Previous Article | Next Article 
Journal of Virology, May 2001, p. 4420-4423, Vol. 75, No. 9
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.9.4420-4423.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Human T-Cell Leukemia Virus Type 1 (HTLV-1)
Infection of Mice: Proliferation of Cell Clones with Integrated HTLV-1
Provirus in Lymphoid Organs
Masakazu
Tanaka,
Binlian
Sun,
Jianhua
Fang,
Takayuki
Nitta,
Toshinori
Yoshida,
Sayaka
Kohtoh,
Hiroko
Kikukawa,
Shuji
Hanai,
Kazuhiko
Uchida, and
Masanao
Miwa*
Department of Biochemistry and Molecular
Oncology, Institute of Basic Medical Sciences and Center for Tsukuba
Advanced Research Alliance, University of Tsukuba, Tsukuba, Ibaraki
305-8575, Japan
Received 18 September 2000/Accepted 30 January 2001
 |
ABSTRACT |
Human T-cell leukemia virus type 1 (HTLV-1) is suggested to cause
adult T-cell leukemia after 40 to 50 years of latency in a small
percentage of carriers. However, little is known about the
pathophysiology of the latent period and the reservoir organs where
polyclonal proliferation of cells harboring integrated provirus occurs.
The availability of animal models would be useful to analyze the latent
period of HTLV-1 infection. At 18 months after HTLV-1 infection of
C3H/HeJ mice inoculated with the MT-2 cell line, which is an
HTLV-1-producing human T-cell line, HTLV-1 provirus was detected in
spleen DNA from eight of nine mice. No more than around 100 proviruses
were found per 105 spleen cells. Cellular sequences
flanking the 3' long terminal repeat (LTR) and the clonalities of the
cells which harbor integrated HTLV-1 provirus were analyzed by
linker-mediated PCR. The results showed that the flanking sequences are
of mouse genome origin and that polyclonal proliferation of the spleen
cells harboring integrated HTLV-1 provirus had occurred in three mice.
A sequence flanking the 5' LTR was isolated from one of the mice and
revealed the presence of a 6-nucleotide duplication of cellular
sequences, consistent with typical retroviral integration. Moreover,
PCR was performed on DNA from infected tissues, with LTR primers and primers derived from seven novel flanking sequences of the three mice.
Data revealed that the expected PCR products were found from lymphatic
tissues of the same mouse, suggesting that the lymphatic tissues were
the reservoir organs for the infected and proliferating cell clones.
The mouse model described here should be useful for analysis of the
carrier state of HTLV-1 infection in humans.
| |
TEXT |
Human T-cell leukemia virus type 1 (HTLV-1) is believed to cause various HTLV-1-associated diseases
including adult T-cell leukemia/lymphoma (ATL) (7, 22).
Before the manifestation of ATL, there is a long latency period, of up
to 40 to 50 years, after HTLV-1 infection, when the infected individual
is an asymptomatic carrier. In addition, only 2 to 3% of infected
individuals develop ATL (20). These facts suggest that a
multistep carcinogenesis model could be applied to explain the
leukemogenesis in ATL (16).
During the long latent period of HTLV-1 infection, most carriers show
polyclonal proliferation of cells harboring integrated HTLV-1 provirus
(21, 26). However, the reservoir organs of cell clones
harboring integrated HTLV-1 provirus are not clear in humans. The study
of the pathophysiology of the carrier states of HTLV-1 infection is
essential for analysis of the mechanism of the progression to ATL.
However, it is difficult to study the clonal proliferation of cells
harboring integrated HTLV-1 provirus in human organs (2,
4).
The availability of animal models would be useful to analyze the
reservoir organs where cell clones harboring integrated HTLV-1 provirus
are persistent during the carrier state. Although HTLV-1 transmission
in experimental animals has been reported for rabbits (1, 12, 17,
18, 23), monkeys (24, 25), and rats (10,
19), little information is available on the reservoir organs for
cell clones which harbor integrated HTLV-1 in the persistently infected
animals. We recently reported HTLV-1 transmission to newborn mice and
maintenance of HTLV-1 provirus in the mouse spleen for 4 months
(5, 6).
In this work, we found that the mode of integration of HTLV-1 after
inoculation of MT-2 cells (15) is consistent with that reported in the typical retrovirus infection, which shows duplication of the cellular sequences at the site of integration, and we found that
the lymphatic tissues, the spleen in particular, are the major
reservoir organs of HTLV-1-infected cells that show clonal proliferation, even at a low frequency. The cell clones infected with
HTLV-1 at a lower level were identified by linker-mediated (LM)-PCR in
the spleen, and the same cell clones were found in other lymphatic
tissues of the same animals.
Ten offspring from three pregnant C3H/HeJ (3) mice were
each injected intraperitonealy with 2.5 × 106 MT-2
cells within 24 h after birth and again at 1-week of age (6). One mouse died of malignant histiocytoma at 15 months of age. The long terminal repeat (LTR) and pX sequences of the HTLV-1
provirus in the mouse organs were detected by PCR when the mice were 18 months old. HTLV-1 provirus was detected frequently in peripheral blood
mononuclear cells (PBMC), spleen, and lymph nodes but less frequently
in the liver, kidneys, and thyroid. These results are consistent with
the recent report of a study with experimentally infected squirrel
monkeys (11).
To detect the clonal proliferation of cells in PBMC harboring
integrated HTLV-1 provirus, we performed LM-PCR (28) but
could not detect the amplified band. This might be due to the low
abundance of HTLV-1 provirus in PBMC compared to that in the spleen
and/or to the sensitivity of our LM-PCR, which proved to be 
10 copies of HTLV-1 provirus using the ATL-1K cell line, which has only one
HTLV-1 provirus integrated per cell (reference 9 and data not shown).
Next we performed LM-PCR with the spleens of mice 1, 2, 3, 5, 6, and 9, which were determined to have 10 to 100 copies of pX sequences per
105 cells by our semiquantitative PCR method (13,
14). The spleens of these mice showed positive signals in
LM-PCR. The representative LM-PCR pattern in mice 1, 5, and 6 (Fig.
1) clearly demonstrated that there are
heterogeneous cell clones with different flanking sequences, which are
consistent with polyclonal integration of HTLV-1 provirus into the
spleen cells of these mice.
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
LM-PCR analysis of cell clones with different
integration sites. The results of LM-PCR on spleen DNA from mice 1, 5, and 6 are presented. P, positive control (ATL-1K cell DNA).
|
|
These LM-PCR products were successfully cloned and sequenced. The
clones that have more than 39 nucleotides to prove their mouse origin
by PCR are shown in Table 1. The
amplification of these flanking sequences by PCR from normal mouse DNA
but not from MT-2 cell DNA (5, 6) showed that these
sequences are of mouse genome origin (data not shown).
Clone 5C4 showed identity to a genomic sequence near the Mus
musculus 45S pre-rRNA gene (nucleotides 2226 to 2277; GenBank accession no. X82564). To determine whether the mouse cellular sequence
was flanked by the 5' LTR of clone 5C4, the forward primer, 5C4-5' F (5'GTGGAGCACACCTTTAACCT3') was designed
from the available database and PCR was performed with the
reverse primer at the U3 region of the 5' LTR,
5'AGCCATATGCGTGCCATGAA3', using a template of spleen DNA of
mouse 5. The amplified band was excised, cloned, and sequenced, as
shown in Fig. 2. It is clear that a
6-nucleotide duplication, 5'TTTTCC3', is found in the
flanking sequence of the 5' and 3' LTR. This suggests that HTLV-1 is
integrated in mouse cells in a mode typical of retrovirus integration.
The sequence of clone 6C2 turned out to be the open reading frame of
the mouse L1 element, which is abundant in the mouse genome.
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
A 6-nucleotide duplication is found in the flanking
sequence of the 5' and 3' LTR. The nucleotide sequences of the 5' and
3' flanks of clone 5C4 in mouse 5 are shown. The double underlines show
the 6-nucleotide (nt) duplication of the mouse sequences.
|
|
The LM-PCR was performed with samples from other organs such as lymph
nodes, kidneys, and liver, but there was no amplified band. This might
be due to similar reasons to those discussed for PBMC (see above).
These results strongly suggest that spleen is the major reservoir organ
of HTLV-1-infected cells in mice.
We next checked whether each cell clone identified in the spleen DNA
was also found in several other organs. PCR was performed with a
forward primer, Bio-2, complementary to a part of the 3' LTR, and with
a reverse primer which was designed from the novel mouse flanking
sequences (Fig. 3; Table 1). The results
showed that these clones were found in the spleen, lymph nodes, liver, kidneys, lungs, and ovaries (Table 2).
The copy numbers of these clones were assayed semiquantitatively by
serial dilution of DNA aliquots from mouse 5. The results showed that
there were 750 to 3,000 or more cells that have the same integration
site per 108 spleen cells, if the cells contain one
provirus per cell. It is not clear whether these small numbers of each
cell clone show proliferation through immune stimulation or are driven
by integrated HTLV-1 provirus. Considering the number of cell clones
found in these mice, the clonal proliferation might be due to ongoing
immune stimulation of T-cell or B-cell clones which happen to harbor the provirus. This is consistent with the multistep carcinogensis model
of HTLV-1 if these latently infected cells are at the stage of being a
carrier before malignant transformation. For more strong clonal
expansion, it is necessary to have additional genetic or epigenetic
events which lead to leukemia.
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Organ distribution of the same cell clone harboring
integrated HTLV-1 provirus in mouse 5. (A) Example of the design scheme
for PCR detection of the cells with clone 5C1. (B) The products were
electrophoresed in a 2% agarose gel, and Southern hybridization was
performed with a probe. Forward primer, Bio-2 (28);
reverse primer, 5'AAGATTGTGGGGATAACCAA3'; probe; Bio-5
(28). The first nucleotide of the flanking sequence was
designated 1. SP, spleen; LI, liver; MG, mammary gland; KI, kidney; OV,
ovary; TH, thymus; LN, lymph nodes; UT, uterus.
|
|
It is interesting that HTLV-1-infected cells reside mainly in the
lymphatic tissues, the spleen in particular. Although the function of
HTLV-1 integration in HTLV-1-infected cells is not known, it is clear
that the cell clones which harbor integrated HTLV-1 provirus can be
easily identified in the spleen as well as in the other lymphatic
tissues. These cell clones, even at a low frequency, continue to
proliferate and are not eliminated in these organs. This is consistent
with the finding that the proviral load in PBMC of HTLV-1 carriers
spans about 5 orders of magnitude, from 1 to 40,000/105
PBMC (14).
The presence of small numbers of latently infected cells in the
lymphatic tissues might be analogous to the condition of the remaining
HIV-1-infected cells in the reservoir organs even after highly active
antiretroviral therapy (8).
Our results indicate that the cell clones harboring integrated HTLV-1
provirus have preferred reservoir organs, in this case lymphatic
tissues, and that PBMC alone are not sufficient for detecting the
clonal state of cells harboring integrated HTLV-1 provirus. The
preferred distribution of provirus in different organs might be
consistent with various HTLV-1-associated diseases in humans
(27). The antibody against HTLV-1 antigens was negative when MT-2 cells were injected during the neonatal period but was positive when they were injected into mice aged 7 months (data not
shown). The reverse transcriptase activity in the supernatant of
splenocytes of HTLV-1-infected mice after being cultured for 2 weeks
was negative. This might be due to the small number of virus-integrated
cells or to the low expression of viral gene, which should be clarified
in future studies. However, the present work suggests that mice could
be used as an HTLV-1 carrier model in an analysis of the mechanism of
the persistence of cell clones with integrated HTLV-1 provirus in
reservoir organs and as a simple model in the evaluation of possible
vaccine or antisense strategies to prevent HTLV-1 infection in vivo.
| |
ACKNOWLEDGMENTS |
We thank T. Nagasawa, H. Abe, R. Feng, and N. Arashi-Hesse for kind suggestions.
This work was supported in part by a Grant-in-Aid for the 2nd Term of
the Comprehensive 10-Year Strategy for Cancer Control and Cancer
Research from the Ministry of Health and Welfare and from the Ministry
of Education, Science, Sports and Culture of Japan.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Oncology, Institute of Basic Medical
Sciences and Center for Tsukuba Advanced Research Alliance, University of Tsukuba, Tsukuba, Ibaraki 305-8575, Japan. Phone: 81-298-53-3272. Fax: 81-298-53-3271. E-mail:
m-miwa{at}md.tsukuba.ac.jp.
| |
REFERENCES |
| 1.
|
Akagi, T.,
I. Takeda,
T. Oka,
Y. Ohtsuki,
S. Yano, and I. Miyoshi.
1985.
Experimental infection of rabbits with human T-cell leukemia virus type I.
Jpn. J. Cancer Res.
76:86-94[Medline].
|
| 2.
|
Cavrois, M.,
S. Wain-Hobson,
A. Gessain,
Y. Plumelle, and E. Wattel.
1996.
Adult T-cell leukemia/lymphoma on a background of clonally expanding human T-cell leukemia virus type-1-positive cells.
Blood
88:4646-4650[Abstract/Free Full Text].
|
| 3.
|
Coutinho, A.
1976.
Genetic control of B-cell response. II. Identification of the spleen B-cell defect in C3H/HeJ mice.
Scand. J. Immunol.
5:129-140[CrossRef][Medline].
|
| 4.
|
Etoh, K.,
S. Tamiya,
K. Yamaguchi,
A. Okayama,
H. Tsubouchi,
T. Ideta,
N. Mueller,
K. Takatsuki, and M. Matsuoka.
1997.
Presistent clonal proliferation of human T-lymphotropic virus type I-infected cells in vivo.
Cancer Res.
57:4862-4867[Abstract/Free Full Text].
|
| 5.
|
Fang, J.,
S. Kushida,
R. Feng,
M. Tanaka,
H. Kikukawa,
T. Kawamura,
K. Uchida, and M. Miwa.
1997.
Integration of HTLV-1 provirus into mouse transforming growth factor- gene.
Biochem. Biophys. Res. Commun.
233:792-795[CrossRef][Medline].
|
| 6.
|
Fang, J.,
S. Kushida,
R. Feng,
M. Tanaka,
T. Kawamura,
H. Abe,
N. Maeda,
M. Onobori,
M. Hori,
K. Uchida, and M. Miwa.
1998.
Transmission of human T-cell leukemia virus type 1 to mice.
J. Virol.
72:3952-3957[Abstract/Free Full Text].
|
| 7.
|
Franchini, G.
1995.
Molecular mechanism of human T-cell leukemia/lymphotropic virus type 1 infection.
Blood
86:3619-3639[Free Full Text].
|
| 8.
|
Haase, A. T.
1999.
Population biology of HIV-1 infection: viral and CD4+ T cell demographics and dynamics in lymphatic tissues.
Annu. Rev. Immunol.
17:625-656[CrossRef][Medline].
|
| 9.
|
Hoshino, H.,
H. Esumi,
M. Miwa,
M. Shimoyama,
K. Minato,
K. Tobinai,
M. Hirose,
S. Watanabe,
N. Inada,
K. Kinoshita,
S. Kamihira,
M. Ichimaru, and T. Sugimura.
1983.
Establishment and characterization of 10 cell lines derived from patients with adult T-cell leukemia.
Proc. Natl. Acad. Sci. USA
80:6061-6065[Abstract/Free Full Text].
|
| 10.
|
Ishiguro, N.,
M. Abe,
K. Seto,
H. Sakurai,
H. Ikeda,
A. Wakisaka,
T. Togashi,
M. Tateno, and T. Yoshiki.
1992.
A rat model of human T lymphocyte virus type I (HTLV-I) infection. 1. Humoral antibody response, provirus integration, and HTLV-I-associated myelopathy/tropical spastic paraparesis-like myelopathy in seronegative HTLV-I carrier rats.
J. Exp. Med.
176:981-989[Abstract/Free Full Text].
|
| 11.
|
Kazanji, M.,
A. Ureta-Vidal,
S. Ozden,
F. Tangy,
B. de Thoisy,
L. Fiette,
A. Talarmin,
A. Gessain, and G. de The.
2000.
Lymphoid organs as a major reservoir for human T-cell leukemia virus type 1 in experimentally infected squirrel monkeys (Saimiri sciureus): provirus expression, persistence, and humoral and cellular immune responses.
J. Virol.
74:4860-4867[Abstract/Free Full Text].
|
| 12.
|
Kotani, S.,
S. Yoshimoto,
K. Yamato,
M. Fujishita,
M. Yamashita,
Y. Ohtsuki,
H. Taguchi, and I. Miyoshi.
1986.
Serial transmission of human T-cell leukemia virus type I by blood transfusion in rabbits and its prevention by use of X-irradiated stored blood.
Int. J. Cancer
37:843-847[Medline].
|
| 13.
|
Matsumura, M.,
S. Kushida,
Y. Ami,
K. Uchida,
T. Kameyama,
A. Terano,
H. Shiraki,
H. Sato, and M. Miwa.
1992.
A simple and reliable method for the detection and quantitation of the human T-cell leukemia virus type-I provirus in peripheral blood mononuclear cells of seropositive blood donors.
Jpn. J. Clin. Oncol.
22:335-341.
|
| 14.
|
Matsumura, M.,
S. Kushida,
Y. Ami,
T. Suga,
K. Uchida,
T. Kameyama,
A. Terano,
Y. Inoue,
H. Shiraki,
K. Okochi,
H. Sato, and M. Miwa.
1993.
Quantitation of HTLV-1 provirus among seropositive blood donors: relation with antibody profile using synthetic peptides.
Int. J. Cancer
55:220-222[Medline].
|
| 15.
|
Miyoshi, I.,
I. Kubonishi,
S. Yoshimoto,
T. Akagi,
Y. Ohtsuki,
Y. Shiraishi,
K. Nagata, and Y. Hinuma.
1981.
Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukemic T cells. 1981.
Nature
294:770-771[CrossRef][Medline].
|
| 16.
|
Okamoto, T.,
Y. Ohno,
S. Tsugane,
W. Watanabe,
M. Shimoyama,
K. Tajima,
M. Miwa, and T. Shimotohno.
1989.
Multi-step carcinogensis model for adult T-cell leukemia.
Jpn. J. Cancer Res.
80:191-195[CrossRef][Medline].
|
| 17.
|
Seto, A.,
T. Isono, and K. Ogawa.
1991.
Infection of inbred rabbits with cell-free HTLV-1.
Leuk. Res.
15:105-110[CrossRef][Medline].
|
| 18.
|
Seto, A.,
M. Kawanishi,
S. Matsuda, and K. Ogawa.
1988.
Seronegative virus carriers in the infection of rabbits with human T lymphotropic virus type I.
J. Exp. Med.
168:2409-2414[Abstract/Free Full Text].
|
| 19.
|
Suga, T.,
T. Kameyama,
T. Kinoshita,
K. Shimotohno,
M. Matsumura,
H. Tanaka,
S. Kushida,
Y. Ami,
M. Uchida,
K. Uchida, and M. Miwa.
1991.
Infection of rats with HTLV-1: a small animal model for HTLV-1-carriers.
Int. J. Cancer
49:764-769[Medline].
|
| 20.
|
Tajima, K.,
The T and B Cell Malignancy Study Group, and co-authors.
1990.
The 4th nationwide study of adult T cell leukemia/lymphoma (ATL) in Japan: estimates of risk of ATL and its geographical and clinical features.
Int. J. Cancer
45:237-243[Medline].
|
| 21.
|
Tsukasaki, K.,
H. Tsusima,
M. Yamamura,
T. Hata,
K. Murata,
T. Maeda,
S. Atogami,
H. Sohda,
S. Momita,
S. Ideda,
S. Katamine,
Y. Yamada,
S. Kamihira, and M. Tomonaga.
1997.
Integration patterns of HTLV-1 provirus in retation to the clinical course of ATL: frequent clonal change at crisis from indolent disease.
Blood
89:948-956[Abstract/Free Full Text].
|
| 22.
|
Uchiyama, T.,
J. Yodoi,
K. Sagawa,
K. Takatsuki, and H. Uchino.
1977.
Adult T-cell leukemia: clinical and hematologic features of 16 cases.
Blood
50:481-492[Free Full Text].
|
| 23.
|
Uemura, Y.,
S. Kotani,
S. Yoshimoto,
M. Fujishita,
M. Yamashita,
Y. Ohtsuki,
H. Taguchi, and I. Miyoshi.
1987.
Mother-to-offspring transmission of human T cell leukemia virus type I in rabbits.
Blood
69:1255-1258[Abstract/Free Full Text].
|
| 24.
|
Yamamoto, N.,
M. Hayami,
A. Komuro,
J. Schneider,
G. Hunsmann,
M. Okada, and Y. Hinuma.
1984.
Experimental infection of cynomolgus monkeys with a human retrovirus, adult T-cell leukemia virus.
Med. Microbiol. Immunol.
173:57-64[CrossRef][Medline].
|
| 25.
|
Yamanouchi, K.,
K. Kinoshita,
R. Moriuchi,
S. Katamine,
T. Amagasaki,
S. Ikeda,
M. Ichimaru,
T. Miyamoto, and S. Hino.
1985.
Oral transmission of human T-cell leukemia provirus type-I into a common marmoset (Callithrix jaccus) as an experimental model for milk-born transmission.
Jpn. J. Cancer Res.
76:481-487[Medline].
|
| 26.
|
Yoshida, M.,
M. Seiki,
K. Yamaguchi, and K. Takatsuki.
1984.
Monoclonal integration of human T-cell leukemia provirus in all primary tumars of adult T-cell leukemia suggests causative role of human T-cell leukemia virus in the disease.
Proc. Natl. Acad. Sci. USA
81:2534-2537[Abstract/Free Full Text].
|
| 27.
|
Watanabe, T.
1997.
HTLV-1-associated diseases.
Int. J. Hematol.
66:257-278[CrossRef][Medline].
|
| 28.
|
Wattel, E.,
J.-P. Vartanian,
C. Pannetier, and S. Wain-Hobson.
1995.
Clonal expansion of human T-cell leukemia virus type I-infected cells in asymptomatic and symptomatic carriers without malignancy.
J. Virol.
69:2863-2868[Abstract].
|
Journal of Virology, May 2001, p. 4420-4423, Vol. 75, No. 9
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.9.4420-4423.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Top
Abstract
Text
