Previous Article | Next Article 
Journal of Virology, May 2001, p. 4239-4246, Vol. 75, No. 9
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.9.4239-4246.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Jaagsiekte Sheep Retrovirus Proviral Clone JSRVJS7,
Derived from the JS7 Lung Tumor Cell Line, Induces Ovine Pulmonary
Carcinoma and Is Integrated into the Surfactant Protein A
Gene
James C.
DeMartini,1,*
Jeanette V.
Bishop,1
Thomas E.
Allen,1
F. A.
Jassim,2
J. Michael
Sharp,2
Marcelo
de las
Heras,3
Dennis R.
Voelker,4 and
Jonathan
O.
Carlson5
Departments of
Pathology1 and
Microbiology,5 Colorado State
University, Fort Collins, and National Jewish Medical and
Research Center, University of Colorado Health Sciences Center,
Denver,4 Colorado; the Moredun Research
Institute, International Research Center, Penicuik, Midlothian, United
Kingdom2; and Facultad de
Veterinaria, Universidad de Zaragoza, Zaragoza,
Spain3
Received 8 December 2000/Accepted 6 February 2001
 |
ABSTRACT |
Ovine pulmonary carcinoma (OPC) is a contagious neoplasm of
alveolar epithelial type II (ATII) or Clara cells caused by a type D/B
chimeric retrovirus, jaagsiekte sheep retrovirus (JSRV). Here we report
the isolation, sequencing, pathogenicity, and integration site of a
JSRV provirus isolated from a sheep lung tumor cell line (JS7). The
sequence of the virus was 93 to 99% identical to other JSRV isolates
and contained all of the expected open reading frames. To produce
virions and test its infectivity, the JS7 provirus
(JSRVJS7) was cloned into a plasmid containing a cytomegalovirus promoter and transfected into 293T cells. After intratracheal inoculation with virions from concentrated supernatant fluid, JSRV-associated OPC lesions were found in one of four lambs, confirming that JSRVJS7 is pathogenic. In JS7-cell DNA, the
viral genome was inserted in the protein-coding region for the
surfactant protein A (SP-A) gene, which is highly expressed in ATII
cells, in an orientation opposite to the direction of transcription of the SP-A gene. No significant transcription was detected from either
the viral or the SP-A gene promoter in the JS7 cell line at passage
level 170. The oncogenic significance of the JSRV proviral insertion
involving the SP-A locus in the JS7 tumor cell line is unknown.
 |
INTRODUCTION |
Ovine pulmonary carcinoma (OPC),
also known as sheep pulmonary adenomatosis and jaagsiekte, is a
contagious neoplasm of sheep that shares several features with human
bronchioloalveolar carcinoma (BAC) (9, 23). Both OPC and
BAC are tumors of alveolar epithelial type II (ATII) cells or
nonciliated bronchiolar (Clara) cells, and both exhibit multifocal
growth in the periphery of the lung in adults (4, 20, 27).
A common feature of OPC and some cases of human BAC is production of
copious quantities of lung fluid, an apparent secretory product of the
tumor cells. BAC is only weakly associated with smoking and accounts
for about 24% of human lung cancer cases (3, 38). The
etiology of BAC is unknown, whereas OPC is caused by jaagsiekte sheep
retrovirus (JSRV) (25, 39). The lung fluid produced in OPC
cases contains JSRV, and the disease can be experimentally induced by
intratracheal inoculation of lung fluid or cell-free tumor filtrate
into lambs (8, 34). The time required to experimentally
induce lung tumors is inversely proportional to the amount of reverse
transcriptase (RT) activity in the inoculum (37). Recently
it was shown that JSRV derived from a molecular proviral clone was able
to cause OPC when inoculated intratracheally into newborn lambs
(25).
The genome of JSRV was originally cloned as cDNA produced from virus
particles in lung fluid from South African (39) and Peruvian (12) OPC cases. Analysis of the nucleotide
sequence of JSRV shows a simple retroviral gag-pol-env
organization with an additional alternate open reading frame,
designated orfX, contained in the pol gene
(1, 39). JSRV is very closely related to the enzootic
nasal tumor virus which is associated with transmissible intranasal
tumors of sheep and goats (6). JSRV is also closely related to a family of endogenous sheep retroviruses in the sheep genome (1, 2, 12, 13, 24). Using exogenous JSRV-specific U3 and TM probes, Southern blot hybridization revealed a single proviral integration site in the JS7 lung tumor cell line
(1), suggesting this cell line as a good candidate for
isolation of a JSRV provirus and characterization of its integration site.
JSRV proviral DNA, mRNA, and capsid protein are consistently detected
in OPC tumor cells, but virus, whether purified from lung fluid or
produced from an infectious clone, replicates only at low levels in
sheep cell lines (26). The oncogenic role of JSRV in OPC
is not well defined, and much of the virology, molecular biology, and
pathogenesis of the JSRV-OPC system remain to be elucidated. The
prolonged incubation period and slow, progressive clinical course of
naturally occurring OPC suggest the possibility that virus-induced
genetic changes in tumor cells may be important in the pathogenesis of
the disease. The long-term goal of our work is to determine whether
insertional mutagenesis by JSRV plays a role in the pathogenesis of
naturally occurring OPC by determining whether shared integration sites
exist, and if so, whether host genes are activated, rearranged, or
deleted in tumor cells. An additional objective of the present study
was to obtain a full-length JSRV proviral clone for subsequent analysis
and pathogenicity studies. We report here the cloning of an infectious
and pathogenic JSRV provirus from the JS7 cell line derived from an OPC
case. This cell line contained a single proviral insertion in the gene encoding pulmonary surfactant protein A (SP-A). The SP-A gene is highly
expressed in ATII cells and Clara cells, and its protein is a major
component of pulmonary surfactant, which is produced in abundance in
OPC-affected sheep.
 |
MATERIALS AND METHODS |
Cell culture.
The JS7 line was derived from OPC tumor tissue
obtained from an adult sheep with naturally occurring disease using a
three-step procedure described previously (16). The cell
line 293T has also been described (26). Cells were
cultured in a humidified 5% CO2 incubator in Dulbecco's
modified Eagle's medium supplemented with 10% fetal bovine serum
(Sigma), 100 U of penicillin per ml, and 100 µg of streptomycin per
ml (DMEM).
Immunoblotting.
Protein immunoblot analysis of ovine lung
fluid and supernatant from OPC cell lines followed the procedure of
Sharp and Herring (35) using goat antiserum to
Mason-Pfizer monkey virus p27 and iodinated rabbit anti-sheep
F(ab)2 to detect the 26-kDa JSRV capsid antigen (CA).
Immunoblot analysis of concentrated JSRVJS7 virus from
transfected 293T cells was performed using rabbit antiserum to JSRV CA
as previously described (22).
Electron microscopy.
Cell monolayers between passages 6 and
37 were fixed in situ for 10 min with 1% glutaraldehyde in 0.1 M
phosphate buffer (pH 7.2) before physical detachment and centrifugation
to pellet the cells. The cell pellet was fixed for a further 2 h
in 3% glutaraldehyde and postfixed in 1% osmium tetroxide. Ultrathin
sections were cut and stained with uranyl acetate and lead citrate.
Library construction.
Genomic DNA (100 µg) from JS7 cells
(passage 170) was partially digested with 0.85 × 10
3 U of restriction endonuclease Sau3A per
µg for 30 min at 37°C to generate fragments between 12 and 23 kb;
these were ligated to BamHI-digested arms of the lambda
BlueStar vector (Novagen). The library was generated as recommended by
the manufacturer. The final titer of the JS7 library before
amplification was 1.35 × 106 PFU/µg. After
amplification the titer was calculated to be 4.7 × 109 PFU/µg.
For screening, phage (9.9 × 104 PFU) were adsorbed to
ER1647 host cells and then plated. Once plaques reached 1 to 2 mm, they were transferred to duplicate nitrocellulose membranes, denatured (1.5 M NaCl, 0.5 M NaOH), neutralized (1.5 M NaCl, 0.5 M Tris-HCl [pH
8.0]), and dried in an 80°C vacuum oven for 15 min. Membranes were
prehybridized in a solution containing 6× SSC (1× SSC is 0.15 M NaCl
plus 0.015 M sodium citrate), 5× Denhardt's reagent, 0.5% sodium
dodecyl sulfate (SDS), 100 µg of fragmented salmon sperm DNA per ml,
and 50% deionized formamide at 42°C overnight. [32P]
dCTP-labeled probes were produced using PCR
(33). Primers for the amplification of U3 were JB24
(AAGAATTTTTAAAAGCTCTTAAGG) and JB25R
(ACAATGCTATATTTATAAAGTACA). Primers for the amplification of
TM were JB26 (TGGAAAACCCTGATCGGTCTAGGA) and JB27R
(TAGTTCTATATTTCATATGTAGCA). PCR conditions for generation of
probes were the following: 1 ng of template, 1× PCR buffer, 200 µM
dGTA mix, 300 nmol of each primer, 2.5 U of Taq polymerase
(Sigma), and 50 µCi of [
-32P]dCTP (6,000 Ci/mmol;
Amersham). Amplification cycles consisted of 94°C for 1 min (1 cycle); 94°C for 30 s, 50°C for 30 s, 72°C for 30 s (30 cycles); and 72°C for 5 min (1 cycle). Probes were purified
through an Elutip (Schleicher and Schuell), boiled, and added to the
membranes. Membranes were washed twice for a total of 30 min at low
stringency (2× SSC, 0.1% SDS at 25°C), once at medium stringency
(1× SSC, 0.1% SDS at 25°C) for 15 min, and once at medium
stringency at 37°C for 30 min. The membranes were exposed to Kodak
X-Omat film overnight at
70°C. Positive plaques were picked and
rescreened, and the phage DNA was isolated (Qiagen).
Sequence generation and analysis.
The lambda
JSRVJS7 clone was sequenced in the forward and reverse
directions using an ABI 377 automated sequencer. Sequence data was
assembled and analyzed using Lasergene (DNASTAR, Inc.). Other JSRV and
endogenous sheep retrovirus sequences used in comparative analysis were
obtained from GenBank.
Plasmids and virus production.
All plasmid propagation, DNA
ligation, and PCR amplification was performed as previously described
(33). PCR amplification cycles consisted of 94°C for 2 min (1 cycle); 94°C for 30 s, 55°C for 30 s, 72°C for
45 s (30 cycles); and 72°C for 5 min (1 cycle). The full-length
JSRVJS7 proviral genome was cloned into the vector pCMV-Script (Stratagene) by replacing the upstream U3 region with the
human cytomegalovirus (CMV) immediate-early promoter contained within
the pCMV-Script vector while maintaining the native start site of
transcription for the virus. This was accomplished by PCR amplification
of region 232 to 588 of pCMV-Script with primers TA-1F
(AGTGTATCATATGCCAAGTAC) and TA-2R
(CTCTTCGTGCGGTTCACTAAACCAGCTCTG), creating a PCR product
containing a 5' NdeI site and a 3' Eam1104I site.
Region 3820 to 4185 in JSRVJS7 was amplified with primers TA-3F (CTCTTCAGCAGAGTATCAGCCATTTTGGTC) and TA-4R
(GCGGCCGCAAGAAAATTAATTAATTTGGG), which created a PCR product
with a 5' Eam1104I site and a 3'-internal PacI
site. A DNA restriction fragment spanning region 4171 to 11392 of
JSRVJS7 was created by digesting the provirus clone with the restriction enzymes PacI and NotI. Following
digestion and purification of each PCR product and of the DNA
restriction fragment, a three-way ligation was performed to create the
full-length CMV-driven provirus, pCMV-JSRVJS7. Plasmid
pCMV-J:gag-pol was created by amplification of the region
4084 to 111285 using primers TA-9F (TCTGAGCTCATGGGACAAACGCATAGTCGT) and TA-10R
(CTGCGGCCGCGGTATAATGCGTCCGAATTT), creating a PCR product
with a 5' SacI site and a 3'-internal PacI site.
A DNA restriction fragment spanning region 4171 to 9090 of
JSRVJS7 was created by digesting the provirus clone with
the restriction enzymes PacI and BamHI. The 3'
end of the gag-pol gene was then created by PCR
amplification of the region 9070 to 9268 in the provirus with primer
TA-11F (GATGGAAGGATCCATTTACGA) and TA-12R
(TGTGGTACCTCACTCGTGGGCTCGCTCAGC), creating a PCR product with a 5' BamHI site and a 3' KpnI site. A
three-way ligation into the corresponding sites in the pCMV-Script
vector was then performed. Plasmid pCMV-J:env was produced
by PCR amplification of the region 9165 to 11012 using primers TA-13F
(TGTGAGCTCATGCCGAAGCGCCGCGCTGGA) and TA-14R
(TGTGGTACCTCACGGGTCGTCCCCCGCATC), creating a PCR product with a 5' SacI site and a 3' KpnI site, which was
also ligated into the pCMV-Script vector.
Transfection of pCMV-JSRVJS7, pCMV-J:gag-pol,
and pCMV-J:env was performed using LipofectAmine (Life
Technologies) as described by the manufacturer. Briefly, 293T cells
were plated in 60-mm tissue culture plates and then incubated for ~15
h or until the cells reached 70% confluence. Two micrograms of each
plasmid was then mixed with 18 µl of LipofectAmine in 400 µl of
serum-free DMEM (SFM) and then subjected to a 40-min incubation at room
temperature; 1.6 ml of SFM was then added to the transfection mixture.
Cells were washed with SFM twice to remove any traces of serum; this was followed by addition of transfection mixture to the cells. Cells
were incubated for 5 h; this was followed by addition of 2 ml of
DMEM containing 20% fetal bovine serum. Cells were then incubated for
15 h, and then the transfection mixture was removed and replaced
with DMEM. Virus was harvested at 24, 48, and 72 h
posttransfection. JSRVJS7 virus was concentrated ~20-fold
using the Minitan tangential-flow ultrafiltration system (Millipore) with a 300-kDa molecular size exclusion filter as described by the manufacturer.
RT assay.
RT activity was quantitated by measuring the
amount of bromodeoxyuridine (BrdU) incorporation into an immobilized
RNA template as described by the manufacturer (Lenti-RT; Cavidi Tech
AB). BrdU incorporation was quantified by the binding of a
BrdU-specific antibody conjugated to alkaline phosphatase (AP) followed
by colorimetric measurement of AP activity. In this assay, AP activity
is proportional to the RT activity in the sample.
In vivo infections.
Four specific-pathogen-free newborn
lambs, as described previously (25), were each inoculated
intratracheally with 5 ml of concentrated supernatant collected from
293T cells transiently transfected with pCMV-JSRVJS7. Two
lambs were inoculated with phosphate-buffered saline alone and were
used as negative controls, whereas two lambs inoculated with
concentrated lung fluid from an OPC case were used as positive
controls. The lambs were killed between 18 and 20 weeks after
inoculation, depending on development of clinical evidence of disease,
and the lungs were examined at necropsy.
Histological examination and immunohistochemistry.
Four
sections (4 to 6 µm thick) of each lung were stained with hematoxylin
and eosin and examined by light microscopy. Sections were also examined
for the presence of JSRV CA protein by immunohistochemistry as
described previously (22), except that an antigen
retrieval step (microwave treatment at 800 W twice for 7 min) was
included. OPC tumor tissue was used as a positive control.
Nucleotide sequence accession numbers.
The nucleotide
sequence of JSRVJS7 and the proviral integration site
flanking sequences containing the SP-A gene has been deposited in
GenBank under accession number AF357971.
 |
RESULTS |
Derivation of the JS7 cell line.
As described in Materials and
Methods, the JS7 cell line was derived by culture of tumor cells from a
naturally occurring case of OPC in Scotland. JS7 cells had epithelial
morphology (Fig. 1A) and features of ATII
cells, including surface microvilli, tonofilaments, desmosomes,
intracytoplasmic glycogen, and lamellar body-like structures (Fig. 1B);
with maintenance in culture, some features of ATII differentiation were
lost. JSRV CA was detected by immunoblotting in culture supernatants of
JS7 cells during early passages (Fig. 1C) but could not be demonstrated
after passage 11 (data not shown). Replication of JSRV could not be
induced in high-passage JS7 cells, but intratracheal inoculation of the cells at passage 137 into lambs induced JSRV-associated OPC of recipient karyotype (15).

View larger version (92K):
[in this window]
[in a new window]
|
FIG. 1.
Features of the JS7 cell line. (A) Confluent monolayer
showing the polygonal, epithelial appearance of JS7 cells and presence
of perinuclear granules (arrows) (bar = 20 µm). (B) Transmission
electron micrograph showing ultrastructural features of JS7 cells
including surface microvilli (mv), desmosomes (arrows), and
intracytoplasmic lamellar body-like structures (arrowheads) (bar = 10 µm). (C) Protein immunoblot analysis using goat antiserum to
Mason-Pfizer monkey virus p27 and iodinated rabbit anti-sheep
F(ab)2 to detect the 26-kDa JSRV CA (arrowhead) in lung
fluid from a natural case of OPC (lane a) and in supernatants from a
JS7 cell culture, passage 8 (lane b). Immunoglobulin light chain (faint
fuzzy band above the JSRV CA band in lung fluid [lane a]) is absent
in preparations from the JS7 culture supernatant.
|
|
Cloning of the JSRVJS7 provirus.
Since the JS7
cell line had a single integration site, it was used as source material
for cloning the JSRV provirus (1). A genomic library was
constructed from JS7 cell DNA in a bacteriophage lambda vector. This
library was screened by plaque hybridization with JSRV-specific U3 and
TM probes (2). Two lambda clones that hybridized to the
probes were identified and purified. One of these, clone 2-1 (Fig.
2B), contained a complete JSRV provirus, and the other, clone 5-1 (Fig. 2C), contained only the 3' half of the
provirus. Southern blot analysis demonstrated that they are independent
clones of the same JSRV provirus locus (see Fig. 2A). The provirus is
referred to as JSRVJS7.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of JSRVJS7 provirus restriction
maps. (A) Results of Southern blot analysis of JS7 genomic DNA digested
with restriction endonucleases EcoRI (E),
HindIII (H), and SacI (S). The membrane was
hybridized with probes specific to the U3 and TM regions of JSRV
(1). (B) Full-length proviral lambda clone 2-1. (C)
Partial-length proviral lambda clone 5-1.
|
|
The nucleotide sequence of the cloned DNA insert of the lambda phage
clone 2-1, containing the complete JSRVJS7 provirus, was
determined. The insert contained 3,549 bp of sheep genomic DNA
downstream from the proviral long terminal repeat (LTR) and 399 bp
upstream to the other proviral LTR (Fig. 2B). (Upstream and downstream
refer to the orientation relative to the SP-A promoter. Thus, the
upstream LTR is the 3' LTR of the provirus and the downstream LTR is
the 5' LTR of the provirus.) The JSRVJS7 provirus is 7,841 bp in length, and the gag, pro, pol, orfX, and
env reading frames are all open. The JSRVJS7
isolate is 99.2% identical to another isolate of Scottish origin,
JSRV21 (25), but is only 93% identical to the
South African isolate of JSRV (39). Amino acid sequence identity among the JSRV isolates in the gag, pro, and
pol regions ranges between 95 and 99%. These regions are
generally the most conserved in retroviruses. The predicted amino acid
sequences of orfX in the two Scottish JSRV isolates are 98%
identical but are only 90 to 91% identical to the African JSRV
isolates (1). JSRV21 has a 5-bp deletion in U3 of the LTR
relative to JSRVJS7, but no known retroviral transcription
factor binding site is lost or gained due to this deletion.
Pathogenicity studies of JSRVJS7.
The
determination of whether JSRVJS7 is capable of inducing OPC
in lambs was crucial to our future studies using this clone. To
investigate the pathogenicity of the JSRVJS7 proviral
clone, it was necessary to produce infectious virus. Cotransfection of pCMV-JSRVJS7, pCMV-J:gag-pol, and
pCMV-J:env (Fig. 3) into 293T cells resulted in transient production of JSRVJS7 virus as
demonstrated by RT activity in tissue culture supernatants 24 h after
transfection (data not shown). The production of viral particles was
confirmed in cell culture supernatants concentrated by using a 300-kDa
membrane filter. As seen in Fig. 4A, RT
activity was found only in the concentrated supernatant; the filtrate
contained no detectable RT, demonstrating that RT activity was
associated with a particle size larger than the molecular mass of RT.
Additional evidence for packaged virus included ultracentrifugation
concentration of viral particles (data not shown) and Western
immunoblotting analysis of concentrated JSRVJS7 showing a
band of approximately 27 kDa when blots were probed with a rabbit
anti-capsid polyclonal antibody (Fig. 4B).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
CMV-based JSRVJS7 plasmid constructs.
Schematic representation of the full-length JSRVJS7
provirus clone in which the 5' U3 region was replaced by the CMV
promoter inserted 5' to the JSRVJS7 RNA start site. The
insert shows the context of the region joining the CMV promoter with
the 5' R region of JSRVJS7. Also shown are
pCMV-J:gag-pol and pCMV-J:env. Both of these
constructs were designed to overexpress viral proteins by using the CMV
promoter to drive transcription. Standard retrovirus notation is used.
These constructs were transfected into 293T cells for production of
JSRV virions.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Production of JSRV in 293T cells. (A) RT activity in
supernatants of 293T cells or in lung fluid of an OPC-affected lamb
detected by measuring the amount of BrdU incorporation into an
immobilized RNA template (Lenti-RT; Cavidi Tech AB). Colorimetric
quantitation of BrdU incorporation was achieved by the binding of a
BrdU-specific antibody conjugated with alkaline phosphatase.
Supernatant was prepared from 293T cells transiently transfected with
the JSRV plasmids described in Fig. 3 and pooled. Combined supernatant
was then concentrated ~20-fold by ultrafiltration; the ultrafiltrate
was also examined for RT activity. RT activity in lung fluid from an
experimental case of OPC (85/13) was used as an indicator for
acceptable levels of JSRVJS7 concentrated virus for lamb
inoculations. (B) Western immunoblot analysis of concentrated
JSRVJS7 virus from transfected 293T cells using rabbit
antiserum to JSRV CA. Lane a represents 30 µl of the lung fluid
(85/13) described above. Lane b represents 30 µl of concentrated
supernatant from 293T cells. OD, optical density.
|
|
Four lambs were inoculated with concentrated stocks of
JSRVJS7 produced after transfection of 293T cells. When
lambs were killed at 18 to 20 weeks postinoculation and examined
histologically, the lungs of one lamb had several papillary foci within
alveoli and bronchioles accompanied by increased numbers of vacuolated cells resembling alveolar macrophages within adjacent alveoli, hallmark
features of OPC (Fig. 5A). As a positive
control, two lambs were inoculated with lung fluid from a field case of
OPC, and both developed gross and histological lesions diagnostic for OPC (data not shown). Neither of the two medium-inoculated lambs developed OPC lesions. To confirm the presence of JSRV in the lesions
found in the lamb inoculated with JSRVJS7,
immunohistochemistry was performed using an antibody against the capsid
protein of JSRV. Positive staining indicated that not only was the
virus present, but transcription and translation of the viral genome were taking place at the site of the lesion (Fig. 5B).

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 5.
Experimental induction of OPC by JSRVJS7.
Lung tissue from a JSRVJS7-inoculated lamb was fixed in
neutral formalin, sectioned at 4 to 6 µm, and stained. (A)
Microscopic tumor nodule detected in lamb number 1615 (hematoxylin and
eosin stain; bar = 40 µm). Note the increased numbers of
alveolar macrophages in alveoli surrounding the tumor nodule (arrows).
(B) JSRV antigen presence in the same tumor nodule detected by
immunohistochemistry using rabbit antiserum to JSRV capsid developed
using Vector Red and using Carazzi's hematoxylin as a counterstain
(bar = 40 µm).
|
|
The JSRVJS7 integration site.
As part of an
investigation of insertional mutagenesis by JSRV provirus, the JSRV
integration site in the JS7 cell line was studied. A comparison of the
sequences flanking the provirus with the GenBank database indicated
that the virus had inserted into the sheep gene that encodes
SP-A. The JSRVJS7 provirus was inserted into the
promoter proximal region of the SP-A gene in reverse orientation
with respect to the SP-A gene (Fig. 6).
The insertion had all of the hallmarks of a typical retrovirus
insertion, including a TG at the downstream end and a CA at the
upstream end of the provirus, and a duplication of 6 bp of host DNA at
the site of insertion (5). The 399 bp of sheep genomic
sequence just upstream of the LTR showed similarity to the promoter
regions of the human (17) and baboon (19)
SP-A genes. There was a 26-bp region, centered about 170 bp upstream of
the TATA box of the sheep SP-A promoter, which was 96% (25 of 26)
identical to a 26-bp sequence in human and baboon promoters, centered
about 180 bp upstream of their TATA boxes. The significance of this
sequence is unknown, but its location suggests that it may be a
transcription factor-binding site. The upstream LTR of the provirus was
about 50 bp downstream of the putative SP-A TATA box, and transcription
from the 5' LTR of the provirus was predicted to be in the opposite
direction of the transcription of the SP-A gene. Consistent with this
interpretation, there were regions of significant similarity to the
SP-A genes of several mammalian species within the 3,549 bases of
genomic sequence just upstream of the 5' LTR of the provirus in clone 2-1 (Fig. 2B). The SP-A genes of human, baboon, rabbit, rat, and mouse
have five exons. The regions of high sequence similarity corresponded
to the exons of the mammalian genes, and the regions of little or no
similarity corresponded to the introns of the mammalian genes. This
suggests that the exon-intron organization of the sheep SP-A gene
conforms to that of other mammals.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
SP-A is the site of JSRVJS7 proviral
integration. (A) JSRVJS7-provirus is integrated in a
reverse orientation to the 5' untranslated region of SP-A exon 1. Both
JSRVJS7 and SP-A sequence fragments are shown to scale.
Ovine SP-A exons are shaded and introns are white. US is a
25-nucleotide upstream "enhancer" region which shares high homology
to sequences in human and baboon. (B) The boundaries of the integration
site are shown in detail. Exon 1 is predicted to begin approximately 25 nucleotides downstream of the TATA box. Integration of
JSRVJS7 interrupts the proposed six-amino-acid exon 1 SP-A
translation product. The dotted line represents the JSRVJS7
provirus. GGCTGT is the retroviral target sequence
duplicated by the host upon integration. Amino acids are indicated
above some of the codons in the nucleotide sequences as follows: M,
Met; G, Gly; C, Cys; V, Val; R, Arg; A, Ala. us, upstream; ds,
downstream.
|
|
The amino acid sequence of the sheep SP-A was predicted by using the
sequences of cDNAs from other species (dog, GenBank accesssion no.
M11769; guinea pig, U40869; human, M68519; rat, X13176; rabbit, L19387;
pig, L41350; and mouse, S48768) to guide the prediction of splice
sites. If translation of the sheep SP-A message begins at the first AUG
codon in the second exon, a protein showing high sequence similarity to
the proteins predicted from the cDNAs of other mammals would result,
and it would be identical to an SP-A cDNA sequence recently reported
for the sheep (28; GenBank accession No. AF076633).
Although the 5' end of the sheep SP-A gene transcript has not been
definitively determined, we assume that it is approximately 25 bases
downstream of the TATA box as indicated in Fig. 6B. The first AUG codon
is about 23 bases downstream of the predicted 5' end of the message and is part of the sequence AGCAUGG, which is in good agreement
with the optimal consensus translation initiation sequence
PuCCAUGG (29). The 6-amino-acid peptide encoded
by the first exon could be joined to the rest of the SP-A to form a
different N terminus if the AGGT indicated in Fig. 6B is used as the
splice donor during removal of the first intron. The rat SP-A gene also
has an ATG in the first exon, resulting in two translation initiation
sites for SP-A. Furthermore, two isoforms of the rat SP-A arise as a consequence of differential use of alternative signal peptidase cleavage sites, which is in turn influenced by which ATG is used for
translation initiation (7).
The 6-bp host sequence that was duplicated in the JSRV integration
reaction begins 21 bases downstream of the predicted 5' end of the SP-A
transcript and 3 bases downstream from the first AUG in the putative
mRNA. Thus, the insertion interrupts the exon 1 open reading frame of
SP-A. This finding raises the question of what effect the
JSRVJS7 provirus may have on the expression of the SP-A
gene, and conversely what effect insertion in an antisense orientation
with respect to the SP-A promoter may have on the production of viral
transcripts. To address this question, total RNA was isolated from JS7
cells at passage 171 and analyzed for the presence of transcripts from
the SP-A promoter and from the JSRV 5' LTR promoter by Northern blot
hybridization. JSRV DNA was used as a probe, since it should detect
proviral transcripts from both viral and SP-A gene promoters. No bands
were seen with the JSRV probe, although an actin mRNA band was detected
when an actin probe was used (data not shown). When the SP-A gene was used as a probe, no bands were detected on the Northern blot (data not
shown). More sensitive RT-PCR assays were used in an attempt to detect
low levels of transcription in both the sense and antisense directions
through the JSRV provirus. Weak signals were detected for both sense
and antisense JSRV RNAs (data not shown). JS7 cells also were analyzed
for the presence of SP-A protein by Western blotting using
cross-reactive antibodies against rat SP-A (18). Although
the antibodies against rat SP-A recognize the sheep antigen, sheep SP-A
was not found in JS7 cells (data not shown). These results suggest that
neither the SP-A promoter nor the JSRV LTR promoter is active in
JS7 cells at the present passage level.
 |
DISCUSSION |
In this work, a full-length provirus, JSRVJS7, was
isolated from JS7 cells, an OPC tumor cell line that had been
maintained in culture for over 170 passages. Derived from a naturally
occurring OPC tumor in Scotland, JSRVJS7 is an example of a
type 2 JSRV geographic variant found in Europe and North America,
distinguished from the type 1 JSRV genotype found in Africa (1,
2). The nucleotide sequence of JSRVJS7 is more than
99% identical to JSRV21, another Scottish isolate of
recent origin (25), but is only 93% identical to the more
distantly related type 1 prototype JSRV from South Africa
(39). The virus has all of the expected open reading
frames and replicated in JS7 cells through passage 8 but, interestingly, not after passage 11. The presence of open reading frames in the JSRVJS7 sequence, therefore, indicates that
the lack of virus production at higher passages of the JS7 cell line is
not due to nonsense mutations in the provirus. This finding is also
consistent with the recovery of virus from tumors induced in lambs
inoculated with high-passage JS7 cells (15).
Upon intratracheal inoculation of newborn lambs, the
JSRVJS7 provirus clone was shown to be infectious and
capable of inducing pulmonary papillary nodules, characteristic of OPC.
JSRV presence in the tumor cells was confirmed by demonstrating
intracellular JSRV capsid protein. The lesions were similar to those
induced by clone JSRV21, a provirus which had been isolated
directly from tumor DNA rather than from a cell line (25).
Because both of these pathogenicity studies were performed only with
animals that are known to contain at least 15 copies of endogenous
sheep retroviruses closely related to JSRV (13) and
because lesions were detected after a 4- to 5-month incubation period,
the possibility that endogenous sheep retroviruses may contribute to
JSRV pathogenicity through recombination cannot be excluded. Thorough
sequence analysis of JSRV isolates recovered from animals inoculated
with JSRV molecular clones will be required to investigate this possibility.
The relatively rapid onset of disease induced by JSRVJS7 is
similar to the incubation period after intratracheal inoculation of
newborn lambs with extracts from OPC-affected lungs (8, 31) and contrasts with naturally occurring OPC, which occurs most frequently in adult sheep (8, 32). This may reflect different oncogenic mechanisms in early and late stages of disease or
the effect of different ATII cell replication rates in young lambs and
adults, with consequent effects on viral replication, integration, and
mutagenesis. The experimentally induced disease in young lambs occurs
within weeks of exposure to JSRV, and the lesions usually consist of
small adenomatous foci disseminated thoughout the pulmonary parenchyma,
suggesting possible polyclonal origin and an epigenetic basis of
proliferation. On the other hand, the lesions of naturally occurring
OPC in adult sheep most often consist of large, occasionally fibrotic,
tumor masses involving one or more lung lobes and a 10% rate of
metastasis to regional lymph nodes, features more consistent with
oligoclonal or monoclonal origin and more likely to be related to an
insertional mutagenesis origin. We believe that different stages of OPC
are related to different pathogenetic mechanisms and that OPC is a
model of multistep carcinogenesis, as has been suggested for the
murine leukemia system (10).
JSRV causes a pulmonary tumor consisting of ATII cells or Clara cells
or their precursors. ATII cells produce pulmonary surfactant, a complex
of lipids and proteins that form a film at the air-liquid interface of
alveoli (11). The chief components of pulmonary surfactant
are the lipids dipalmitoylphosphatidylcholine and phosphatidylglycerol and the surfactant proteins SP-A, SP-B, SP-C, and SP-D
(36). A morphological hallmark of ATII cells is the
lamellar body, an intracellular storage form of surfactant; lamellar
bodies are frequently found in OPC tumor cells and were present in JS7
cells, particularly at low passage levels. Although leukocytes, and
perhaps other cell types, are infected by JSRV (14), the
virus is apparently only oncogenic in these pulmonary epithelial cell
types. This may reflect the observation that JSRV gene expression,
under the control of LTR promoters or enhancers, is upregulated in
pulmonary epithelial cells (21). Receptor-ligand
interactions, perhaps involving a recently described JSRV receptor (30;
A. D. Miller, University of Washington, personal communication),
or genetic events associated with JSRV integration also may be related
to ATII proliferation.
The finding of JSRV integration in a gene that is highly expressed in
the OPC target cell, the ATII cell, is of potential interest, but its
relevance to the pathogenesis of the disease is unclear. In a Southern
blot study of tumor DNA of eight sheep naturally affected by OPC using
clone 2-1 (Fig. 2B) as a probe, no rearrangements were detected in the
SP-A gene (data not shown); however, dilution of tumor cell DNA in the
sample by leukocyte and stromal cell DNA may have reduced sensitivity
of detection. Unfortunately, DNA from the original tumor source of the
JS7 cell line was unavailable to determine whether the tumor was clonal with respect to the SP-A integration site. JSRV insertion into the SP-A
gene also could be a fortuitous retroviral insertion into the
relatively open chromatin structure of an actively expressed gene in
ATII cells.
The mechanisms by which JSRV induces neoplasia of the secretory
epithelium of the lower respiratory tract may involve viral protein
expression or genetic changes in the principal target cells for
transformation, the ATII cells. The availability of pathogenic
molecular clones of JSRV will be crucial in studies to determine
whether viral proteins are capable of directly transforming cells. In
addition, further studies to determine whether the SP-A gene is
frequently rearranged in natural tumors will be necessary to evaluate
the overall significance of the SP-A integration site. Aside from the
potential significance of the SP-A integration site in oncogenesis,
JSRV-induced changes in the ATII cell cycle, differentiation state, or
alterations of SP-A production may lead to new information about the
biology of this important pneumocyte.
 |
ACKNOWLEDGMENTS |
This work was supported by grant CA 59116 from the National
Cancer Institute, National Institutes of Health. Some of the work in
Scotland was supported by the Scottish Executive, Rural Affairs Department. J. C. DeMartini is a member of the University of
Colorado Cancer Center.
We thank Lorenzo Gonzalez for performing necropsy examinations and
histopathology and Patricia Dewar for technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, Colorado State University, Fort Collins, CO 80524. Phone: (970) 491-5410. Fax: (970) 491-0603. E-mail:
jcdemar{at}cvmbs.colostate.edu.
 |
REFERENCES |
| 1.
|
Bai, J.,
J. V. Bishop,
J. O. Carlson, and J. C. DeMartini.
1999.
Sequence comparison of JSRV with endogenous proviruses: envelope genotypes and a novel ORF with similarity to a G-protein coupled receptor.
Virology
258:333-343[CrossRef][Medline].
|
| 2.
|
Bai, J.,
R.-Y. Zhu,
K. Stedman,
C. Cousens,
J. Carlson,
J. M. Sharp, and J. C. DeMartini.
1996.
Unique long terminal repeat U3 sequences distinguish exogenous jaagsiekte sheep retroviruses associated with ovine pulmonary carcinoma from endogenous loci in the sheep genome.
J. Virol.
70:3159-3168[Abstract].
|
| 3.
|
Barsky, S. H.,
R. Cameron,
K. E. Osann,
D. Tomita, and E. C. Holmes.
1994.
Rising incidence of bronchioloalveolar lung carcinoma and its unique clinicopathologic features.
Cancer
73:1163-1170[CrossRef][Medline].
|
| 4.
|
Bonne, C.
1939.
Morphological resemblance of pulmonary adenomatosis (Jaagsiekte) in sheep and certain cases of cancer of the lung in man.
Am. J. Cancer
35:491.
|
| 5.
|
Coffin, J. M.
1990.
Retroviridae and their replication, p. 1437-1499.
In
B. N. Fields (ed.), Virology. Raven Press, Ltd., New York, N.Y.
|
| 6.
|
Cousens, C.,
E. Minguijon,
R. G. Dalziel,
A. Ortin,
M. Garcia,
J. Park,
L. Gonzalez,
J. M. Sharp, and M. de las Heras.
1999.
Complete sequence of enzootic nasal tumor virus, a retrovirus associated with transmissible intranasal tumors of sheep.
J. Virol.
73:3986-3993[Abstract/Free Full Text].
|
| 7.
|
Damodarasamy, M.,
M. Zhang,
K. Dienger, and F. X. McCormack.
2000.
Two rat surfactant protein A isoforms arise by a novel mechanism that includes alternative translation initiation.
Biochemistry
39:10189-10195[CrossRef][Medline].
|
| 8.
|
DeMartini, J. C.,
R. H. Rosadio,
J. M. Sharp,
H. I. Russell, and M. D. Lairmore.
1987.
Experimental coinduction of type D retrovirus-associated pulmonary carcinoma and lentivirus-associated lymphoid interstitial pneumonia in lambs.
JNCI
79:167-177.
|
| 9.
|
DeMartini, J. C., and D. F. York.
1997.
Retrovirus-associated neoplasms of the respiratory system of sheep and goats. Ovine pulmonary carcinoma and enzootic nasal tumor.
Vet. Clin. N. Am. Food Anim. Pract.
13:55-70[Medline].
|
| 10.
|
Fan, H.
1997.
Leukemogenesis by Moloney murine leukemia virus: a multistep process.
Trends Microbiol.
5:74-82[CrossRef][Medline].
|
| 11.
|
Goerke, J.
1998.
Pulmonary surfactant: functions and molecular composition.
Biochim. Biophys. Acta
1408:79-89[Medline].
|
| 12.
|
Hecht, S. J.,
J. O. Carlson, and J. C. DeMartini.
1994.
Analysis of a type D retroviral capsid gene expressed in ovine pulmonary carcinoma and present in both affected and unaffected sheep genomes.
Virology
202:480-484[CrossRef][Medline].
|
| 13.
|
Hecht, S. J.,
K. Stedman,
J. O. Carlson, and J. C. DeMartini.
1996.
Distribution of endogenous type B and D retroviral sequences in ungulates and other mammals.
Proc. Natl. Acad. Sci. USA
93:3297-3302[Abstract/Free Full Text].
|
| 14.
|
Holland, M. J.,
M. Palmarini,
M. Garcia-Goti,
L. Gonzalez,
I. McKendrick,
M. de las Heras, and J. M. Sharp.
1999.
Jaagsiekte retrovirus is widely distributed both in T and B lymphocytes and in mononuclear phagocytes of sheep with naturally and experimentally acquired pulmonary adenomatosis.
J. Virol.
73:4004-4008[Abstract/Free Full Text].
|
| 15.
|
Jassim, F. A.
1988.
Identification and characterization of transformed cells in jaagsiekte, a contagious lung tumor of sheep. Ph.D. dissertation.
University of Edinburgh, Edinburgh, Scotland.
|
| 16.
|
Jassim, F. A.,
J. M. Sharp, and P. D. Marinello.
1987.
Three-step procedure for isolation of epithelial cells from the lungs of sheep with jaagsiekte.
Res. Vet. Sci.
43:407-409[Medline].
|
| 17.
|
Kouretas, D.,
A. M. Karinch,
A. Rishi,
K. Melchers, and J. Floros.
1993.
Conservation analysis of rat and human SP-A gene identifies 5' flanking sequences of rat SP-A that bind rat lung nuclear proteins.
Exp. Lung Res.
19:485-503[Medline].
|
| 18.
|
Kuroki, Y.,
R. J. Mason, and D. R. Voelker.
1988.
Pulmonary surfactant apoprotein A structure and modulation of surfactant secretion by rat alveolar type II cells.
J. Biol. Chem.
263:3388-3394[Abstract/Free Full Text].
|
| 19.
|
Li, J.,
E. Gao,
S. R. Seidner, and C. R. Mendelson.
1998.
Differential regulation of baboon SP-A1 and SP-A2 genes: structural and functional analysis of 5'-flanking DNA.
Am. J. Physiol.
275:L1078-L1088[Abstract/Free Full Text].
|
| 20.
|
Liebow, A. A.
1960.
Bronchiolo-alveolar carcinoma.
Adv. Intern. Med.
10:329-358[Medline].
|
| 21.
|
Palmarini, M.,
S. Datta,
R. Omid,
C. Murgia, and H. Fan.
2000.
The long terminal repeat of jaagsiekte sheep retrovirus is preferentially active in differentiated epithelial cells of the lungs.
J. Virol.
74:5776-5787[Abstract/Free Full Text].
|
| 22.
|
Palmarini, M.,
P. Dewar,
M. de las Heras,
N. F. Inglis,
R. G. Dalziel, and J. M. Sharp.
1995.
Epithelial tumour cells in the lungs of sheep with pulmonary adenomatosis are major sites of replication for jaagsiekte retrovirus.
J. Gen. Virol.
76:2731-2737[Abstract/Free Full Text].
|
| 23.
|
Palmarini, M.,
H. Fan, and J. M. Sharp.
1997.
Sheep pulmonary adenomatosis: a unique model of retrovirus-associated lung cancer.
Trends Microbiol.
5:478-483[CrossRef][Medline].
|
| 24.
|
Palmarini, M.,
C. Hallwirth,
D. York,
C. Murgia,
T. de Oliveira,
T. Spencer, and H. Fan.
2000.
Molecular cloning and functional analysis of three type D endogenous retroviruses of sheep reveal a different cell tropism from that of the highly related exogenous jaagsiekte sheep retrovirus.
J. Virol.
74:8065-8076[Abstract/Free Full Text].
|
| 25.
|
Palmarini, M.,
J. M. Sharp,
M. de las Heras, and H. Fan.
1999.
Jaagsiekte sheep retrovirus is necessary and sufficient to induce a contagious lung cancer in sheep.
J. Virol.
73:6964-6972[Abstract/Free Full Text].
|
| 26.
|
Palmarini, M.,
J. M. Sharp,
C. Lee, and H. Fan.
1999.
In vitro infection of ovine cell lines by Jaagsiekte sheep retrovirus.
J. Virol.
73:10070-10078[Abstract/Free Full Text].
|
| 27.
|
Perk, K, and I. Hod.
1982.
Sheep lung carcinoma: an epidemic analogue of a human neoplasm.
JNCI
69:747-750.
|
| 28.
|
Pietschmann, S. M., and U. Pison.
2000.
cDNA cloning of ovine pulmonary SP-A, SP-B, and SP-C: isolation of two different sequences for SP-B.
Am. J. Physiol.
278:L765-L778[Abstract/Free Full Text].
|
| 29.
|
Poirier, Y.,
C. Kozak, and P. Jolicoeur.
1988.
Identification of a common helper provirus integration site in Abelson murine leukemia virus-induced lymphoma DNA.
J. Virol.
62:3985-3992[Abstract/Free Full Text].
|
| 30.
|
Rai, S. K.,
J. C. DeMartini, and A. D. Miller.
2000.
Retrovirus vectors bearing jaagsiekte sheep retrovirus Env transduce human cells by using a new receptor localized to chromosome 3p21.3.
J. Virol.
74:4698-4704[Abstract/Free Full Text].
|
| 31.
|
Rosadio, R. H.,
M. D. Lairmore,
H. I. Russell, and J. C. DeMartini.
1988.
Retrovirus-associated ovine pulmonary carcinoma (sheep pulmonary adenomatosis) and lymphoid interstitial pneumonia. I. Lesion development and age susceptibility.
Vet. Pathol.
25:475-483[Abstract].
|
| 32.
|
Rosadio, R. H.,
J. M. Sharp,
M. D. Lairmore,
J. E. Dahlberg, and J. C. DeMartini.
1987.
Lesions and retroviruses associated with naturally occurring ovine pulmonary carcinoma (sheep pulmonary adenomatosis).
Vet. Pathol.
25:58-66.
|
| 33.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 34.
|
Sharp, J. M.,
K. Angus,
E. Gray, and F. Scott.
1983.
Rapid transmission of sheep pulmonary adenomatosis (jaagsiekte) in young lambs.
Arch. Virol.
78:89-95[CrossRef][Medline].
|
| 35.
|
Sharp, J. M., and A. J. Herring.
1983.
Sheep pulmonary adenomatosis: demonstration of a protein which cross reacts with the major core proteins of Mason-Pfizer monkey virus and mouse mammary tumor virus.
J. Gen. Virol.
64:2223-2227.
|
| 36.
|
Veldhuizen, R.,
K. Nag,
S. Orgeig, and F. Possmayer.
1998.
The role of lipids in pulmonary surfactant.
Biochim. Biophys. Acta
1408:90-108[Medline].
|
| 37.
|
Verwoerd, D. W.,
R. C. Tustin, and A. L. Payne.
1985.
Jaagsiekte: an infectious pulmonary adenomatosis of sheep, p. 53-76.
In
R. G. Olsen, S. Krakowka, and J. R. Blackslee (ed.), Comparative pathobiology of viral diseases. CRC Press, Inc., Boca Raton, Fla.
|
| 38.
|
Wu, A. H.,
M. C. Yu,
D. C. Thomas,
M. C. Pike, and B. E. Henderson.
1988.
Personal and family history of lung disease as risk factors for adenocarcinoma of the lung.
Cancer Res.
48:7279-7284[Medline].
|
| 39.
|
York, D. F.,
R. Vigne,
D. W. Verwoerd, and G. Querat.
1992.
Nucleotide sequence of the Jaagsiekte retrovirus, an exogenous and endogenous type D and B retrovirus of sheep and goats.
J. Virol.
66:4930-4939[Abstract/Free Full Text].
|
Journal of Virology, May 2001, p. 4239-4246, Vol. 75, No. 9
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.9.4239-4246.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cote, M., Kucharski, T. J., Liu, S.-L.
(2008). Enzootic Nasal Tumor Virus Envelope Requires a Very Acidic pH for Fusion Activation and Infection. J. Virol.
82: 9023-9034
[Abstract]
[Full Text]
-
Cote, M., Zheng, Y.-M., Albritton, L. M., Liu, S.-L.
(2008). Fusogenicity of Jaagsiekte Sheep Retrovirus Envelope Protein Is Dependent on Low pH and Is Enhanced by Cytoplasmic Tail Truncations. J. Virol.
82: 2543-2554
[Abstract]
[Full Text]
-
Wootton, S. K., Halbert, C. L., Miller, A. D.
(2006). Envelope proteins of jaagsiekte sheep retrovirus and enzootic nasal tumor virus induce similar bronchioalveolar tumors in lungs of mice.. J. Virol.
80: 9322-9325
[Abstract]
[Full Text]
-
Caporale, M., Cousens, C., Centorame, P., Pinoni, C., De las Heras, M., Palmarini, M.
(2006). Expression of the jaagsiekte sheep retrovirus envelope glycoprotein is sufficient to induce lung tumors in sheep.. J. Virol.
80: 8030-8037
[Abstract]
[Full Text]
-
Maeda, N., Fu, W., Ortin, A., de las Heras, M., Fan, H.
(2005). Roles of the Ras-MEK-Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase-Akt-mTOR Pathways in Jaagsiekte Sheep Retrovirus-Induced Transformation of Rodent Fibroblast and Epithelial Cell Lines. J. Virol.
79: 4440-4450
[Abstract]
[Full Text]
-
Salvatori, D., Gonzalez, L., Dewar, P., Cousens, C., Heras, M. d. l., Dalziel, R. G., Sharp, J. M.
(2004). Successful induction of ovine pulmonary adenocarcinoma in lambs of different ages and detection of viraemia during the preclinical period. J. Gen. Virol.
85: 3319-3324
[Abstract]
[Full Text]
-
Hofacre, A., Fan, H.
(2004). Multiple Domains of the Jaagsiekte Sheep Retrovirus Envelope Protein Are Required for Transformation of Rodent Fibroblasts. J. Virol.
78: 10479-10489
[Abstract]
[Full Text]
-
Cousens, C., Bishop, J. V., Philbey, A. W., Gill, C. A., Palmarini, M., Carlson, J. O., DeMartini, J. C., Sharp, J. M.
(2004). Analysis of Integration Sites of Jaagsiekte Sheep Retrovirus in Ovine Pulmonary Adenocarcinoma. J. Virol.
78: 8506-8512
[Abstract]
[Full Text]
-
Liu, S.-L., Halbert, C. L., Miller, A. D.
(2004). Jaagsiekte Sheep Retrovirus Envelope Efficiently Pseudotypes Human Immunodeficiency Virus Type 1-Based Lentiviral Vectors. J. Virol.
78: 2642-2647
[Abstract]
[Full Text]
-
Liu, S.-L., Lerman, M. I., Miller, A. D.
(2003). Putative Phosphatidylinositol 3-Kinase (PI3K) Binding Motifs in Ovine Betaretrovirus Env Proteins Are Not Essential for Rodent Fibroblast Transformation and PI3K/Akt Activation. J. Virol.
77: 7924-7935
[Abstract]
[Full Text]
-
Allen, T. E., Sherrill, K. J., Crispell, S. M., Perrott, M. R., Carlson, J. O., DeMartini, J. C.
(2002). The jaagsiekte sheep retrovirus envelope gene induces transformation of the avian fibroblast cell line DF-1 but does not require a conserved SH2 binding domain. J. Gen. Virol.
83: 2733-2742
[Abstract]
[Full Text]
-
Grossman, D. A., Hiti, A. L., McNiel, E. A., Ye, Y., Alpaugh, M. L., Barsky, S. H.
(2002). Comparative Oncological Studies of Feline Bronchioloalveolar Lung Carcinoma, Its Derived Cell Line and Xenograft. Cancer Res.
62: 3826-3833
[Abstract]
[Full Text]
-
Summers, C., Neill, W., Dewar, P., Gonzalez, L., van der Molen, R., Norval, M., Sharp, J. M.
(2002). Systemic immune responses following infection with Jaagsiekte sheep retrovirus and in the terminal stages of ovine pulmonary adenocarcinoma. J. Gen. Virol.
83: 1753-1757
[Abstract]
[Full Text]
-
Platt, J. A., Kraipowich, N., Villafane A., F., DeMartini, J. C.
(2002). Alveolar Type II Cells Expressing Jaagsiekte Sheep Retrovirus Capsid Protein and Surfactant Proteins Are the Predominant Neoplastic Cell Type in Ovine Pulmonary Adenocarcinoma. Vet Pathol
39: 341-352
[Abstract]
[Full Text]
-
Palmarini, M., Maeda, N., Murgia, C., De-Fraja, C., Hofacre, A., Fan, H.
(2001). A Phosphatidylinositol 3-Kinase Docking Site in the Cytoplasmic Tail of the Jaagsiekte Sheep Retrovirus Transmembrane Protein Is Essential for Envelope-Induced Transformation of NIH 3T3 Cells. J. Virol.
75: 11002-11009
[Abstract]
[Full Text]
-
Palmarini, M., Fan, H.
(2001). Retrovirus-Induced Ovine Pulmonary Adenocarcinoma, an Animal Model for Lung Cancer. JNCI J Natl Cancer Inst
93: 1603-1614
[Abstract]
[Full Text]