Previous Article | Next Article 
Journal of Virology, October 2002, p. 10099-10108, Vol. 76, No. 20
0022-538X/02/$04.00+0 DOI: 10.1128/JVI.76.20.10099-10108.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Quantitation of Human Immunodeficiency Virus Type 1 DNA Forms with the Second Template Switch in Peripheral Blood Cells Predicts Disease Progression Independently of Plasma RNA Load
Leondios G. Kostrikis,1* Giota Touloumi,1 Rose Karanicolas,2 Nikos Pantazis,1 Cleo Anastassopoulou,1 Anastasia Karafoulidou,3 James J. Goedert,4 Angelos Hatzakis,1 and for the Multicenter Hemophilia Cohort Study Group
Department of Hygiene and Epidemiology, Athens University Medical School,1
Hemophilia Center, Laikon Hospital, Athens, Greece,3
College of Physicians and Surgeons, Columbia University, New York, New York,2
Viral Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, Rockville, Maryland4
Received 8 March 2002/
Accepted 1 July 2002

ABSTRACT
There are several forms of human immunodeficiency virus type
1 (HIV-1) DNA in peripheral blood T cells and lymph nodes in
untreated HIV-1-infected individuals and in patients whose plasma
HIV-1 RNA levels are suppressed by long-term combination antiretroviral
therapy. However, it remains to be established whether the concentration
of HIV-1 DNA in cells predicts the clinical outcome of HIV-1
infection. In this report, we measured the concentration of
HIV-1 DNA forms which has undergone the second template switch
(STS DNA) and 2-long-terminal-repeat DNA circles in peripheral
blood mononuclear cell (PBMC) samples. To do this, we used molecular-beacon-based
real-time PCR assays and studied 130 patients with hemophilia
in the Multicenter Hemophilia Cohort Study. We assessed the
influence of baseline HIV-1 STS DNA levels on the progression
of HIV-1 disease in the absence of combination antiretroviral
therapy by Kaplan-Meier and Cox regression analysis. Among the
patients who progressed to AIDS, the median levels (interquartile
ranges) of STS HIV-1 DNA in PBMC were significantly higher than
those of patients who remained AIDS free during the 16 years
of follow-up (1,017 [235 to 6,059] and 286 [31 to 732] copies
per 10
6 PBMC, respectively;
P < 0.0001). Rates of progression
to death and development of AIDS varied significantly (log rank
P < 0.001) by quartile distribution of HIV-1 STS DNA levels.
After adjustment for age at seroconversion, baseline CD4
+ T-cell
counts, plasma viral load, and T-cell-receptor excision circles,
the relative hazards (RH) of death and AIDS were significantly
increased with higher HIV-1 STS DNA levels (adjusted RH, 1.84
[95% confidence interval {CI}, 1.30 to 2.59] and 2.62 [95% CI,
1.75 to 3.93] per 10-fold increase per 10
6 PBMC, respectively).
HIV-1 STS DNA levels in each individual remained steady in longitudinal
PBMC samples during 16 years of follow-up. Our findings show
that the concentration of HIV-1 STS DNA in PBMC complements
the HIV-1 RNA load in plasma in predicting the clinical outcome
of HIV-1 disease. This parameter may have important implications
for understanding the virological response to combination antiretroviral
therapy.

INTRODUCTION
The rate of progression of human immunodeficiency virus type
1 (HIV-1) disease is highly variable among patients not receiving
potent antiretroviral therapy (
34,
48). Previous epidemiological
studies on untreated HIV-1-infected individuals have revealed
that viral load (
37,
38,
45,
52), host factors (
17,
22,
27,
43,
44), and age at HIV-1 antibody seroroconversion (
13) are
associated with the variation in disease progression, with plasma
HIV-1 RNA load being the most effective independent predictor
of the rate of progression of HIV-1 disease (
37,
38). The plasma
HIV-1 RNA load is now widely considered a direct indicator of
the overall level of HIV-1 expression in infected individuals.
Commercially available assays for measuring the plasma viral
load (
12,
41,
61) are currently being used to monitor disease
progression in HIV-1-infected patients receiving potent antiretroviral
therapy and to assess the efficacy of new antiretroviral regimens
to treat HIV-1 infection (
18,
21). Most current antiretroviral
protocols utilizing drugs that inhibit the HIV-1 reverse transcriptase
and protease proteins suppress the replicative ability of HIV-1
to such an extent that circulating HIV-1 in plasma becomes undetectable
by the most sensitive viral RNA detection assays (
18,
21). Several
studies have revealed that there is a direct relationship between
reduction in HIV-1 replication as evidenced by plasma HIV-1
RNA concentrations and inhibition of progression of HIV-1 disease
(
25,
29,
30,
46,
47,
49-
51). However, in HIV-1-infected individuals
who have prolonged suppression of HIV-1 replication by antiretroviral
therapy, peripheral blood mononuclear cells (PMBC), lymphoid
tissues, and semen may still contain HIV-1 DNA (
9,
14,
63,
64,
66), replication-competent virus (
14,
64,
66), and viral products
indicative of persistent HIV-1 replication (
54) and transcription
(
15).
Over the past decade, numerous PCR-based methodologies for quantifying cell-associated HIV-1 DNA have been described in various formats (1, 2, 5, 11, 16, 19, 28, 35, 36, 39, 40, 53, 62, 65), some of which have been used to measure the decay characteristics of HIV-1 DNA in individuals whose plasma virus levels are suppressed by antiretroviral therapy (3, 42, 55). Several PCR-based assays to quantify integrated HIV-1 DNA levels in HIV-1-infected cell cultures and patients have been described recently (4, 6, 9, 59). Some of these methodologies have been utilized in studies aimed at elucidating whether long-term suppression of HIV-1 replication can reduce levels of integrated HIV-1 (6-9, 14, 15, 26). Other applications include studies to establish the kinetics of HIV-1 DNA integration (4, 59) and to evaluate the ability of newly developed inhibitors of HIV-1 integrase to obstruct integration in cell culture (60). Despite the growing number of studies involving quantification of cellular HIV-1 DNA, some of the methodologies used either are semiquantitative, have a restricted dynamic range, require laborious post-PCR analytical procedures, or utilize genomic equivalent markers present at an imprecise number of copies per cell to determine the exact number of cells in a sample. Although it is generally recognized that accurate quantification of HIV-1 DNA in peripheral blood cells and tissues is important for monitoring disease progression in patients receiving antiretroviral therapy, it remains to be determined whether the prognosis of HIV-1 infection is associated with the quantity of HIV-1 DNA in cells.
Following reverse transcription of the viral RNA genome, the HIV-1 RNA must be reverse transcribed to linear double-stranded DNA (dsDNA) prior to integration of the proviral HIV-1 DNA genome into the human chromosome. To accomplish a successful reverse transcription, HIV-1 undergoes two template switches by using the R and U5 long terminal repeat (LTR) regions and the primer-binding site (PBS) of its genome. In this study, we report an assay, which is based on real-time PCR and the molecular-beacon detection system, that quantifies PBMC-associated HIV-1 DNA forms that have undergone the second template switch (HIV-1 STS DNA). The HIV-1 STS DNA assay mainly detects a pool of HIV-1 forms that includes unintegrated and integrated linear dsDNA viral genomes and 1- and 2-LTR circles (LTRC and 2LTRC). In contrast, the existing 2LTRC-specific assay quantifies only 2LTRC, as previously described (17, 54, 58).
By using the STS DNA- and 2LTRC-specific assays coupled with a CCR5-specific real-time PCR assay that quantifies genomic equivalent markers with known numbers of copies in human cells, we quantified HIV-1 STS and 2LTRC DNAs in PBMC for a cohort of longitudinally studied HIV-1-infected hemophiliacs. The STS DNA and 2LTRC measurements were used to determine the relationships between STS DNA and 2LTRC in PBMC and HIV-1 RNA in plasma, to study the kinetics of cellular STS DNA throughout the natural history of HIV-1 infection, and to establish the relationship between the PBMC-associated HIV-1 STS DNA load and clinical outcome in untreated HIV-1 infection.

MATERIALS AND METHODS
Study patients.
All clinical samples were obtained from HIV-1-infected Greek
study participants enrolled in the Multicenter Hemophilia Cohort
Study (MHCS). The Greek component of MHCS consists of 158 white
HIV-1-infected hemophiliac men with known HIV-1 antibody seroconversion
dates; they have been prospectively monitored for more than
18 years after seroconversion. Clinical and laboratory data
were collected for each patient approximately every 6 months
(
56). For 131 subjects of this cohort, plasma HIV-1 RNA loads
and levels of T-cell-receptor excision DNA circles (TREC) taken
during the early chronic infection period were shown to be predictive
of the progression of HIV-1 disease (
22). STS and 2LTRC HIV-1
DNA concentrations were measured in cryopreserved PBMC samples
isolated closest to the HIV-1 antibody seroconversion date.
In longitudinal studies, STS DNA levels were determined in 655
available cryopreserved PBMC samples isolated from all participants
before the initiation of highly effective antiretroviral therapy.
Long-term nonprogressors were selected based on the absence
of clinical AIDS and high CD4 T-cell counts (more than 500 cells/µl
for at least 10 years after HIV-1 antibody seroconversion),
and progressors, who developed AIDS during follow-up, were randomly
selected. Plasma HIV-1 RNA levels were measured with the ultrasensitive
HIV-1 Amplicor Monitor assay (Roche Diagnostics, Alameda, Calif.),
which has a detection limit of 50 HIV-1 RNA copies/ml. CD4 T-cell
counts were measured by flow cytometry with standard procedures.
Quantitation of PBMC-associated HIV-1 STS and 2LTRC DNAs.
The schematic outline in Fig. 1 illustrates the major HIV-1 DNA structures formed during reverse transcription and the strategy for STS- and 2LTRC-specific assays. To uniquely detect DNA structures that have completed the two template switches, we designed a real-time PCR assay with PCR primers that direct the amplification of viral sequences between the 5' R-LTR region and the 5' gag gene (4). This assay measures only HIV-1 DNA structures that have undergone both single-stranded DNA (ssDNA) template switches, including unintegrated and integrated linear viral genomes as well as LTRC and 2LTRC. The 2LTRC-specific assay is based on amplification of a region spanning the 5'- and 3'-end LTR ligation as previously described (54, 58). To count the number of cells in the input DNA, we used a molecular-beacon- and real-time PCR-based assay to quantify a region of the human CCR5 gene adjacent to the
32 deletion, which exists at 2 copies per cell (data not shown).
To quantify the concentrations of HIV-1 STS DNA and 2LTRC per
cell, we designed two molecular-beacon real-time PCR assays
by using the general method of quantifying single sequences
with nucleotide-specific molecular beacons (
57) and real-time
PCR (
23) as we have previously described (
22). Genomic DNA was
isolated from uncultured PBMC by standard procedures. HIV-1
STS DNA was quantified by amplifying a region spanning the LTR-U5
and
gag regions. The sequence of the
gag-specific molecular
beacon was fluorescein-5'-
CCGGTCTCCCCCGCTTAATACTGACGCTCTC
GACCGG-3'-dabcyl,
where dabcyl is the quencher 4-(4'-dimethylamino phenylazo)benzoic
acid (underlining indicates the complementary sequences forming
the hairpin structure). The target recognition sequence for
the molecular beacon was 5'-CGAGAGCGTCAGTATTAAGCGGGGGAGA-3'
(at positions 797 to 824 of the
gag region of the HXB2 sequence).
Primers used in the real-time PCR were 5'-GCCTCAATAAAGCTTGCCTTGAGTG-3'
(at positions 522 to 546 of the LTR-R region) and 5'-GTTCTTCTGATCCTGTCTGAAGGG-3'
(at positions 989 to 1012 of the
gag region). HIV-1 DNAs of
circularized HIV-1 genomes containing 2 LTRs (2LTRC) were quantified
by amplifying a region spanning the 5'- and 3'-end LTR ligation
as previously described (
54). The sequence of the LTR-U5-specific
molecular beacon was fluorescein-5'-
GCGGGTTCTGAGGGATCTCTAGTTACCAG
ACCCGC-3'-dabcyl.
The target recognition sequence for the molecular beacon was
5'-TCTGGTAACTAGAGATCCCTCAGA-3' (at positions 580 to 603 of the
LTR-U5 region of the HXB2 sequence). Primers used in the real-time
PCR were 5'-GGTACTAGCTTGAAGCACCATCC-3' (at positions 129 to
151 of the LTR-U3 region) and LK164 5'-GCCTCAATAAAGCTTGCCTTGAGTG-3'
(at positions 522 to 546 of the LTR-R region). The PCR primers
and the target recognition sequence of the molecular beacon
were designed to hybridize on conserved regions from all the
genetic subtypes within the M group based on a comprehensive
DNA sequence alignment from published HIV-1 sequences. HIV-1
STS and 2LTRC amplicons were sequenced and found to contain
the correct U5-
gag and R-U5-U3 regions, respectively. Each 50-µl
PCR mixture contained 0.5 to 5.0 µg of genomic DNA, 0.25
µM each molecular beacon, 0.5 µM each primer, 0.25
mM dATP, 0.25 mM dCTP, 0.25 mM dGTP, 0.25 mM dTTP, 2.5 U of
AmpliTaq Gold DNA polymerase (Perkin-Elmer), 50 mM KCl, 3.5
mM MgCl
2, and 10 mM Tris-HCl (pH 8.3). One cycle of denaturation
(94°C for 10 min), followed by 40 cycles of amplification
(denaturation at 94°C for 15 s, annealing and data collection
at 60°C for 30 s, and polymerization at 72°C for 30
s), was performed in a spectrofluorometric thermal cycler (ABI
7700; Applied Biosystems).
To quantify the cell equivalents in the input genomic DNA, we used a molecular-beacon-based real-time PCR assay with primers and probe within the CCR5 coding region, because it is known that this gene is present at only 2 copies per cell (L. G. Kostrikis, unpublished data). The genomic equivalent number was determined in each cell aliquot by real-time PCR using the CCR5 molecular beacon tetrachloro-fluorescein-5'-GCGCCTATGACAAGCAGCGGCAGGAGGCGC-3'-dabcyl. Primers used in the real-time PCR were 5'-GCTGTGTTTGCGTCTCTCCCAGGA-3' and 5'-CTCACAGCCCTGTGCCTCTTCTTC-3'. The target recognition sequence for the molecular beacon (5'-TCCTGCCGCT GCTTGTCAT-3') is adjacent to the
32 deletion of CCR5 and therefore recognizes both the wild-type CCR5 and mutant CCR5
32 alleles. Each 50-µl PCR mixture contained 0.5 to 5.0 µg of genomic DNA, 0.25 µM each molecular beacon, 0.5 µM each primer, 0.25 mM dATP, 0.25 mM dCTP, 0.25 mM dGTP, 0.25 mM dTTP, 2.5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer), 3.5 mM MgCl2, and 10 mM Tris-HCl (pH 8.3). One cycle of denaturation (94°C for 10 min), followed by 40 cycles of amplification (denaturation at 94°C for 15 s, annealing and data collection at 60°C for 30 s, and polymerization at 72°C for 30 s), was performed. Real-time PCR amplifications were performed in a spectrofluorometric thermal cycler (ABI 7700; Applied Biosystems).
DNA standards.
The DNA external standards used in the three real-time PCR assays were STS DNA, 2LTRC, and CCR5 amplicons with known nucleotide lengths and base compositions, which contain within them the amplicons utilized in the real-time PCR assays. Each amplicon was purified by gel filtration twice to remove excess PCR primers, deoxynucleoside triphosphates, and polymerase, and the amplicon length was compared to dsDNA standards with known lengths by agarose gel electrophoresis. The concentrations of the purified STS DNA, 2LTRC, and CCR5 amplicons were quantified by UV absorbance spectrophotometry using a Cary 219 spectrophotometer. Wavelength accuracy was ±0.2 nm, and wavelength repeatability was within ±0.05 nm. Spectra of DNA in neutral aqueous buffer (10 mM Tris-HCl-0.1 mM EDTA [pH 7.0]) were recorded from 340 to 250 nm at scan rates of 0.5 to 1.0 nm/s, at a period of 0.5 s, and at a slit width of 1.0 nm. Concentrations of purified DNA with negligible (optical density cm-1, <10-4) light scattering for a
of >320 nm were determined with a scatter-corrected absorbance coefficient of 19.98 mg-1 cm2 at 260 nm. Tenfold serial dilutions of the purified dsDNA transcripts with known molar concentrations were used as standard templates to generate the standard curves in the selective amplification assays using molecular-beacon-based real-time PCR. The slope and correlation coefficient of each standard curve were calculated based on the average threshold cycle (CT) values measured in eight replicates for each dilution point ranging from 106 to 101 DNA templates. The PCR efficiency, E, corresponding to the experimentally derived dynamic range was computed as (10-1/s - 1) x 100, where s is the slope of the standard curve generated.
During the molecular-beacon annealing stage of each PCR cycle, the fluorescence emission spectrum in each sample was automatically recorded from 500 to 650 nm. After completion of the PCR, each spectrum generated was decomposed into prerecorded fluorescein (specific for HIV-1 STS DNA or 2LTRC) and tetrachloro-fluorescein (specific for CCR5) reference spectra. In each experiment, standard curves for HIV-1 STS or 2LTRC and human CCR5 templates were run in duplicate by using six serial dilutions, ranging from 106 to 101 copies, for each DNA template and a no-template negative control. Changes in the emission spectra during amplification were compared with those from control STS DNA, 2LTRC, or CCR5 samples with known concentrations of initial DNA templates. In each genomic DNA sample, the number of cells was quantified as 1 cell per 2 CCR5 copies, because there is experimental evidence that the CCR5 amplicon used in the assay is present at 2 copies per human cell (data not shown), and the HIV-1 STS DNA and 2LTRC levels were calculated per 106 PBMC.
Statistical analysis.
Median levels and interquartile ranges (IQR) of HIV-1 STS DNA and 2LTRC were determined. Spearman correlations were used to evaluate the relationships between HIV-1 STS DNA levels, plasma HIV-1 RNA levels, TREC levels, and CD4 T-cell counts. The relative prognostic values of baseline HIV-1 STS DNA and 2LTRC levels with regard to death and development of clinical AIDS were investigated. Kaplan-Meier survival curves were used to estimate the cumulative incidence of an end point, and the log rank test was used to compare survival curves among different groups. Cox proportional-hazard models for death and AIDS risk were constructed using continuous measures of log10-transformed HIV-1 STS DNA, TREC, and plasma RNA levels and untransformed CD4 T-cell counts. The cohort was analyzed as seroincident (the HIV-1 seroconversion date was used as time zero) by using Cox proportional-hazard models with allowance for late entry; that is, participants entered into the risk set at the time they were first tested for HIV-1 STS DNA and 2LTRC. Temporal trends in STS DNA values were described by fitting random-effects models. These models provide estimates of average marker trends while accounting for correlation of repeated measurements within each individual.

RESULTS
Characteristics of real-time PCR assays for quantifying HIV-1 STS and 2LTRC DNAs in PBMC.
We have established that the STS DNA, 2LTRC, and CCR5 assays
are specific and can accurately detect 10 DNA copies with a
6-log
10 linear dynamic range. The coefficients of variation
were below 20% for 10
6 copies and below 30% for 10
1 copies.
The slopes of the standard curves (Fig.
2) were between -3.6
and -3.4 cycles/log
10 DNA templates, corresponding to PCR efficiencies
between 90 and 97%. The capability of the STS DNA assay to detect
HIV-1 strains within the M group was evaluated by using DNA
extracted from primary PBMC samples isolated from patients infected
with HIV-1 strains from genetic subtypes A, B, C, D, and E and
two recombinant strains. As expected, based on the designs of
the PCR primers and molecular beacon, the 5'-R-U5-
gag regions
could be amplified from all strains (data not shown). The specificities
of the STS DNA and 2LTRC assays against human genomic DNA were
examined by using DNA extracted from individuals who were not
infected with HIV-1; the results were negative, with no detectable
signals after 50 cycles (data not shown).
The analytical sensitivities of STS DNA- and 2LTRC-specific
assays were assessed overall in 743 PBMC samples isolated from
Greek individuals in the MHCS and 208 samples taken from the
entire MHCS during early chronic infection and prior to effective
antiretroviral therapy. Eighty-seven (87%) of the 951 PBMC samples
taken prior to effective antiretroviral therapy had positive
values for STS DNA (>10 copies/10
6 PBMC), and 31 (31%) of
the samples had positive values for 2LTRC (>10 copies/10
6 PBMC). Median values were 451 copies/10
6 PBMC for STS DNA and
<10 copies/10
6 PBMC for 2LTRC.
Baseline values of HIV-1 STS and 2LTRC DNAs.
Quantities of STS DNA and 2LTRC in PBMC were assessed for 130 individuals in the Greek MHCS. The median time between HIV-1 antibody seroconversion and the first PBMC isolation (baseline) was 6.7 years (range, 3.4 to 12.9 years). The mean age (± standard deviation) of the subjects at baseline was 30.4 (±13.7) years (range, 7 to 66 years). Three subjects who had developed AIDS by the time of the first PBMC isolation, with corresponding STS DNA levels of 916, 572, and 47 copies/106 PBMC, were excluded from further analysis. Of the remaining 127 participants, 14 had fewer than 10 STS DNA copies/106 PBMC, with a median CD4 T-cell count of 679 (IQR, 360 to 702) cells/µl.
At baseline, the median HIV-1 STS DNA level for subjects without clinical AIDS was 443 copies/106 PBMC (IQR, 123 to 1,505 copies/106 PBMC) (Fig. 3A). We have found that there was no significant association between STS DNA levels and age at time of PBMC isolation. The corresponding median CD4 T-cell count was 320 cells/µl (IQR, 204 to 563 cells/µl), and the median HIV RNA level was 17,850 copies/ml (IQR, 4,580 to 59,860 copies/ml). Of the 127 subjects, only 20 (16.5%) had detectable 2LTRC levels. The median 2LTRC level was <10 copies/106 PBMC (range, <10 to 98 copies/106 PBMC). STS DNA levels were moderately correlated with plasma HIV-1 RNA levels (Spearman's r = 0.38; P < 0.001) (Fig. 3B) and weakly correlated with CD4 T-cell counts (Spearman's r = -0.24; P = 0.007) (Fig. 3C). The majority of subjects with detectable 2LTRC levels (>10 copies/106 PBMC) had high STS DNA levels (>103 copies/106 PBMC) and tended to cluster at higher plasma HIV-1 RNA levels and lower CD4 T-cell counts (Fig. 3B and C).
Effects of HIV-1 STS DNA and 2LTRC levels on the progression of untreated HIV-1 disease.
Among the 127 participants without clinical AIDS at baseline,
STS DNA levels were higher in the 54 subjects who progressed
to AIDS than in those who remained AIDS free. The corresponding
median levels were 1,017 (IQR, 235 to 6,059) and 286 (IQR, 31
to 732) copies/10
6 PBMC, respectively (
P < 0.0001). For quartiles
of the STS DNA distribution, ranging from lowest to highest
values, the cumulative rates of death by 16 years after seroconversion
were 23.6% (95% confidence interval [CI], 11.8 to 43.7%), 44.8%
(95% CI, 28.5 to 64.9%), 65.0% (95% CI, 47.4 to 82.0%), and
72.6% (95% CI, 55.8 to 87.1%), respectively. The corresponding
rates for progression to clinical AIDS were 14.0% (95% CI, 5.5
to 33.2%), 46.0% (95% CI, 29.5 to 66.3%), 64.9% (95% CI, 44.9
to 84.1%), and 70.7% (95% CI, 53.8 to 85.8%) (Fig.
4). The progression
rates differed significantly by HIV-1 STS DNA levels (log rank
P < 0.001 for both end points).
Following adjustment for age at HIV-1 antibody seroconversion,
STS DNA levels, concurrent CD4 T-cell counts, plasma viral load,
and TREC levels were significantly associated with the hazards
of death and of developing clinical AIDS (Table
1). The predictive
value of STS DNA levels remained significant and of almost the
same magnitude with multivariate adjustment for concurrent CD4
T-cell counts, HIV-1 RNA levels, and TREC levels. In this multivariate
model, there was greater attenuation of the prognostic values
of concurrent CD4 cell counts and TREC levels, such that they
were not statistically significant for time to AIDS (Table
1).
Figure
5 shows the cumulative incidence rates of progression
to death and to clinical AIDS after stratification of patients
by their baseline STS DNA and plasma RNA levels. Higher baseline
STS DNA levels were associated with increased risks of AIDS
and death for patients with baseline RNA levels either above
or below the median (log rank
P < 0.05 in both cases). In
univariate analysis, detectable versus undetectable 2LTRC levels
(more versus fewer than 10 copies/10
6 PBMC, respectively) were
significantly associated with time to death and development
of clinical AIDS. However, after adjustment for STS DNA levels,
2LTRC levels did not significantly predict the progression of
HIV-1 disease. The frequency of patients with detectable 2LTRC
levels in this study is lower than those in previously published
studies using similar methodologies (
4,
54). This discrepancy
may be attributed to differences in real-time-PCR methodologies
in quantifying both 2LTRC templates and cell equivalents and
to genetic diversity among the HIV-1 strains.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Relative risk of HIV-1-induced death and AIDS associated with changes in PBMC HIV-1 STS DNA levels, plasma HIV-1 RNA levels, CD4 T-cell counts, and TREC levelsa
|
Longitudinal HIV-1 STS DNA values.
HIV-1 STS DNA levels were measured in all available samples
from all patients prior to initiation of effective antiretroviral
therapy. From each patient, six longitudinal STS DNA values
were determined on average during the 16 years of follow-up,
with a median interval of 1 year between successive measurements.
The results indicated that during the natural history of HIV-1
infection, there was no evidence of increasing or decreasing
levels of STS DNA over time. The overall mean slope of STS levels
(change in log
10 unit) was -0.001 per year (95% CI, -0.031 to
0.028), corresponding to a 0.3% rate of drop in the original
scale (95% CI, 6.8% decrease to 6.6% increase) (Fig.
6A). As
shown in Fig.
6B, the majority of the longitudinal STS values
from seven randomly selected progressors were above the median
values estimated from all study participants, while the majority
of the STS values derived from seven selected long-term nonprogressors
were below the estimated median values.

DISCUSSION
Our interest in developing a quantitative real-time PCR assay
to measure the PBMC-associated levels of HIV-1 DNA in HIV-1-infected
patients in a well-characterized AIDS study cohort originates
from our ongoing effort to identify new clinically important
prognostic markers of HIV-1 disease. We also want to use this
assay to study persistent viral reservoirs and to monitor patients
receiving antiretroviral treatment who have undetectable plasma
RNA loads. We therefore identified biologically significant
pools of HIV-1 DNA structures formed during reverse transcription
and DNA integration, and we evaluated whether they correlated
with progression of HIV-1 disease independently of the well-known
effect of plasma viral load. During the early steps of cellular
HIV-1 infection, the viral RNA is reverse transcribed into linear
dsDNA and then integrates into the human cell chromosome. The
resulting provirus carries out the production of progeny HIV-1
virions. A few linear dsDNA molecules undergo recombination,
forming LTRC and 2LTRC (
24,
54).
Considering the complex mechanism of HIV-1 reverse transcription and integration, we deemed it prudent to design a molecular-beacon-based real-time PCR assay to quantify the pool of HIV-1 DNA forms that had undergone both template switches. These DNA forms, termed STS DNA, are a prerequisite for integration of the viral genome. Real-time PCR assays that quantitate 2LTRC have been described previously (17, 24, 54, 58). Thus, a real-time PCR assay using a TaqMan-based detection system has been used to quantify HIV-1 DNA in human cells (4, 11). The real-time assay developed by Butler et al. (4), termed "late reverse transcript," quantitates HIV-1 DNA forms that have undergone two template switches, whereas the assay by Desire et al. (11) detects DNA forms with one template switch. To the best of our knowledge, real-time PCR assays that quantify HIV-1 DNA with one or two template switches have not been used to estimate the prognosis of HIV-1 infection. Two previous studies of the relationship between cell-associated HIV-1 DNA load and clinical outcome by use of non-real-time PCR technologies produced contradictory results (10, 20).
To establish whether the cellular HIV-1 DNA load influences the rate of disease progression, and to monitor the progression of DNA throughout the natural history of HIV-1 infection, we measured HIV-1 STS and 2LTRC DNA levels in PBMC samples isolated from patients in the Greek MHCS. To do this, we used a real-time PCR technology with a molecular-beacon detection system (57). Similar assays based on the same technologies were previously developed to investigate other markers of progression of HIV-1 disease, such as natural polymorphisms on the CCR5 and CCR2 HIV-1 coreceptor genes (31-33) and the concentration of TREC (22). Our results demonstrate that the HIV-1 STS DNA concentration is an important independent predictor of HIV-1 disease. We showed that patients who progressed to AIDS had significantly higher levels of HIV-1 STS DNA than those who remained AIDS free. Importantly, we further showed that STS DNA levels were rather weakly correlated with plasma RNA loads, suggesting a biologically significant and independent role of cellular HIV-1 STS DNA in the pathogenesis of HIV-1 disease. The simplest interpretation of the results obtained in this study suggests that the HIV-1 cellular DNA load may be an indicator of the spread of infection, whereas the plasma RNA load is an indicator of active infection. Furthermore, the results from our longitudinal study showed that the concentration of HIV-1 STS DNA remained constant during the natural course of HIV-1 infection, as previously described (10).
In summary, we have introduced a new real-time PCR assay to measure the level of HIV-1 STS DNA forms, which are viral DNA forms that have undergone two template switches in PBMC. By using the cellular HIV-1 STS DNA assay, we established that the quantity of STS DNA has a significant and independent influence on the rate of disease progression throughout the natural course of HIV-1 infection. Furthermore, we reconfirmed previously published findings that, unlike the plasma RNA load, HIV-1 DNA levels remain constant during the natural course of HIV-1 infection. Similarly, as the term "plasma viral load" has been introduced to denote the concentration of HIV-1 RNA in plasma, we propose the term "cellular viral load" to refer to the concentration of HIV-1 STS DNA in PBMC. The observations we have made about the implications of cellular DNA load for the progression of HIV-1 disease suggest further studies to evaluate the clinical significance of cellular DNA load in patients receiving effective antiretroviral therapy, whose plasma RNA loads are undetectable by currently available assays. Although the biological explanation of the independent role of HIV-1 STS DNA in the progression of HIV-1 disease is not immediately apparent, new lines of experimental studies might emerge from such studies. In time, cellular DNA load might have important implications for therapeutic research and the clinical management of patients.

ACKNOWLEDGMENTS
We are grateful to L. A. Day, S. Tyagi and F. R. Kramer for
useful discussions and for the use of spectrophotometric facilities.
We thank E. Delwart, J. P. Moore, M. Stevenson, and S. M. Wolinsky
for critical comments on the manuscript. We are thankful to
Zissis Moschidis for technical assistance, to V. Milona for
administrative assistance, and to A. Leonditsi for secretarial
help. We are indebted to the patients enrolled in the Greek
component of the Multicenter Hemophilia Cohort Study.
The Elizabeth Glazer Pediatric AIDS Foundation provided grant support (51086-25-PG, awarded to L.G.K.). C.A. was funded by the Hellenic Center of Infectious Disease Control. The Greek Hemophilia Study Cohort is funded by the National Cancer Institute under contract N01-CP-33002. Additional support was provided by the Hellenic Society for the Study of AIDS and Other Sexually Transmitted Diseases and by the University of Athens Medical School, where L.G.K. is the Athanasios Mantecos Scholar.

FOOTNOTES
* Corresponding author. Mailing address: Athens University Medical School, Department of Hygiene and Epidemiology, 75 Mikras Asias, 11527 Athens, Greece. Phone: 30-1-748-6382. Fax: 30-1-748-6382. E-mail:
lkostrik{at}med.uoa.gr.

Collaborating investigators in the Multicenter Hemophilia Cohort Study Group were: J. J. Goedert, T. R. O'Brien, P. S. Rosenberg, C. S. Rabkin, E. A. Engels, M. H. Gail, S. J. O'Brien, M. Dean, M. Carrington, M. Smith, and C. Winkler (National Cancer Institute, Rockville and Frederick, Md.); B. Konkle (Cardeza Foundation Hemophilia Center, Philadelphia, Pa.); M. Manco-Johnson (Mountain States Regional Hemophilia and Thrombosis Program, University of Colorado, Aurora, Colo.); D. DiMichele and M. W. Hilgartner (Hemophilia Treatment Center, New York Presbyterian Hospital, New York, N.Y.); Philip Blatt (Christiana Hospital, Newark, Del.); L. M. Aledort and S. Seremetes (Hemophilia Center, Mount Sinai Medical Center, New York, N.Y.); K. Hoots (Gulf States Hemophilia Center, University of Texas at Houston, Houston, Tex.); A. L. Angiolillo and N. L. C. Luban (Hemophilia Center, Children's Hospital National Medical Center, Washington, D.C.); A. Cohen and C. S. Manno (Hemophilia Center, Children's Hospital of Philadelphia, Philadelphia, Pa.); C. Leissinger (Tulane University Medical School, New Orleans, La.); G. C. White II (Comprehensive Hemophilia Center, University of North Carolina, Chapel Hill, N.C.); M. M. Lederman, S. Purvis, and J. Salkowitz (Case Western Reserve University School of Medicine, Cleveland, Ohio); C. M. Kessler (Georgetown Univeristy Medical Center, Washington, D.C.); A. Karafoulidou and T. Mandalaki (Hemophilia Center, Second Regional Blood Transfusion Center, Laikon General Hospital, Athens, Greece); A. Hatzakis and G. Touloumi (National Retrovirus Reference Center, Athens University Medical School, Athens, Greece); W. Schramm and F. Rommel (Medizinische Klinik Innerstadt der Maximilian, Universitaet Muenchen, Munich, Germany); P. de Moerloose (Haemostasis Unit, Hôpital Cantonal Universitaire, Geneva, Switzerland); S. Eichinger (University of Vienna Medical School, Vienna, Austria); K. E. Sherman (University of Cincinnati Medical Center, Cincinnati, Ohio); D. Waters (Scientific Applications International Corporation, Frederick, Md.); and V. Lamprecht and B. L. Kroner (Research Triangle Institute, Rockville, Md.). 

REFERENCES
1 - Aoki, S., R. Yarchoan, R. V. Thomas, J. M. Pluda, K. Marczyk, S. Broder, and H. Mitsuya. 1990. Quantitative analysis of HIV-1 proviral DNA in peripheral blood mononuclear cells from patients with AIDS or ARC: decrease of proviral DNA content following treatment with 2',3'-dideoxyinosine (ddI). AIDS Res. Hum. Retrovir. 6:1331-1339.[Medline]
2 - Bieniasz, P. D., K. Ariyoshi, M. A. Bourelly, S. Bloor, R. B. Foxall, E. C. Harwood, and J. N. Weber. 1993. Variable relationship between proviral DNA load and infectious virus titre in the peripheral blood mononuclear cells of HIV-1-infected individuals. AIDS 7:803-806.[Medline]
3 - Bruisten, S. M., P. Reiss, A. E. Loeliger, P. van Swieten, R. Schuurman, C. A. Boucher, G. J. Weverling, and J. G. Huisman. 1998. Cellular proviral HIV type 1 DNA load persists after long-term RT-inhibitor therapy in HIV type 1 infected persons. AIDS Res. Hum. Retrovir. 14:1053-1058.[Medline]
4 - Butler, S. L., M. S. Hansen, and F. D. Bushman. 2001. A quantitative assay for HIV DNA integration in vivo. Nat. Med. 7:631-634.[CrossRef][Medline]
5 - Christopherson, C., Y. Kidane, B. Conway, J. Krowka, H. Sheppard, and S. Kwok. 2000. PCR-based assay to quantify human immunodeficiency virus type 1 DNA in peripheral blood mononuclear cells. J. Clin. Microbiol. 38:630-634.[Abstract/Free Full Text]
6 - Chun, T. W., L. Carruth, D. Finzi, X. Shen, J. A. DiGiuseppe, H. Taylor, M. Hermankova, K. Chadwick, J. Margolick, T. C. Quinn, Y. H. Kuo, R. Brookmeyer, M. A. Zeiger, P. Barditch-Crovo, and R. F. Siliciano. 1997. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature 387:183-188.[CrossRef][Medline]
7 - Chun, T. W., D. Engel, M. M. Berrey, T. Shea, L. Corey, and A. S. Fauci. 1998. Early establishment of a pool of latently infected, resting CD4+ T cells during primary HIV-1 infection. Proc. Natl. Acad. Sci. USA 95:8869-8873.[Abstract/Free Full Text]
8 - Chun, T. W., and A. S. Fauci. 1999. Latent reservoirs of HIV: obstacles to the eradication of virus. Proc. Natl. Acad. Sci. USA 96:10958-10961.[Free Full Text]
9 - Chun, T. W., L. Stuyver, S. B. Mizell, L. A. Ehler, J. A. Mican, M. Baseler, A. L. Lloyd, M. A. Nowak, and A. S. Fauci. 1997. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc. Natl. Acad. Sci. USA 94:13193-13197.[Abstract/Free Full Text]
10 - Cone, R. W., P. Gowland, M. Opravil, P. Grob, B. Ledergerber, and the Swiss HIV Cohort Study. 1998. Levels of HIV-infected peripheral blood cells remain stable throughout the natural history of HIV-1 infection. AIDS 12:2253-2260.[CrossRef][Medline]
11 - Desire, N., A. Dehee, V. Schneider, C. Jacomet, C. Goujon, P. M. Girard, W. Rozenbaum, and J. C. Nicolas. 2001. Quantification of human immunodeficiency virus type 1 proviral load by a TaqMan real-time PCR assay. J. Clin. Microbiol. 39:1303-1310.[Abstract/Free Full Text]
12 - Dewar, R. L., H. C. Highbarger, M. D. Sarmiento, J. A. Todd, M. B. Vasudevachari, R. T. Davey, Jr., J. A. Kovacs, N. P. Salzman, H. C. Lane, and M. S. Urdea. 1994. Application of branched DNA signal amplification to monitor human immunodeficiency virus type 1 burden in human plasma. J. Infect. Dis. 170:1172-1179.[Medline]
13 - Eyster, M. E., M. H. Gail, J. O. Ballard, H. Al-Mondhiry, and J. J. Goedert. 1987. Natural history of human immunodeficiency virus infections in hemophiliacs: effects of T-cell subsets, platelet counts, and age. Ann. Intern. Med. 107:1-6.
14 - Finzi, D., M. Hermankova, T. Pierson, L. M. Carruth, C. Buck, R. E. Chaisson, T. C. Quinn, K. Chadwick, J. Margolick, R. Brookmeyer, J. Gallant, M. Markowitz, D. D. Ho, D. D. Richman, and R. F. Siliciano. 1997. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 278:1295-1300.[Abstract/Free Full Text]
15 - Furtado, M. R., D. S. Callaway, J. P. Phair, K. J. Kunstman, J. L. Stanton, C. A. Macken, A. S. Perelson, and S. M. Wolinsky. 1999. Persistence of HIV-1 transcription in peripheral-blood mononuclear cells in patients receiving potent antiretroviral therapy. N. Engl. J. Med. 340:1614-1622.[Abstract/Free Full Text]
16 - Furtado, M. R., R. Murphy, and S. M. Wolinsky. 1993. Quantification of human immunodeficiency virus type 1 tat mRNA as a marker for assessing the efficacy of antiretroviral therapy. J. Infect. Dis. 167:213-216.[Medline]
17 - Goedert, J. J., T. R. O'Brien, A. Hatzakis, and L. G. Kostrikis for the Multicenter Hemophilia Cohort Study. 2001. T cell receptor excision circles and HIV-1 2-LTR episomal DNA to predict AIDS in patients not receiving effective therapy. AIDS 15:2245-2250.[CrossRef][Medline]
18 - Gulick, R. M., J. W. Mellors, D. Havlir, J. J. Eron, C. Gonzalez, D. McMahon, D. D. Richman, F. T. Valentine, L. Jonas, A. Meibohm, E. A. Emini, and J. A. Chodakewitz. 1997. Treatment with indinavir, zidovudine, and lamivudine in adults with human immunodeficiency virus infection and prior antiretroviral therapy. N. Engl. J. Med. 337:734-739.[Abstract/Free Full Text]
19 - Gupta, P., M. Ding, M. Cottrill, C. Rinaldo, L. Kingsley, S. Wolinsky, and J. Mellors. 1995. Quantitation of human immunodeficiency virus type 1 DNA and RNA by a novel internally controlled PCR assay. J. Clin. Microbiol. 33:1670-1673.[Abstract]
20 - Gupta, P., L. Kingsley, J. Armstrong, M. Ding, M. Cottrill, and C. Rinaldo. 1993. Enhanced expression of human immunodeficiency virus type 1 correlates with development of AIDS. Virology 196:586-595.[CrossRef][Medline]
21 - Hammer, S. M., K. E. Squires, M. D. Hughes, J. M. Grimes, L. M. Demeter, J. S. Currier, J. J. Eron, Jr., J. E. Feinberg, H. H. Balfour, Jr., L. R. Deyton, J. A. Chodakewitz, and M. A. Fischl for the AIDS Clinical Trials Group 320 Study Team. 1997. A controlled trial of two nucleoside analogues plus indinavir in persons with human immunodeficiency virus infection and CD4 cell counts of 200 per cubic millimeter or less. N. Engl. J. Med. 337:725-733.[Abstract/Free Full Text]
22 - Hatzakis, A., G. Touloumi, R. Karanicolas, A. Karafoulidou, T. Mandalaki, C. Anastassopoulou, L. Zhang, J. J. Goedert, D. D. Ho, and L. G. Kostrikis. 2000. Effect of recent thymic emigrants on progression of HIV-1 disease. Lancet 355:599-604.[CrossRef][Medline]
23 - Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time quantitative PCR. Genome Res. 6:986-994.[Abstract/Free Full Text]
24 - Hu, W. S., and H. M. Temin. 1990. Retroviral recombination and reverse transcription. Science 250:1227-1233.[Abstract/Free Full Text]
25 - Hughes, M. D., V. A. Johnson, M. S. Hirsch, J. W. Bremer, T. Elbeik, A. Erice, D. R. Kuritzkes, W. A. Scott, S. A. Spector, N. Basgoz, M. A. Fischl, and R. T. D'Aquila for the AIDS Clinical Trials Group 24 Protocol Virology Substudy Team. 1997. Monitoring plasma HIV-1 RNA levels in addition to CD4+ lymphocyte count improves assessment of antiretroviral therapeutic response. Ann. Intern. Med. 126:929-938.[Abstract/Free Full Text]
26 - Ibanez, A., T. Puig, J. Elias, B. Clotet, L. Ruiz, and M. A. Martinez. 1999. Quantification of integrated and total HIV-1 DNA after long-term highly active antiretroviral therapy in HIV-1-infected patients. AIDS 13:1045-1049.[CrossRef][Medline]
27 - Ioannidis, J. P., P. S. Rosenberg, J. J. Goedert, L. J. Ashton, T. L. Benfield, S. P. Buchbinder, R. A. Coutinho, J. Eugen-Olsen, T. Gallart, T. L. Katzenstein, L. G. Kostrikis, H. Kuipers, L. G. Louie, S. A. Mallal, J. B. Margolick, O. P. Martinez, L. Meyer, N. L. Michael, E. Operskalski, G. Pantaleo, G. P. Rizzardi, H. Schuitemaker, H. W. Sheppard, G. J. Stewart, I. D. Theodorou, H. Ullum, E. Vicenzi, D. Vlahov, D. Wilkinson, C. Workman, J. F. Zagury, and T. R. O'Brien for the International Meta-Analysis. 2001. Effects of CCR5-
32, CCR2-64I, and SDF-1 3'A alleles on HIV-1 disease progression: an international meta-analysis of individual-patient data. Ann. Intern. Med. 135:782-795.[Abstract/Free Full Text]
28 - Izopet, J., C. Tamalet, C. Pasquier, K. Sandres, B. Marchou, P. Massip, and J. Puel. 1998. Quantification of HIV-1 proviral DNA by a standardized colorimetric PCR-based assay. J. Med. Virol. 54:54-59.[CrossRef][Medline]
29 - Katzenstein, D. A., S. M. Hammer, M. D. Hughes, H. Gundacker, J. B. Jackson, S. Fiscus, S. Rasheed, T. Elbeik, R. Reichman, A. Japour, T. C. Merigan, and M. S. Hirsch for the AIDS Clinical Trials Group Study 175 Virology Study Team. 1996. The relation of virologic and immunologic markers to clinical outcomes after nucleoside therapy in HIV-infected adults with 200 to 500 CD4 cells per cubic millimeter. N. Engl. J. Med. 335:1091-1098.[Abstract/Free Full Text]
30 - Kempf, D. J., R. A. Rode, Y. Xu, E. Sun, M. E. Heath-Chiozzi, J. Valdes, A. J. Japour, S. Danner, C. Boucher, A. Molla, and J. M. Leonard. 1998. The duration of viral suppression during protease inhibitor therapy for HIV-1 infection is predicted by plasma HIV-1 RNA at the nadir. AIDS 12:F9-F14.[CrossRef][Medline]
31 - Kostrikis, L. G., Y. Huang, J. P. Moore, S. M. Wolinsky, L. Zhang, Y. Guo, L. Deutsch, J. Phair, A. U. Neumann, and D. D. Ho. 1998. A chemokine receptor CCR2 allele delays HIV-1 disease progression and is associated with a CCR5 promoter mutation. Nat. Med. 4:350-353.[CrossRef][Medline]
32 - Kostrikis, L. G., A. U. Neumann, B. Thomson, B. T. Korber, P. McHardy, R. Karanicolas, L. Deutsch, Y. Huang, J. F. Lew, K. McIntosh, H. Pollack, W. Borkowsky, H. M. Spiegel, P. Palumbo, J. Oleske, A. Bardeguez, K. Luzuriaga, J. Sullivan, S. M. Wolinsky, R. A. Koup, D. D. Ho, and J. P. Moore. 1999. A polymorphism in the regulatory region of the CC-chemokine receptor 5 gene influences perinatal transmission of human immunodeficiency virus type 1 to African-American infants. J. Virol. 73:10264-10271.[Abstract/Free Full Text]
33 - Kostrikis, L. G., S. Tyagi, M. M. Mhlanga, D. D. Ho, and F. R. Kramer. 1998. Spectral genotyping of human alleles. Science 279:1228-1229.[Free Full Text]
34 - Levy, J. A. 1993. Pathogenesis of human immunodeficiency virus infection. Microbiol. Rev. 57:183-289.[Abstract/Free Full Text]
35 - Lin, H. J., M. Haywood, and F. B. Hollinger. 1996. Application of a commercial kit for detection of PCR products to quantification of human immunodeficiency virus type 1 RNA and proviral DNA. J. Clin. Microbiol. 34:329-333.[Abstract]
36 - Mallet, F., C. Hebrard, J. M. Livrozet, O. Lees, F. Tron, J. L. Touraine, and B. Mandrand. 1995. Quantitation of human immunodeficiency virus type 1 DNA by two PCR procedures coupled with enzyme-linked oligosorbent assay. J. Clin. Microbiol. 33:3201-3208.[Abstract]
37 - Mellors, J. W., L. A. Kingsley, C. R. Rinaldo, Jr., J. A. Todd, B. S. Hoo, R. P. Kokka, and P. Gupta. 1995. Quantitation of HIV-1 RNA in plasma predicts outcome after seroconversion. Ann. Intern. Med. 122:573-579.[Abstract/Free Full Text]
38 - Mellors, J. W., C. R. Rinaldo, Jr., P. Gupta, R. M. White, J. A. Todd, and L. A. Kingsley. 1996. Prognosis in HIV-1 infection predicted by the quantity of virus in plasma. Science 272:1167-1170.[Abstract]
39 - Menzo, S., P. Bagnarelli, M. Giacca, A. Manzin, P. E. Varaldo, and M. Clementi. 1992. Absolute quantitation of viremia in human immunodeficiency virus infection by competitive reverse transcription and polymerase chain reaction. J. Clin. Microbiol. 30:1752-1757.[Abstract/Free Full Text]
40 - Montoya, J. G., R. Wood, D. Katzenstein, M. Holodny, and T. C. Merigan. 1993. Peripheral blood mononuclear cell human immunodeficiency virus type 1 proviral DNA quantification by polymerase chain reaction: relationship to immunodeficiency and drug effect. J. Clin. Microbiol. 31:2692-2696.[Abstract/Free Full Text]
41 - Mulder, J., N. McKinney, C. Christopherson, J. Sninsky, L. Greenfield, and S. Kwok. 1994. Rapid and simple PCR assay for quantitation of human immunodeficiency virus type 1 RNA in plasma: application to acute retroviral infection. J. Clin. Microbiol. 32:292-300.[Abstract/Free Full Text]
42 - Ngo-Giang-Huong, N., C. Deveau, I. Da Silva, I. Pellegrin, A. Venet, M. Harzic, M. Sinet, J. F. Delfraissy, L. Meyer, C. Goujard, and C. Rouzioux for the French PRIMO Cohort Study Group. 2001. Proviral HIV-1 DNA in subjects followed since primary HIV-1 infection who suppress plasma viral load after one year of highly active antiretroviral therapy. AIDS 15:665-673.[CrossRef][Medline]
43 - O'Brien, S. J., and J. P. Moore. 2000. The effect of genetic variation in chemokines and their receptors on HIV transmission and progression to AIDS. Immunol. Rev. 177:99-111.[CrossRef][Medline]
44 - O'Brien, S. J., G. W. Nelson, C. A. Winkler, and M. W. Smith. 2000. Polygenic and multifactorial disease gene association in man: lessons from AIDS. Annu. Rev. Genet. 34:563-591.[CrossRef][Medline]
45 - O'Brien, T. R., W. A. Blattner, D. Waters, E. Eyster, M. W. Hilgartner, A. R. Cohen, N. Luban, A. Hatzakis, L. M. Aledort, P. S. Rosenberg, W. J. Miley, B. L. Kroner, and J. J. Goedert. 1996. Serum HIV-1 RNA levels and time to development of AIDS in the Multicenter Hemophilia Cohort Study. JAMA 276:105-110.[Abstract/Free Full Text]
46 - O'Brien, W. A., P. M. Hartigan, E. S. Daar, M. S. Simberkoff, J. D. Hamilton, and the Veterans Affairs Cooperative Study Group on AIDS. 1997. Changes in plasma HIV RNA levels and CD4+ lymphocyte counts predict both response to antiretroviral therapy and therapeutic failure. Ann. Intern. Med. 126:939-945.[Abstract/Free Full Text]
47 - O'Brien, W. A., P. M. Hartigan, D. Martin, J. Esinhart, A. Hill, S. Benoit, M. Rubin, M. S. Simberkoff, J. D. Hamilton, and the Veterans Affairs Cooperative Study Group on AIDS. 1996. Changes in plasma HIV-1 RNA and CD4+ lymphocyte counts and the risk of progression to AIDS. N. Engl. J. Med. 334:426-431.[Abstract/Free Full Text]
48 - Pantaleo, G., C. Graziosi, and A. S. Fauci. 1993. New concepts in the immunopathogenesis of human immunodeficiency virus infection. N. Engl. J. Med. 328:327-335.[Free Full Text]
49 - Polis, M. A., I. A. Sidorov, C. Yoder, S. Jankelevich, J. Metcalf, B. U. Mueller, M. A. Dimitrov, P. Pizzo, R. Yarchoan, and D. S. Dimitrov. 2001. Correlation between reduction in plasma HIV-1 RNA concentration 1 week after start of antiretroviral treatment and longer-term efficacy. Lancet 358:1760-1765.[CrossRef][Medline]
50 - Pomerantz, R. J. 1999. Residual HIV-1 disease in the era of highly active antiretroviral therapy. N. Engl. J. Med. 340:1672-1674.[Free Full Text]
51 - Powderly, W. G., M. S. Saag, S. Chapman, G. Yu, B. Quart, and N. J. Clendeninn. 1999. Predictors of optimal virological response to potent antiretroviral therapy. AIDS 13:1873-1880.[CrossRef][Medline]
52 - Saksela, K., C. E. Stevens, P. Rubinstein, P. E. Taylor, and D. Baltimore. 1995. HIV-1 messenger RNA in peripheral blood mononuclear cells as an early marker of risk for progression to AIDS. Ann. Intern. Med. 123:641-648.[Abstract/Free Full Text]
53 - Sei, S., D. E. Kleiner, J. B. Kopp, R. Chandra, P. E. Klotman, R. Yarchoan, P. A. Pizzo, and H. Mitsuya. 1994. Quantitative analysis of viral burden in tissues from adults and children with symptomatic human immunodeficiency virus type 1 infection assessed by polymerase chain reaction. J. Infect. Dis. 170:325-333.[Medline]
54 - Sharkey, M. E., I. Teo, T. Greenough, N. Sharova, K. Luzuriaga, J. L. Sullivan, R. P. Bucy, L. G. Kostrikis, A. Haase, C. Veryard, R. E. Davaro, S. H. Cheeseman, J. S. Daly, C. Bova, R. T. Ellison III, B. Mady, K. K. Lai, G. Moyle, M. Nelson, B. Gazzard, S. Shaunak, and M. Stevenson. 2000. Persistence of episomal HIV-1 infection intermediates in patients on highly active anti-retroviral therapy. Nat. Med. 6:76-81.[CrossRef][Medline]
55 - Tamalet, C., A. Lafeuillade, J. Fantini, C. Poggi, and N. Yahi. 1997. Quantification of HIV-1 viral load in lymphoid and blood cells: assessment during four-drug combination therapy. AIDS 11:895-901.[CrossRef][Medline]
56 - Touloumi, G., A. Karafoulidou, A. Gialeraki, O. Katsarou, I. Milona, V. Kapsimali, T. Mandalaki, and A. Hatzakis. 1998. Determinants of progression of HIV infection in a Greek hemophilia cohort followed for up to 16 years after seroconversion. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 19:89-97.[Medline]
57 - Tyagi, S., and F. R. Kramer. 1996. Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14:303-308.[CrossRef][Medline]
58 - Valentin, A., H. Trivedi, W. Lu, L. G. Kostrikis, and G. N. Pavlakis. 2000. CXCR4 mediates entry and productive infection of syncytia-inducing (X4) HIV-1 strains in primary macrophages. Virology 269:294-304.[CrossRef][Medline]
59 - Vandegraaff, N., R. Kumar, C. J. Burrell, and P. Li. 2001. Kinetics of human immunodeficiency virus type 1 (HIV) DNA integration in acutely infected cells as determined using a novel assay for detection of integrated HIV DNA. J. Virol. 75:11253-11260.[Abstract/Free Full Text]
60 - Vandegraaff, N., R. Kumar, H. Hocking, T. R. Burke, Jr., J. Mills, D. Rhodes, C. J. Burrell, and P. Li. 2001. Specific inhibition of human immunodeficiency virus type 1 (HIV-1) integration in cell culture: putative inhibitors of HIV-1 integrase. Antimicrob. Agents Chemother. 45:2510-2516.[Abstract/Free Full Text]
61 - van Gemen, B., R. van Beuningen, A. Nabbe, D. van Strijp, S. Jurriaans, P. Lens, and T. Kievits. 1994. A one-tube quantitative HIV-1 RNA NASBA nucleic acid amplification assay using electrochemiluminescent (ECL) labelled probes. J. Virol. Methods 49:157-167.[CrossRef][Medline]
62 - Vesanen, M., C. E. Stevens, P. E. Taylor, P. Rubinstein, and K. Saksela. 1996. Stability in controlling viral replication identifies long-term nonprogressors as a distinct subgroup among human immunodeficiency virus type 1-infected persons. J. Virol. 70:9035-9040.[Abstract]
63 - Wong, J. K., H. F. Gunthard, D. V. Havlir, Z. Q. Zhang, A. T. Haase, C. C. Ignacio, S. Kwok, E. Emini, and D. D. Richman. 1997. Reduction of HIV-1 in blood and lymph nodes following potent antiretroviral therapy and the virologic correlates of treatment failure. Proc. Natl. Acad. Sci. USA 94:12574-12579.[Abstract/Free Full Text]
64 - Wong, J. K., M. Hezareh, H. F. Gunthard, D. V. Havlir, C. C. Ignacio, C. A. Spina, and D. D. Richman. 1997. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 278:1291-1295.[Abstract/Free Full Text]
65 - Yerly, S., L. Kaiser, C. Baumberger, B. Hirschel, and L. H. Perrin. 1995. Early and prolonged decrease of viremia in HIV-1-infected patients treated with didanosine. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 8:358-364.[Medline]
66 - Zhang, H., G. Dornadula, M. Beumont, L. Livornese, Jr., B. Van Uitert, K. Henning, and R. J. Pomerantz. 1998. Human immunodeficiency virus type 1 in the semen of men receiving highly active antiretroviral therapy. N. Engl. J. Med. 339:1803-1809.[Abstract/Free Full Text]
Journal of Virology, October 2002, p. 10099-10108, Vol. 76, No. 20
0022-538X/02/$04.00+0 DOI: 10.1128/JVI.76.20.10099-10108.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Beloukas, A., Paraskevis, D., Haida, C., Sypsa, V., Hatzakis, A.
(2009). Development and Assessment of a Multiplex Real-Time PCR Assay for Quantification of Human Immunodeficiency Virus Type 1 DNA. J. Clin. Microbiol.
47: 2194-2199
[Abstract]
[Full Text]
-
Sarmati, L., Parisi, S. G., Nicastri, E., d'Ettorre, G., Palmisano, L., Andreotti, M., Andreoni, C., Giuliano, M., Gatti, F., Boldrin, C., Palu, G., Vullo, V., Vella, S., Andreoni, M.
(2005). Association between Cellular Human Immunodeficiency Virus DNA Level and Immunological Parameters in Patients with Undetectable Plasma Viremia Level during Highly Active Antiretroviral Therapy. J. Clin. Microbiol.
43: 6183-6185
[Abstract]
[Full Text]
-
Fondere, J.-M., Petitjean, G., Huguet, M.-F., Salhi, S. L., Baillat, V., Macura-Biegum, A., Becquart, P., Reynes, J., Vendrell, J.-P.
(2004). Human Immunodeficiency Virus Type 1 (HIV-1) Antigen Secretion by Latently Infected Resting CD4+ T Lymphocytes from HIV-1-Infected Individuals. J. Virol.
78: 10536-10542
[Abstract]
[Full Text]