Previous Article | Next Article ![]()
Journal of Virology, May 2002, p. 5051-5061, Vol. 76, No. 10
0022-538X/02/$04.00+0 DOI: 10.1128/JVI.76.10.5051-5061.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Molecular Medicine Program, Mayo Foundation, Rochester, Minnesota 55905,1 Immunite et Infections Virales, CNRS-UCBL UMR5537, IFR Laennec, 69372 Lyon Cedex 08, France2
Received 11 October 2001/ Accepted 8 February 2002
|
|
|---|
|
|
|---|
The determinants of viral infectivity and the balance between lateral spread and release are complex and incompletely understood. Syncytium formation may be important for viral pathogenesis in vivo. For measles virus (MV), a clinically relevant member of the Paramyxoviridae, syncytia have been reported in cells from infected humans (27), primates (29), and transgenic mice (19) expressing one of the virus receptors, CD46 (7, 21). However, syncytia are not produced in every MV-infected tissue, and some primary MV isolates are poorly or nonfusogenic in many cell lines (35). Repeated passaging of the MV-Edmonston (MV-Edm) original isolate on chicken embryo fibroblasts provided the basis for the generation of the MV-Edm B line and the currently used vaccine strains (8, 22, 28), which are no longer pathogenic in vivo. Further adaptation by laboratory passage on cultured primate cells often results in the selection of more fusogenic variants.
Recombinant MVs lacking matrix (M) or the cytoplasmic tail of the fusion (F) protein, mutations found in MV variants causing the rare and fatal complication, subacute sclerosing panencephalitis (17), spread more extensively by cell-to-cell fusion but achieve a significantly lower titer, particularly of released virus (4, 5). Their extended cell-to-cell fusion is a factor facilitating deeper penetration into the brains of CD46-transgenic mice (4), supporting a role for fusogenicity in subacute sclerosing panencephalitis pathogenesis. Furthermore, mutants of murine leukemia virus (10, 36), simian immunodeficiency virus, and human immunodeficiency virus with altered glycoprotein cytoplasmic tails show decreased infectivity (23), increased infectivity (15, 30) or fusogenicity (20), or both increased fusogenicity and infectivity (37). Together, these studies implicate envelope glycoprotein interaction or incorporation as a determinant of viral infectivity.
We now describe the modification of MV particles by the addition of small epitope tags to the H (for MV hemagglutinin) cytoplasmic tail. These viruses induce more-extensive syncytia than does parental MV while they replicate at least as efficiently, depending on the host cell line. Characterizing the basis for this phenotype allows insights into the molecular interactions governing MV infectivity. We demonstrate that addition of the epitope tags weakens the interaction of H with F and that this provides the basis for the observed phenotype. While this effect of the epitope tags is independent of the M protein, it requires the presence of ribonucleocapsid. The correlation between the strength of interaction and cytopathicity was tested for recombinant particles expressing envelope glycoproteins derived from other MV strains with a lateral spread different from that of MV-Edm. Stability of the H/F complexes was found to be an important modulator of virus-induced cell-to-cell fusion.
|
|
|---|
To prepare virus stocks, Vero cells were infected at a multiplicity of infection (MOI) of 0.1 PFU/cell with the relevant virus and incubated at 37°C. Cells were scraped in Opti-MEM (Gibco), and particles released by three freeze-thaw cycles. Titers were determined by 50% tissue culture infective dose (TCID50) titration of Vero cells according to the Spearmann-Karber method.
Plasmid construction. The parental plasmids for mutagenesis and all experiments were pCG-H and pCG-F, carrying MV-Edm H and F under the control of the cytomegalovirus promoter (3), and pCG-HFlag (24). Site-directed mutagenesis was performed using the Quick Change system (Stratagene) and confirmed by DNA sequencing and Western analysis.
To transfer tagged HFlag into a DNA copy of the MV genome, PacI/SpeI fragments of pCG-HFlag containing the H open reading frame were cloned into PacI/SpeI-digested p(+)MV-NSe (31), adhering to the reported rule of six (2). An HA (for influenza virus-derived hemagglutinin) epitope (YPYDVPDYAY)-tagged version of MV-H, pCG-HHA, was generated using primer 5-CTTAGGGTGCAAGATCATCGATAATGTATCCGTACGACGTCCCGG ATTACGCTTTCACCACAACGAGACCGGATAAATGC (nucleotides coding for altered or added amino acids are shown in boldface for all primer sequences). Full-length p(+)MV-HHA was generated by transfer of the PacI/SpeI fragment from pCG-HHA into p(+)MV-NSe. MV strain Moraten (MV-Moraten) was grown from an aliquot of a currently used vaccine strain, Attenuvax (Merck). To generate a cDNA copy of MV-Edm carrying Moraten-derived glycoproteins, variant amino acids of the Moraten glycoproteins (22) were introduced into pCG-H (positions F117L, N484T, and E600V), using primers 5-CAGAGATTCACTGACCTAGTGAAATTAATCTCTGACAA GATTAAATTCCTTAATCC, 5-GATTCAAGGTTAGTCCCTACCTCTTCACTGTCC CAATTAAGGAAGCAGGCGAAG, and 5-GACATATCACTCACTCTGGGATGGTG GGCATGGGAGTCAGCTGCAC; pCG-F (positions V97 M [14], A166T, R266G, and S365Y), using primers 5-GAACCAATTAGAGATGCACTTAATGCAATGACCCAGA ATATAAGACCGGTTC, 5-CTGGAAACTACTAATCAGGCAATTGAGACAATCAG ACAAGCAGGGCAGGAG, 5-GATTTACTGGGCATCTTAGAGAGCGGAGGAATA AAGGCCCGGATAACTC, and 5-CTCCAAGAATGCCTCCGGGGGTACACTAAGT CCTGTGCTCGTACAC. The PacI/SpeI fragment from pCG-HMor and the NarI/PacI fragment from pCG-FMor were cloned into p(+)MV-NSe. To generate a cDNA copy of p(+)MV-HFlag lacking most of the M coding region, the 10,696-bp SacII/PacI fragment of p(+)MV-HFlag was ligated with the SacII/PacI fragment of p(+)MV-
M (4) harboring the M gene deletion.
Recovery of recombinant viruses. Recombinant MVs were generated essentially as described (26). Briefly, the helper cell line 293-3-46 stably expressing MV-N, MV-P, and T7 polymerase was transfected by calcium phosphate precipitation with the ProFection kit (Promega) with a DNA copy of the relevant MV genome and MV polymerase L. Helper cells were overlaid on Vero cells 76 h posttransfection, and the resulting infectious centers were passaged on Vero cells. In all cases, the integrity of recombinant viruses was confirmed by reverse transcription-PCR and DNA sequencing of the modified genes.
Western analysis. Cells (4 x 105) were infected at an MOI of 0.1 PFU/cell, washed 36 h later in phosphate-buffered saline, lysed for 10 min at 4°C in lysis buffer (50 mM Tris [pH 8.0], 62.5 mM EDTA, 0.4% deoxycholate, 1% Igepal [Sigma]) containing protease inhibitors (Complete mixture [Roche]) and 1 mM phenylmethylsulfonylfluoride (PMSF), and centrifuged at 5,000 x g for 10 min at 4°C. The total protein concentration of postnuclear supernatants was determined using the DC Protein Assay kit (Bio-Rad). Unless otherwise stated, 2.5 µg of total protein was mixed with urea buffer (200 mM Tris [pH 6.8], 8 M urea, 5% sodium dodecyl sulfate, 0.1 mM EDTA, 0.03% bromphenol blue, 1.5% dithiothreitol) for 25 min at 50°C. Samples were fractionated on sodium dodecyl sulfate-polyacrylamide gels, blotted to polyvinylidene difluoride membranes (Millipore), and subjected to enhanced chemiluminescence detection (Amersham Pharmacia Biotech) using antibodies specific for the Flag epitope (M2; Sigma), MV-N and -M (both Chemicon), the cytosolic tails of H and F (24), and the ectodomain of F, as indicated.
Virus growth kinetics. Vero cells (4 x 105 per time point) were infected at an MOI of 0.03 PFU/cell. At the indicated time points, supernatants were cleared by centrifugation, cells were scraped in Opti-MEM (Gibco) and subjected to freeze-thaw cycles, and released and cell-associated titers were determined by TCID50 titration. Where indicated, 2.5 µg of total lysate protein was subjected to Western analysis to follow synthesis of viral proteins.
Metabolic labeling and purification of viral particles. Vero cells were infected at an MOI of 0.1 PFU/cell and incubated for 30 h and then for 20 h in labeling medium lacking cysteine, methionine, and ammonium sulfate supplemented with 1% fetal bovine serum and 100-µCi/ml [35S]methionine (Amersham Pharmacia Biotech). Labeled particles were purified essentially as described (24). Briefly, supernatants were cleared by centrifugation at 20,000 x g at 4°C for 20 min. Viral particles were concentrated at the interphase of a 20 and 60% sucrose gradient in TNE buffer (10 mM Tris [pH 7.8], 100 mM sodium chloride, 1 mM EDTA) by centrifugation at 100,000 x g at 4°C for 90 min and then diluted with TNE buffer to less than 30% sucrose. Particles were pelleted at 100,000 x g at 4°C for 90 min, resuspended in TNE buffer, and subjected to TCID50 titration and, after addition of urea buffer, to Western analysis. Labeling efficiency was determined by analysis of purified particles with a scintillation counter.
Coimmunoprecipitation. Cells were cotransfected with 2.5 µg each of plasmid DNA encoding MV-F and -H or MV-HFlag as indicated or virus infected at an MOI of 0.1 PFU/cell. For some experiments, fusion inhibitory peptide (FIP) was added at a final concentration of 200 µM 12 h postinfection. After being washed with phosphate-buffered saline, cells were scraped in coimmunoprecipitation buffer (10 mM HEPES [pH 7.4], 50 mM sodium pyrophosphate, 50 mM sodium fluoride, 50 mM sodium chloride, 5 mM EDTA, 5 mM EGTA, 100 µM sodium vanadate, 1% Triton X-100) containing protease inhibitors (Complete mixture) and 1 mM PMSF. Lysates were cleared by centrifugation for 25 min at 20,000 x g and 4°C, and 300 µg of total protein was incubated with antibodies directed against MV H (Chemicon) for 90 min at 4°C. As an internal standard, 5 µg of total protein was mixed with urea buffer. Immune complexes were adsorbed to protein G-agarose (GibcoBRL) for 90 min at 4°C, washed in buffer 1 (100 mM Tris [pH 7.6], 500 mM lithium chloride, 0.1% Triton X-100, 1 mM dithiothreitol) and then buffer 2 (20 mM HEPES [pH 7.2], 2 mM EGTA, 10 mM magnesium chloride, 0.1% Triton X-100, 1 mM dithiothreitol), incubated in urea buffer for 25 min at 50°C, and subjected to Western analysis using antibodies specific for MV-F tail or ectodomain as indicated.
Neutralization assays.
Viral particles, corresponding to an MOI of 0.1 PFU/cell, were incubated with indicated concentrations of sCD46-C4bp
molecules (6) for 1 h at 37°C in Opti-MEM, absorbed to Vero cells for 90 min at 37°C, and incubated for 48 h after the addition of Dulbecco's modified Eagle's medium and 10% fetal calf serum. For harvesting, cells were scraped in Opti-MEM and subjected to three freeze-thaw cycles. A total of 2.5 µg of total protein was used for Western analysis, and cleared viral lysates were subjected to TCID50 titration.
|
|
|---|
![]() View larger version (51K): [in a new window] |
FIG. 1. Addition of the Flag epitope to the cytoplasmic tail of H results in increased fusogenicity. (A) Representative fields of view of Vero cells infected with MV-Edm and MV-HFlag (MOI = 0.03 PFU/cell) or uninfected (Co), at indicated times postinfection. (B) Growth kinetics of MV-Edm and MV-HFlag in Vero cells. Cells were infected at an MOI of 0.03 PFU/cell. At the indicated time points, titers were determined for both cell-associated and released viral particles. (C) Western analysis of total cell lysates derived from the experiment shown in panel B using anti-H and Flag antibodies.
|
When equal amounts of total protein from cell lysates were analyzed at each time point by Western blotting, H was more abundant in MV-HFlag- than MV-Edm-infected cells (Fig. 1C). Surprisingly, HFlag was detectable 6 h earlier in cells infected with the mutant virus. Considering the very similar growth kinetics of the two viruses, this may reflect differences in cell entry. The presence of the Flag epitope was confirmed by Western analysis with an anti-Flag antibody.
Importantly, when transiently coexpressed with MV-F protein in Vero cells, H-EdmFlag induced a level of syncytium formation similar to that of H-Edm (data not shown).
The phenotype of MV-HFlag is neither Vero cell nor Flag epitope dependent. The phenotype of MV-HFlag was studied with other CD46-positive cell types to investigate its general relevance. Syncytium formation in HeLa, HT1080 (data not shown), and MA104 cells was also more efficiently induced by MV-HFlag, as shown in Fig. 2A for MA104 cells, which displayed the most pronounced difference. In this cell line, MV-HFlag reached a significant difference in titer compared with MV-Edm and displayed a faster kinetics of virus growth (Fig. 2B). Western blot analysis of infected MA104 cells following the level of MV-H protein at each time point (Fig. 2C) mirrored the growth curves, showing a far greater level of H expression from MV-HFlag -infected cells. That this cell line replicated faster than Vero cells may reflect differences in cellular factors which contribute to the productivity of viral infection.
![]() View larger version (79K): [in a new window] |
FIG. 2. The phenotype of MV-HFlag is not Vero cell dependent and is most pronounced in MA104 cells. (A) Representative fields of view of MA104 cells infected with MV-Edm and MV-HFlag or uninfected (Co), at indicated hours postinfection. (B) Growth kinetics of MV-Edm and MV-HFlag in MA104 cells. Cells were infected at an MOI of 0.03 PFU/cell. At the indicated time points, titers of cell-associated viral particles were determined. (C) Western analysis of total cell lysates derived from the experiment shown in panel B using anti-H antibodies.
|
![]() View larger version (105K): [in a new window] |
FIG. 3. The mutant phenotype is not sequence restricted. (A) Representative fields of view of MA104 cells infected with MV-Edm, MV-HFlag, and MV-HHA or uninfected (Co) at indicated hours postinfection. (B) Endpoint titration of viruses derived from the cells shown in panel A. Titers of cell-associated virus were determined in duplicate.
|
![]() View larger version (19K): [in a new window] |
FIG. 4. MV-HFlag has an altered protein composition and a greater infectivity per particle than MV-Edm. (A) Composition of purified MV-Edm and MV-HFlag particles released from Vero cells. Particles were purified by sucrose centrifugation and subjected to Western analysis with sera derived against N, H, F, and M. Total amounts of infectious particles (PFU) associated with each preparation are indicated. Co, control. (B) Infectivity per released particles of purified MV-Edm and MV-HFlag, expressed as the number of PFU per counts per minute. Radiolabeled particles were purified and subjected to scintillation counting to determine counts per minute, and TCID50 titration was carried out to determine the number of infectious particles per preparation.
|
Since it is unknown whether normalizing for N equates to similar numbers of particles, we also analyzed infectivity after standardization based on metabolic labeling of total viral proteins by [35S]methionine and purification of released particles. The infectious titer associated with labeled particles was determined by TCID50 titration and expressed as the number of PFU per counts per minute (Fig. 4B). Using this assay, the infectivity per particle of purified MV-HFlag was about 1,000-fold greater than that of MV-Edm, roughly mirroring the data obtained when normalizing for N.
Interaction of tagged H-Edm with F-Edm is weaker than that of unmodified H in the context of viral infection. Considering our recent observation that the MV-F and -H proteins intracellularly form stable hetero-oligomers (25), it seemed possible that the epitope tags added to the H terminus interfere with glycoprotein complex formation either directly or indirectly through an interaction with M; either might provide the basis for the observed higher fusogenicity. To biochemically test this hypothesis, we carried out coimmunoprecipitation experiments using an antibody directed against the MV-H ectodomains, followed by Western blot analysis of the precipitates using an anti-F antibody. Comparing the amount of F which coimmunoprecipitated with H with that present in the total cell lysate as an internal standard enables calculation of the relative efficiency of the coimmunoprecipitation and thus of the strength of H/F interaction.
In cells transiently expressing F and H-Edm or F and H-EdmFlag, no differences could be observed in the strength of interaction between H and F proteins (Fig. 5A), in line with the indistinguishable biological activity of these two proteins. When this was assessed in the context of an infection, significantly less F could be coimmunoprecipitated with HFlag than with H although more F was present in MV-HFlag- than in MV-Edm-infected cells (Fig. 5B). Thus, when the epitope tag results in a phenotypic difference (i.e., in virus-infected cells), a significantly less stable complex of the tagged H with MV-F protein is formed. To confirm that modification of the cytoplasmic tail of MV-H caused a destabilization of the complex, we also compared the interaction between HHA and F by coimmunoprecipitation and found it also to be weaker than that between H-Edm and F in cells infected with MV-HHA and MV-Edm, respectively (Fig. 5B). Thus, it is the addition of an epitope tag to the cytosolic tail of H which causes the weakened interaction between H and F.
![]() View larger version (31K): [in a new window] |
FIG. 5. Interaction of HFlag with F is weaker than that of H with F in the context of viral infection. (A) Coimmunoprecipitation of F with H or HFlag following transient expression in Vero cells. F antigenic material from coimmunoprecipitated (IP) samples and total cell lysate (TL) was detected by Western analysis (WS) using specific antibodies directed against the cytosolic F tail. Control (Co) transfection was with equal amounts of noncoding plasmid DNA. (B) Coimmunoprecipitation of F with H from Vero cells infected with the indicated viruses at an MOI of 1.0 PFU/cell. (C) Analysis of MV recombinants lacking the M protein. Coimmunoprecipitation of F with H as in the results shown in panel B.
|
M recombinant was confirmed through DNA sequencing and Western analysis (data not shown). Lysates of cells infected with either MV-HFlag
M, MV-Edm
M (4), MV-HFlag, or MV-Edm were subjected to coimmunoprecipitation of F with H. The difference in coprecipitation efficiency between H or HFlag and F was unchanged regardless of the presence or absence of M (Fig. 5C). Interestingly, in both
M recombinant strains the glycoprotein complex stability was slightly increased, rather than decreased, compared to the corresponding parental strains carrying the M gene. Thus, the absence of M does not influence the effect caused by the epitope tags. Presumably, the difference in HFlag/F complex stability in the context of viral infection is due to the presence of ribonucleocapsid rather than the M protein alone.
MV-HFlag shows increased sensitivity to neutralization by soluble CD46.
We speculated that the weakened interaction between HFlag and F facilitates a more efficient infection by rendering the H/F glycoprotein complex prone to fusion. Since it is most likely that the MV entry cascade is initiated by receptor binding inducing conformational changes in H and then F, HFlag/F-containing complexes may conceivably be in an altered conformational state facilitating receptor binding. H/F complexes in such a conformation may be highly sensitive to neutralization by soluble receptor molecules. To test this hypothesis, we compared the sensitivity of MV-Edm and MV-HFlag to octameric sCD46-Cpb
molecules, previously shown to neutralize MV-Edm irreversibly and much more efficiently than monomeric sCD46 or antibodies derived against the MV glycoproteins (6).
Consistent with previous data, infection of Vero cells by MV-Edm was inhibited in a dose-dependent fashion by sCD46-Cpb
(Fig. 6A). MV-HFlag was, however, far more sensitive to neutralization by the soluble receptor, as apparent from the inhibition curves. These findings were mirrored by the expression levels of H protein from the infected cells determined 48 h postinfection. After pretreatment of MV-HFlag with increasing concentrations of sCD46-Cpb
, H levels decreased rapidly (Fig. 6B). In contrast, cells infected with pretreated MV-Edm revealed a far more moderate decrease in H expression. Thus, the weakened interaction between HFlag and F results in an increase in sensitivity to neutralization, consistent with this glycoprotein complex resembling an activated conformational state.
![]() View larger version (27K): [in a new window] |
FIG. 6. Inhibition of infection through soluble sCD46-Cpb molecules. (A) Cells were infected with the indicated viruses at an MOI of 0.1 PFU/cell in the presence of sCD46-Cpb molecules, and cell-associated particles were harvested 48 h postinfection and subjected to TCID50 titration. (B) Western analysis with anti-H antibodies of cell lysates derived from the cells shown in panel A.
|
When comparing growth of MV-Edm, MV-Moraten, and MV-Edm-H/F-Moraten in Vero cells (Fig. 7A), MV-Edm induced cell-to-cell fusion which lysed all cells about 48 h postinfection. In contrast, both MV-Moraten and MV-Edm-H/F-Moraten induced cytopathicity, based predominantly on rounding of individual cells rather than cell-to-cell fusion. Titers of the different viruses were comparable over time (Fig. 7B), although MV-Moraten and MV-Edm-H/F-Moraten maintained an extended plateau phase of virus production, presumably reflecting less-extensive cell death. Again, expression of MV-H protein over time was consistent with the observed titers, when equal amounts of protein were analyzed by Western blotting (Fig. 7C). Importantly, coimmunoprecipitation experiments revealed that the F and H glycoproteins of the viruses with reduced fusogenicity, MV-Moraten and MV-Edm-H/F-Moraten, form more stable heteromeric complexes than those of MV-Edm (Fig. 7D).
![]() ![]() View larger version (229K): [in a new window] |
FIG. 7. Strength of MV glycoprotein interaction is a determinant for viral cytopathicity. (A) Representative fields of view of Vero cells infected with MV-Edm, MV-Edm-H/F-Moraten, and MV-Moraten (MOI = 0.03 PFU/cell or uninfected (Co) at indicated time points postinfection. (B) Growth kinetics of the same strains in Vero cells. Cells were infected at an MOI of 0.03 PFU/cell. At the indicated time points, titers were determined for both cell-associated and released viral particles. (C) Western analysis of total cell lysates derived from the cells shown in panel B using anti-H antibodies. (D) Coimmunoprecipitation of F with H from Vero cells infected with the indicated viruses at an MOI of 1.0 PFU/cell. F antigenic material from coimmunoprecipitated samples (IP)and total cell lysate (TL) is shown. (E) The same experiments were carried out as those shown in panel D.7 Cells were infected with MV-HFlag or MV-Edm-H/F-Moraten, followed by treatment with FIP as indicated. Coimmunoprecipated samples (IP) and total cell lysate (TL) are shown.
|
Strength of MV glycoprotein interaction determines, rather than is determined by, cell-to-cell fusion. Although our data suggest that reduced stability of MV glycoprotein complexes causes increased cell-to-cell fusion, we cannot exclude that the fusion event itself provides the mechanistic basis for a reduction of H/F interactions. In this scenario, extensive cell-to-cell fusion, rather than resulting from a weakened interaction, could cause changes in the cellular environment which induce a destabilization of the complexes. To distinguish between these possibilities, we analyzed the strength of H/F interaction in cells infected with the two viruses displaying the most distinct phenotypes, i.e., MV-HFlag and MV-Edm-H/F-Moraten, in the presence and absence of FIP, a potent inhibitor of MV-induced cell-to-cell fusion (9).
In infected Vero cells, FIP completely prevented development of syncytia induced by both viruses (data not shown); whereas in the absence of the inhibitor, MV-HFlag induced extensive cell-to-cell fusion and MV-Edm-H/F-Moraten induced its characteristic cell-rounding cytopathic effect described earlier (see Fig. 7A). When assessing the strength of interaction of MV glycoproteins, the H/F coimmunoprecipitation efficiency observed for either virus was virtually identical in both the presence and absence of the inhibitor (Fig. 7E). Consistent with our earlier observations, MV-HFlag-derived H and F displayed a far weaker interaction than the MV-Edm-H/F-Moraten-derived glycoproteins. These data demonstrate that the strength of the MV envelope protein interactions indeed modulates the extent of cell-to-cell fusion, rather than vice versa.
|
|
|---|
Several lines of evidence support the modification of the H tail as the basis for the observed phenotype. Firstly, addition of a different epitope tag, HA, in place of Flag results in similar changes in viral phenotype, also demonstrating that the alteration does not depend on the specific sequence appended. Secondly, biochemical data demonstrate a weakened interaction between H-EdmFlag or H-EdmHA and F in both MV-HFlag and MV-HHA. Lastly, no further sequence changes were detected in the H open reading frame of the mutated viruses when analyzed by reverse transcription-PCR and DNA sequencing.
The phenotype of MV-HFlag is distinct from that of previously described MV mutants, since fusogenicity is improved without impairing the efficiency of replication. An MV-Edm derivative lacking M protein also displays an increase in cell-to-cell fusion but has a concomitantly reduced viral titer, particularly of released virus (4). Similarly, MV-Edm, lacking the cytoplasmic tails of both H and F, induces more-extensive lateral fusion but again with some loss in overall titer (5). It was also shown in these studies that the glycoproteins with truncated cytosolic tails were incorporated less efficiently into viral particles. We provide direct biochemical evidence that extending the cytoplasmic tail of MV H in the context of a viral infection impairs its interaction with F but results in both increased fusogenicity and infectivity.
When analyzing glycoproteins derived from different MV strains, attenuated or a primary isolate, we also observed an inverse correlation between lateral spread and cytopathicity and the stringency of glycoprotein interaction. For these experiments, recombinant particles were used that differ exclusively in their glycoproteins but have identical genomic backbones. Usage of receptor molecules other than CD46 by these recombinants as an alternative explanation for our observations appears unlikely because MV-Moraten and MV-Edm-H/F-Moraten grow to titers similar to those of MV-Edm on Vero cells, H-Moraten mutations compared to those of H-Edm do not affect known CD46 binding residues (1, 18), and MV-Edm-F-wtF differs from MV-Edm only in the F protein, which is not involved in viral attachment to target cells. Furthermore, all target cell lines analyzed in our study are CD150 (SLAM) negative.
The MV-M protein interacts with both the F cytosolic tail (33) and ribonucleocapsid (13, 34), presumably linking the viral genome to the glycoproteins. Interestingly, the difference in strength of interaction between H/F and HFlag/F complexes is unchanged in the presence or absence of M. Given that MV glycoprotein hetero-oligomerization already initiates in the endoplasmic reticulum (25), this might occur prior to their interaction with M. Our experiments suggest that presence of ribonucleocapsid results in a destabilization of the HFlag/F glycoprotein complexes, presumably reflecting conformational rearrangements. It is intriguing to speculate that the H cytoplasmic tails could interact directly with ribonucleocapsids. In the presence of HFlag the viral particles were enriched in both M and F proteins while the amount of H was slightly reduced. This increased incorporation of M and F might reflect a tighter binding of M to F cytosolic tails in MV-HFlag particles.
Despite their slightly tighter envelope glycoprotein interaction, viruses lacking the M protein were found to be highly fusogenic (4). This indicates that the modulatory effect of H/F interaction strength on fusogenicity may be mechanistically mediated through a complex interplay between the envelope glycoproteins, M and ribonucleocapsid, and that the strength of glycoprotein interaction constitutes an important parameter for, but is not the only determinant of, fusogenicity.
The increased sensitivity of MV-HFlag particles to neutralization through soluble receptor molecules furthermore suggests an altered conformational state of the HFlag/F complexes. Presumably, the cytosolic epitope tags induce a weakening of the glycoprotein complex stability, which results in a conformational rearrangement of the protein ectodomains increasing the binding affinity to the CD46 receptor and or resembling an activated state that facilitates fusion.
Interestingly, none of the sequence differences between glycoproteins derived from MV-Edm, MV-Moraten, and MV-wtF are localized in the cytosolic domains of the proteins, in contrast to the epitope tags added to the cytosolic tail of H-Edm. Thus, mutations in distant domains of the molecules, cytosolic or extracellular, can influence the stability of the MV-glycoprotein complex and therefore change viral cytopathicity. In conclusion, the strength of MV envelope protein interaction can be considered as a potent modulator of lateral viral spread.
This work was supported by grants from the Siebens and Mayo Foundations (to R.C.) and the Fraternity of the Eagles (to R.K.P.) and an Emmy-Noether postdoctoral fellowship from the Deutsche Forschungsgemeinschaft (to R.K.P.).
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»