Kerr. 1991. Molecular analysis of a human interferon-inducible gene family. Eur. J. Biochem. 199:417-423.[Medline]
70 - Li, J., G. W. Peet, D. Balzarano, X. Li, P. Massa, R. W. Barton, and K. B. Marcu. 2001. Novel NEMO/I
B kinase and NF-
B target genes at the pre-B to immature B cell transition. J. Biol. Chem. 276:18579-18590.[Abstract/Free Full Text]
71 - Liebowitz, D., J. Mannick, K. Takada, and E. Kieff. 1992. Phenotypes of Epstein-Barr virus LMP1 deletion mutants indicate transmembrane and amino-terminal cytoplasmic domains necessary for effects in B-lymphoma cells. J. Virol. 66:4612-4616.[Abstract/Free Full Text]
72 - Lin, J., E. Johannsen, E. Robertson, and E. Kieff. 2002. Epstein-Barr virus nuclear antigen 3C putative repression domain mediates coactivation of the LMP1 promoter with EBNA-2. J. Virol. 76:232-242.[Abstract/Free Full Text]
73 - Longnecker, R., C. L. Miller, X. Q. Miao, B. Tomkinson, and E. Kieff. 1993. The last seven transmembrane and carboxy-terminal cytoplasmic domains of Epstein-Barr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. J. Virol. 67:2006-2013.[Abstract/Free Full Text]
74 - Lu, Y. J., D. Williamson, J. Clark, R. Wang, N. Tiffin, L. Skelton, T. Gordon, R. Williams, B. Allan, A. Jackman, C. Cooper, K. Pritchard-Jones, and J. Shipley. 2001. Comparative expressed sequence hybridization to chromosomes for tumor classification and identification of genomic regions of differential gene expression. Proc. Natl. Acad. Sci. USA 98:9197-9202.[Abstract/Free Full Text]
75 - Ludwig, J., S. Kerscher, U. Brandt, K. Pfeiffer, F. Getlawi, D. K. Apps, and H. Schagger. 1998. Identification and characterization of a novel 9.2-kDa membrane sector-associated protein of vacuolar proton-ATPase from chromaffin granules. J. Biol. Chem. 273:10939-10947.[Abstract/Free Full Text]
76 - Mannick, J. B., J. I. Cohen, M. Birkenbach, A. Marchini, and E. Kieff. 1991. The Epstein-Barr virus nuclear protein encoded by the leader of the EBNA RNAs is important in B-lymphocyte transformation. J. Virol. 65:6826-6837.[Abstract/Free Full Text]
77 - Matsumoto, R., H. Matsumoto, M. Seki, M. Hata, Y. Asano, S. Kanegasaki, R. L. Stevens, and M. Hirashima. 1998. Human ecalectin, a variant of human galectin-9, is a novel eosinophil chemoattractant produced by T lymphocytes. J. Biol. Chem. 273:16976-16984.[Abstract/Free Full Text]
78 - Mendel, D. B., P. A. Khavari, P. B. Conley, M. K. Graves, L. P. Hansen, A. Admon, and G. R. Crabtree. 1991. Characterization of a cofactor that regulates dimerization of a mammalian homeodomain protein. Science 254:1762-1767.[Abstract/Free Full Text]
79 - Milburn, S. C., J. W. Hershey, M. V. Davies, K. Kelleher, and R. J. Kaufman. 1990. Cloning and expression of eukaryotic initiation factor 4B cDNA: sequence determination identifies a common RNA recognition motif. EMBO J. 9:2783-2790.[Medline]
80 - Miller, C. L., A. L. Burkhardt, J. H. Lee, B. Stealey, R. Longnecker, J. B. Bolen, and E. Kieff. 1995. Integral membrane protein 2 of Epstein-Barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity 2:155-166.[CrossRef][Medline]
81 - Mitchell, T., and B. Sugden. 1995. Stimulation of NF-
B-mediated transcription by mutant derivatives of the latent membrane protein of Epstein-Barr virus. J. Virol. 69:2968-2976.[Abstract]
82 - Mosevitsky, M. I., J. P. Capony, G. Skladchikova, V. A. Novitskaya, A. Plekhanov, and V. V. Zakharov. 1997. The BASP1 family of myristoylated proteins abundant in axonal termini. Primary structure analysis and physico-chemical properties. Biochimie 79:373-384.[Medline]
83 - Mosialos, G., M. Birkenbach, R. Yalamanchili, T. VanArsdale, C. Ware, and E. Kieff. 1995. The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 80:389-399.[CrossRef][Medline]
84 - Muslin, A. J., J. W. Tanner, P. M. Allen, and A. S. Shaw. 1996. Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84:889-897.[CrossRef][Medline]
85 - Nitsche, F., A. Bell, and A. Rickinson. 1997. Epstein-Barr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain. J. Virol. 71:6619-6628.[Abstract]
86 - Oliva, D., L. Cali, S. Feo, and A. Giallongo. 1991. Complete structure of the human gene encoding neuron-specific enolase. Genomics 10:157-165.[CrossRef][Medline]
87 - Ounanian, A., B. Guilbert, and J. M. Seigneurin. 1992. Characteristics of Epstein-Barr virus transformed B cell lines from patients with Alzheimer's disease and age-matched controls. Mech. Ageing Dev. 63:105-116.[CrossRef][Medline]
88 - Park, S., Y. I. Kim, B. Kim, C. Seong, Y. Oh, K. Baek, and J. Yoon. 1998. Characterization of bovine and human cDNAs encoding NAP-22 (22 kDa neuronal tissue-enriched acidic protein) homologs. Mol. Cells 8:471-477.[Medline]
89 - Quintrell, N., R. Lebo, H. Varmus, J. M. Bishop, M. J. Pettenati, M. M. Le Beau, M. O. Diaz, and J. D. Rowley. 1987. Identification of a human gene (HCK) that encodes a protein-tyrosine kinase and is expressed in hemopoietic cells. Mol. Cell. Biol. 7:2267-2275.[Abstract/Free Full Text]
90 - Rickinson, A., and E. Kieff. 2001. Epstein-Barr virus, p. 2575-2628. In D. Knipe, P. Howley, D. Griffin, M. Martin, R. Lamb, B. Roizman, and S. Straus (ed.), Fields virology, 4th ed., vol. 2. Lippincott Williams and Wilkins, Philadelphia, Pa.
91 - Robertson, E. S., S. Grossman, E. Johannsen, C. Miller, J. Lin, B. Tomkinson, and E. Kieff. 1995. Epstein-Barr virus nuclear protein 3C modulates transcription through interaction with the sequence-specific DNA-binding protein J
. J. Virol. 69:3108-3116.[Abstract]
92 - Robertson, E. S., B. Tomkinson, and E. Kieff. 1994. An Epstein-Barr virus with a 58-kilobase-pair deletion that includes BARF0 transforms B lymphocytes in vitro. J. Virol. 68:1449-1458.[Abstract/Free Full Text]
93 - Rodriguez, A. M., D. Rodin, H. Nomura, C. C. Morton, S. Weremowicz, and M. C. Schneider. 1997. Identification, localization, and expression of two novel human genes similar to deoxyribonuclease I. Genomics 42:507-513.[CrossRef][Medline]
94 - Rohan, P. J., P. Davis, C. A. Moskaluk, M. Kearns, H. Krutzsch, U. Siebenlist, and K. Kelly. 1993. PAC-1: a mitogen-induced nuclear protein tyrosine phosphatase. Science 259:1763-1766.[Abstract/Free Full Text]
95 - Rowe, M., A. L. Lear, D. Croom-Carter, A. H. Davies, and A. B. Rickinson. 1992. Three pathways of Epstein-Barr virus gene activation from EBNA1-positive latency in B lymphocytes. J. Virol. 66:122-131.[Abstract/Free Full Text]
96 - Sasaki, A., H. Yasukawa, A. Suzuki, S. Kamizono, T. Syoda, I. Kinjyo, M. Sasaki, J. A. Johnston, and A. Yoshimura. 1999. Cytokine-inducible SH2 protein-3 (CIS3/SOCS3) inhibits Janus tyrosine kinase by binding through the N-terminal kinase inhibitory region as well as SH2 domain. Genes Cells 4:339-351.[Abstract]
97 - Schena, M., D. Shalon, R. W. Davis, and P. O. Brown. 1995. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270:467-470.[Abstract/Free Full Text]
98 - Semba, K., M. Nishizawa, N. Miyajima, M. C. Yoshida, J. Sukegawa, Y. Yamanashi, M. Sasaki, T. Yamamoto, and K. Toyoshima. 1986. yes-related protooncogene, syn, belongs to the protein-tyrosine kinase family. Proc. Natl. Acad. Sci. USA 83:5459-5463.[Abstract/Free Full Text]
99 - Shaffer, A. L., A. Rosenwald, E. M. Hurt, J. M. Giltnane, L. T. Lam, O. K. Pickeral, and L. M. Staudt. 2001. Signatures of the immune response. Immunity 15:375-385.[CrossRef][Medline]
100 - Spellman, P. T., G. Sherlock, M. Q. Zhang, V. R. Iyer, K. Anders, M. B. Eisen, P. O. Brown, D. Botstein, and B. Futcher. 1998. Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol. Biol. Cell 9:3273-3297.[Abstract/Free Full Text]
101 - Sugden, B., and S. Metzenberg. 1983. Characterization of an antigen whose cell surface expression is induced by infection with Epstein-Barr virus. J. Virol. 46:800-807.[Abstract/Free Full Text]
102 - Swaminathan, S., B. Tomkinson, and E. Kieff. 1991. Recombinant Epstein-Barr virus with small RNA (EBER) genes deleted transforms lymphocytes and replicates in vitro. Proc. Natl. Acad. Sci. USA 88:1546-1550.[Abstract/Free Full Text]
103 - Takahashi, K., N. Kitamura, T. Shibui, M. Kamizono, R. Matsui, Y. Yoshiyama, T. Maeda, J. Kondo, Y. Honda, E. Yamada, et al. 1990. Cloning, sequencing and expression in Escherichia coli of cDNA for a non-A, non-B hepatitis-associated microtubular aggregates protein. J. Gen. Virol. 71:2005-2011.[Abstract/Free Full Text]
104 - Takeshita, H., T. Yoshizaki, W. E. Miller, H. Sato, M. Furukawa, J. S. Pagano, and N. Raab-Traub. 1999. Matrix metalloproteinase 9 expression is induced by Epstein-Barr virus latent membrane protein 1 C-terminal activation regions 1 and 2. J. Virol. 73:5548-5555.[Abstract/Free Full Text]
105 - Tang, H., T. Matthes, N. Carballido-Perrig, R. H. Zubler, and V. Kindler. 1993. Differential induction of T cell cytokine mRNA in Epstein-Barr virus-transformed B cell clones: constitutive and inducible expression of interleukin-4 mRNA. Eur. J. Immunol. 23:899-903.[Medline]
106 - Thorley-Lawson, D. A., L. M. Nadler, A. K. Bhan, and R. T. Schooley. 1985. BLAST-2 [EBVCS], an early cell surface marker of human B cell activation, is superinduced by Epstein Barr virus. J. Immunol. 134:3007-3012.[Abstract]
107 - Thorley-Lawson, D. A., R. T. Schooley, A. K. Bhan, and L. M. Nadler. 1982. Epstein-Barr virus superinduces a new human B cell differentiation antigen (B-LAST 1) expressed on transformed lymphoblasts. Cell 30:415-425.[CrossRef][Medline]
108 - Tomkinson, B., and E. Kieff. 1992. Use of second-site homologous recombination to demonstrate that Epstein-Barr virus nuclear protein 3B is not important for lymphocyte infection or growth transformation in vitro. J. Virol. 66:2893-2903.[Abstract/Free Full Text]
109 - Tomkinson, B., E. Robertson, and E. Kieff. 1993. Epstein-Barr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation. J. Virol. 67:2014-2025.[Abstract/Free Full Text]
110 - Torsteinsdottir, S., M. L. Andersson, J. Avila-Carino, B. Ehlin-Henriksson, M. G. Masucci, G. Klein, and E. Klein. 1989. Reversion of tumorigenicity and decreased agarose clonability after EBV conversion of an IgH/myc translocation-carrying BL line. Int. J. Cancer. 43:273-278.[Medline]
111 - Turk, V., and W. Bode. 1991. The cystatins: protein inhibitors of cysteine proteinases. FEBS Lett. 285:213-219.[CrossRef][Medline]
112 - Velazquez, L., M. Fellous, G. R. Stark, and S. Pellegrini. 1992. A protein tyrosine kinase in the interferon alpha/beta signaling pathway. Cell 70:313-322.[CrossRef][Medline]
113 - Waltzer, L., F. Logeat, C. Brou, A. Israel, A. Sergeant, and E. Manet. 1994. The human J
recombination signal sequence binding protein (RBP-J
) targets the Epstein-Barr virus EBNA2 protein to its DNA responsive elements. EMBO J. 13:5633-5638.[Medline]
114 - Wang, D., D. Liebowitz, F. Wang, C. Gregory, A. Rickinson, R. Larson, T. Springer, and E. Kieff. 1988. Epstein-Barr virus latent infection membrane protein alters the human B-lymphocyte phenotype: deletion of the amino terminus abolishes activity. J. Virol. 62:4173-4184.[Abstract/Free Full Text]
115 - Wang, F., C. Gregory, C. Sample, M. Rowe, D. Liebowitz, R. Murray, A. Rickinson, and E. Kieff. 1990. Epstein-Barr virus latent membrane protein (LMP1) and nuclear proteins 2 and 3C are effectors of phenotypic changes in B lymphocytes: EBNA-2 and LMP1 cooperatively induce CD23. J. Virol. 64:2309-2318.[Abstract/Free Full Text]
116 - Wang, F., C. D. Gregory, M. Rowe, A. B. Rickinson, D. Wang, M. Birkenbach, H. Kikutani, T. Kishimoto, and E. Kieff. 1987. Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23. Proc. Natl. Acad. Sci. USA 84:3452-3456.[Abstract/Free Full Text]
117 - Ward, Y., S. Gupta, P. Jensen, M. Wartmann, R. J. Davis, and K. Kelly. 1994. Control of MAP kinase activation by the mitogen-induced threonine/tyrosine phosphatase PAC1. Nature 367:651-654.[CrossRef][Medline]
118 - Yablonski, D., and A. Weiss. 2001. Mechanisms of signaling by the hematopoietic-specific adaptor proteins, SLP-76 and LAT and their B cell counterpart, BLNK/SLP-65. Adv. Immunol. 79:93-128.[Medline]
119 - Yalamanchili, R., X. Tong, S. Grossman, E. Johannsen, G. Mosialos, and E. Kieff. 1994. Genetic and biochemical evidence that EBNA 2 interaction with a 63-kDa cellular GTG-binding protein is essential for B lymphocyte growth transformation by EBV. Virology 204:634-641.[CrossRef][Medline]
120 - Yokoyama, S., D. Staunton, R. Fisher, M. Amiot, J. J. Fortin, and L. D. Thorley. 1991. Expression of the Blast-1 activation/adhesion molecule and its identification as CD48. J. Immunol. 146:2192-2200.[Abstract]
121 - Yu, J., C. Riou, D. Davidson, R. Minhas, J. D. Robson, M. Julius, R. Arnold, F. Kiefer, and A. Veillette. 2001. Synergistic regulation of immunoreceptor signaling by SLP-76-related adaptor Clnk and serine/threonine protein kinase HPK-1. Mol. Cell. Biol. 21:6102-6112.[Abstract/Free Full Text]
122 - Zeng, Z., D. Parmelee, H. Hyaw, T. A. Coleman, K. Su, J. Zhang, R. Gentz, S. Ruben, C. Rosen, and Y. Li. 1997. Cloning and characterization of a novel human DNase. Biochem. Biophys. Res. Commun. 231:499-504.[CrossRef][Medline]
123 - Zhao, B., D. R. Marshall, and C. E. Sample. 1996. A conserved domain of the Epstein-Barr virus nuclear antigens 3A and 3C binds to a discrete domain of J
. J. Virol. 70:4228-4236.[Abstract]
124 - Zhu, H., J. P. Cong, and T. Shenk. 1997. Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs. Proc. Natl. Acad. Sci. USA 94:13985-13990.[Abstract/Free Full Text]
125 - Ziegler, S. F., J. D. Marth, D. B. Lewis, and R. M. Perlmutter. 1987. Novel protein-tyrosine kinase gene (hck) preferentially expressed in cells of hematopoietic origin. Mol. Cell. Biol. 7:2276-2285.[Abstract/Free Full Text]
Journal of Virology, October 2002, p. 10427-10436, Vol. 76, No. 20
0022-538X/02/$04.00+0 DOI: 10.1128/JVI.76.20.10427-10436.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Bullaughey, K., Chavarria, C. I., Coop, G., Gilad, Y.
(2009). Expression quantitative trait loci detected in cell lines are often present in primary tissues. Hum Mol Genet
18: 4296-4303
[Abstract]
[Full Text]
-
Honma, K., Tsuzuki, S., Nakagawa, M., Tagawa, H., Nakamura, S., Morishima, Y., Seto, M.
(2009). TNFAIP3/A20 functions as a novel tumor suppressor gene in several subtypes of non-Hodgkin lymphomas. Blood
114: 2467-2475
[Abstract]
[Full Text]
-
Zhang, W., Zeng, Z., Zhou, Y., Xiong, W., Fan, S., Xiao, L., Huang, D., Li, Z., Li, D., Wu, M., Li, X., Shen, S., Wang, R., Cao, L., Tang, K., Li, G.
(2009). Identification of aberrant cell cycle regulation in Epstein-Barr virus-associated nasopharyngeal carcinoma by cDNA microarray and gene set enrichment analysis. Acta Biochim Biophys Sin
41: 414-428
[Abstract]
[Full Text]
-
Klibi, J., Niki, T., Riedel, A., Pioche-Durieu, C., Souquere, S., Rubinstein, E., Le Moulec, S., Guigay, J., Hirashima, M., Guemira, F., Adhikary, D., Mautner, J., Busson, P.
(2009). Blood diffusion and Th1-suppressive effects of galectin-9-containing exosomes released by Epstein-Barr virus-infected nasopharyngeal carcinoma cells. Blood
113: 1957-1966
[Abstract]
[Full Text]
-
Xu, D., Zhao, L., Del Valle, L., Miklossy, J., Zhang, L.
(2008). Interferon Regulatory Factor 4 Is Involved in Epstein-Barr Virus-Mediated Transformation of Human B Lymphocytes. J. Virol.
82: 6251-6258
[Abstract]
[Full Text]
-
Xing, L., Kieff, E.
(2007). Epstein-Barr Virus BHRF1 Micro- and Stable RNAs during Latency III and after Induction of Replication. J. Virol.
81: 9967-9975
[Abstract]
[Full Text]
-
Pegtel, D. M., Subramanian, A., Meritt, D., Tsai, C.-H., Sheen, T.-S., Golub, T. R., Thorley-Lawson, D. A.
(2007). IFN-{alpha}-Stimulated Genes and Epstein-Barr Virus Gene Expression Distinguish WHO Type II and III Nasopharyngeal Carcinomas. Cancer Res.
67: 474-481
[Abstract]
[Full Text]
-
Dinarello, C A, Kim, S-H
(2006). IL-32, a novel cytokine with a possible role in disease. Ann Rheum Dis
65: iii61-iii64
[Abstract]
[Full Text]
-
Maier, S., Staffler, G., Hartmann, A., Hock, J., Henning, K., Grabusic, K., Mailhammer, R., Hoffmann, R., Wilmanns, M., Lang, R., Mages, J., Kempkes, B.
(2006). Cellular Target Genes of Epstein-Barr Virus Nuclear Antigen 2. J. Virol.
80: 9761-9771
[Abstract]
[Full Text]
-
Xu, D., Brumm, K., Zhang, L.
(2006). The Latent Membrane Protein 1 of Epstein-Barr Virus (EBV) Primes EBV Latency Cells for Type I Interferon Production. J. Biol. Chem.
281: 9163-9169
[Abstract]
[Full Text]
-
Zhao, B., Maruo, S., Cooper, A., R. Chase, M., Johannsen, E., Kieff, E., Cahir-McFarland, E.
(2006). RNAs induced by Epstein-Barr virus nuclear antigen 2 in lymphoblastoid cell lines. Proc. Natl. Acad. Sci. USA
103: 1900-1905
[Abstract]
[Full Text]
-
Goda, C., Kanaji, T., Kanaji, S., Tanaka, G., Arima, K., Ohno, S., Izuhara, K.
(2006). Involvement of IL-32 in activation-induced cell death in T cells. Int Immunol
18: 233-240
[Abstract]
[Full Text]
-
Lua, D. T., Yasuike, M., Hirono, I., Aoki, T.
(2005). Transcription Program of Red Sea Bream Iridovirus as Revealed by DNA Microarrays. J. Virol.
79: 15151-15164
[Abstract]
[Full Text]
-
Zhang, J., Wang, J., Wood, C., Xu, D., Zhang, L.
(2005). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Replication and Transcription Activator Regulates Viral and Cellular Genes via Interferon-Stimulated Response Elements. J. Virol.
79: 5640-5652
[Abstract]
[Full Text]
-
Najjar, I., Baran-Marszak, F., Le Clorennec, C., Laguillier, C., Schischmanoff, O., Youlyouz-Marfak, I., Schlee, M., Bornkamm, G. W., Raphael, M., Feuillard, J., Fagard, R.
(2005). Latent Membrane Protein 1 Regulates STAT1 through NF-{kappa}B-Dependent Interferon Secretion in Epstein-Barr Virus-Immortalized B Cells. J. Virol.
79: 4936-4943
[Abstract]
[Full Text]
-
Zhang, J., Das, S. C., Kotalik, C., Pattnaik, A. K., Zhang, L.
(2004). The Latent Membrane Protein 1 of Epstein-Barr Virus Establishes an Antiviral State via Induction of Interferon-stimulated Genes. J. Biol. Chem.
279: 46335-46342
[Abstract]
[Full Text]
-
Rieger, K. E., Chu, G.
(2004). Portrait of transcriptional responses to ultraviolet and ionizing radiation in human cells. Nucleic Acids Res
32: 4786-4803
[Abstract]
[Full Text]
-
Cahir-McFarland, E. D., Carter, K., Rosenwald, A., Giltnane, J. M., Henrickson, S. E., Staudt, L. M., Kieff, E.
(2004). Role of NF-{kappa}B in Cell Survival and Transcription of Latent Membrane Protein 1-Expressing or Epstein-Barr Virus Latency III-Infected Cells. J. Virol.
78: 4108-4119
[Abstract]
[Full Text]
-
DeBiasi, R. L., Clarke, P., Meintzer, S., Jotte, R., Kleinschmidt-Demasters, B. K., Johnson, G. L., Tyler, K. L.
(2003). Reovirus-Induced Alteration in Expression of Apoptosis and DNA Repair Genes with Potential Roles in Viral Pathogenesis. J. Virol.
77: 8934-8947
[Abstract]
[Full Text]