INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Human herpesvirus 7 (HHV-7) is a widely prevalent betaherpesvirus with an in vitro tropism for CD4⁺ T lymphocytes (reviewed in reference 5). HHV-7 is usually acquired during early childhood after HHV-6 infection and is likely transmitted via saliva (29). HHV-7 has been associated with febrile illnesses in children, neurological manifestations during primary infection, and clinical complications in organ transplant patients.

The betaherpesvirus subfamily consists of the cytomegaloviruses and the roseoloviruses (HHV-7 and HHV-6 variants A and B [HHV-6A and HHV-6B]). Their genomes are genetically colinear, with origins of lytic replication (oriLyts) in analogous positions upstream from U41, the gene encoding the major DNA binding protein (1, 7, 11, 23, 27). However, sequence features of their oriLyt regions indicate substantial differences between cytomegaloviruses and roseoloviruses in their mechanisms for initiating viral replication. The minimal oriLyt regions of the cytomegaloviruses are long (>1.3-kb) complex structures consisting of multiple inverted and direct repeats, in addition to numerous transcription factor recognition sites that are believed to mediate activation of the replication origin (2, 20, 21, 28). Unlike the cytomegaloviruses, oriLyts of HHV-6A and HHV-6B have features in common with the replication origins of alphaherpesviruses; these origins are less complex and are centered around binding sites for a virus-encoded replication initiator protein, the OBP.

Roseoloviruses each encode a homolog of the alphaherpesvirus OBP (14, 16, 23), which has no homolog in the cytomegaloviruses. The most extensively characterized alphaherpesvirus OBP, herpes simplex virus type 1 (HSV-1) OBP (OBP_H1), binds as a dimer at each of two sites in its origins of replication (Box sites I and II in each ori_S and two Box I sites in ori_L) (17). Homodimer interactions at each box site are believed to lead to local DNA bending of the intervening AT-rich element, unwinding of the region in association with the single-stranded DNA binding protein, and recruitment of the viral replication machinery (6).

Like OBP_H1, the OBP of HHV-6B (OBP_H6B) binds two sites (OBP-1 and OBP-2) that flank an AT-rich spacer element in the minimal core of the oriLyt region (14). The consensus recognition sequence differs between OBP_H6B and OBP_H1, and they are unable to bind each other's OBP site (15). OBP_H7 and OBP_H6B, encoded by the U73 gene in each virus, share 58% amino acid identity, in contrast to their respective 32 and 31% identities with the more distantly related OBP_H1 (23). Although the HHV-7 genome is generally well conserved with respect to HHV-6A and HHV-6B, there is little sequence similarity in the origin regions (reference 27 and data not shown). Nonetheless, van Loon et al. demonstrated that an HHV-6 oriLyt-containing plasmid could replicate in HHV-7-infected cells (27). In addition, they found that mutation of the only site in the HHV-7 oriLyt region that matches the OBP_H6B consensus recognition sequence resulted in the loss of transient plasmid replication in HHV-7-infected cells. Although these results indicate that OBP_H7 may recognize sequences similar to those in the HHV-6 oriLyt, they suggest that there are OBP sites in the HHV-7 oriLyt that do not conform to the OBP_H6B consensus. Recognizing the limits of relying on the consensus sequence of a distinct, albeit closely related, herpesvirus to predict OBP_H7-binding sites, we have used a direct biochemical approach for their identification.

In this study, we characterized the interaction of OBP_H7 with its cognate oriLyt to better understand the initiation mechanism of HHV-7 DNA replication. We found that in the HHV-7 oriLyt, OBP_H7 binds to two sites that flank an AT-rich spacer, and we studied its sequence and spatial binding requirements.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

RNA preparation and RT-PCR analysis. For mRNA studies, HHV-7(SB) was propagated in SupT1 cells as previously described (4). Total RNA was prepared from 10⁶ SupT1 cells 7 days postinfection with HHV-7(SB) with a High Pure RNA isolation kit (Roche, Indianapolis, Ind.) according to the manufacturer's protocol. One microgram of RNA (extracted from approximately 1.5 × 10⁵ cells) was treated with DNase (Roche) at 37°C for 30 min according to the manufacturer's recommendations. Twenty nanograms of DNase-treated RNA was reverse transcribed from oligo(dT) primers in a 40-µl reaction mixture by using a GeneAmp RNA PCR kit (PE Biosystems, Foster City, Calif.) according to the manufacturer's protocol. Ten microliters of the reverse transcriptase (RT) reaction mixture was then used for PCR analysis using primers specific for HHV-7 U73 (CCGAATCAAAACATTTACTCTA and AATCCGCTCTAATAGATTCTGCTA) and for the cellular gene glyceraldehyde-3'-phosphate dehydrogenase (GAPDH) (Stratagene, La Jolla, Calif.). Thermal cycling conditions were as follows: 35 cycles of 96°C for 15 s, 60°C for 30 s, and 68°C for 30 s with an increased extension of 5 s per cycle.

Plasmid construction. U73 fragments encoding the carboxyl-terminal portions of OBP_H7 were amplified from HHV-7(SB) nucleocapsid DNA using a proofreading DNA polymerase (Pfx; GIBCO BRL, Rockville, Md.). Primers used were as follows: for the construct without a Kozak sequence, CGCGGATCCATGAACGGAGAATTCTA and CCGGATATCCGTTATGAACGCAATA; and for constructs containing a Kozak consensus sequence surrounding the ATG, CGCATCACGGGATCCGCCACCATGGACGGAGAATTCTA and CCGGATATCCGTTATGAACGCAATA (restriction endonuclease sites used for cloning are italicized, residues in boldface indicate U73-derived nucleotides, and underlined ATG sequences were inserted for translation initiation). Using standard cloning techniques, these amplimers were digested, purified, and then ligated into the EcoRV site of pcDNA3 (Invitrogen, Carlsbad, Calif.) for the non-Kozak primer set or the BamHI and EcoRV sites of pcDNA3 and pCMV-Tag 2B (Stratagene) for the Kozak-containing primer set. pCMV-Tag 2B provides a FLAG epitope tag at the amino terminus of the protein. A negative control pcDNA3-derived construct was also generated that contained U73 in the reverse orientation.

OBP_H7 in vitro expression. OBP was expressed in coupled in vitro transcription-translation (IVTT) reactions (Promega, Madison, Wis.) as previously described with 2 µg of input DNA and 55% reticulocyte lysate (14). Negative control lysate was generated by programming the reactions with a plasmid containing U73 in the reverse orientation. ³⁵S-labeled in vitro-translated products were mixed with loading buffer and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis as previously described (14).

Electrophoretic mobility shift analysis (EMSA). Oligonucleotides were annealed, labeled, and purified as described previously (14). DNA was incubated at room temperature for 20 min in 10 µl of either reaction buffer A or B with 2 µl of programmed IVTT lysate. Reaction buffer A consisted of 12 mM HEPES-NaOH (pH 7.6), 4 mM Tris-HCl (pH 7.6), 125 mM NaCl, 1 mM EDTA, 5 mM MgCl₂, 1 mM dithiothreitol, 120 µg of bovine serum albumin per ml, 12% glycerol, 5 µg of salmon testes DNA per ml, and a cocktail of protease inhibitors (Complete Mini EDTA-free; Roche). Buffer B (14) was similar to buffer A except that it contained 50 mM NaCl and no MgCl₂. DNA-protein complexes were separated in 5% polyacrylamide gels (60:1 acrylamide:bis-acrylamide) by using a low-ionic-strength electrophoresis buffer (14) at 4°C.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

The HHV-7 oriLyt region. As for the whole genome, the HHV-7 U41-U42 intergenic region is more compact than those of HHV-6A and HHV-6B (Fig. 1). The approximately 600-bp HHV-7 oriLyt region mapped in transient replication assays is composed of nearly all of the U41-U42 intergenic region and extends 300 bases into U42 (27). HHV-7 amplicons constructed by Romi et al. (24) utilized an approximately 1-kb oriLyt region that extended only 200 bases into U42; this suggests that the minimal oriLyt may be as short as 500 bp.

View larger version (13K): [in this window] [in a new window]   FIG. 1.   The oriLyt regions of HHV-7 and HHV-6B. The HHV-7 minimal origin as defined from plasmid (27) and amplicon (24) constructs includes two OBP sites flanking an AT-rich spacer element (described in this report). The HHV-6B minimal efficient origin determined by transient replication analysis (7) and a region found amplified in some cell culture passages of HHV-6B(Z29) (26) contains a G+C-rich region and IDRs to the right of the OBP sites. Coordinates are derived from HHV-7(RK) and HHV-6B(Z29).

U73 expression in HHV-7(SB)-infected cells. RT-PCR was done to confirm that the gene encoding OBP_H7 (U73) is expressed during lytic replication. A 133-bp amplimer was generated from RNA extracted from HHV-7(SB)-infected SupT1 cells (Fig. 2, lane 7) but not uninfected cells (lane 5). A 550-bp GAPDH product was amplified in reactions containing both uninfected and infected SupT1 RNA only upon the addition of RT (lanes 5 and 7), demonstrating the absence of DNA contamination and the presence of amplifiable RNA. The U73 primers were specific for HHV-7, since they did not produce a product with HHV-6B(Z29) DNA (lane 2).

View larger version (55K): [in this window] [in a new window]   FIG. 2.   RT-PCR detection of HHV-7(SB) U73 (OBPH7) transcripts. Lanes 1 and 10 contain a 100-bp DNA ladder (New England Biolabs, Inc., Beverly, Mass.). Lanes 2 and 3 contain HHV-6B(Z29) and HHV-7(SB) viral nucleocapsid DNA, respectively. Lanes 4 and 5 and lanes 6 and 7 contain the PCR products of reactions with uninfected SupT1 RNA and HHV-7(SB)-infected SupT1 RNA, respectively. Lanes 8 and 9 are no-template negative controls. RT was added to lanes 5, 7, and 9. The upper and lower panels contain PCR products obtained using U73 and GAPDH primers, respectively.

In vitro expression of truncated OBP_H7. Unlike OBP_H1, baculovirus and bacterial expression of full-length OBP_H6B has yielded insoluble protein (15). As for OBP_H6B (14), full-length OBP_H7 protein expressed in IVTT formed high-molecular-weight aggregates that had little binding activity by EMSA (data not shown). The carboxyl-terminal portion of OBP_H7 (amino acids [aa] 484 to 787) closely corresponds to the smallest region of OBP_H6B (aa 482 to 770) required for DNA binding activity as measured by EMSA (15). The carboxyl-terminal portion of OBP_H7 was expressed by IVTT from three plasmid constructs. From an OBP expression construct lacking a Kozak translation initiation sequence surrounding the initiating methionine, 33- and 29-kDa products were detected (Fig. 3, lane 3). The presence of a Kozak sequence resulted in higher levels of the 33-kDa protein that closely approximated the expected molecular mass of 35.4 kDa (Fig. 3, lane 4). This suggests that the smaller products initiated from internal AUG sequences. An amino-terminal FLAG-tagged OBP_H7 fusion protein of 37 kDa was also generated that was consistent with the predicted size of 36.9 kDa (Fig. 4, lane 5). Truncated OBP_H7 and FLAG-tagged OBP_H7 generated from constructs containing a Kozak sequence were used in the remainder of the experiments described in this report.

View larger version (56K): [in this window] [in a new window]   FIG. 3.   In vitro expression of truncated OBPH7. IVTT mixtures programmed with pCMV-Tag 2B vector DNA (lane 1), pcDNA3 with truncated U73 in the reverse orientation (lane 2), or plasmids containing the carboxyl-terminal region (aa 484 to 787) of HHV-7 U73 (lanes 3 to 5) were incubated in the presence of [35S]methionine and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis as described previously (14). OBPH7 was expressed from pcDNA3 constructs either lacking (lane 3) or containing (lane 4) a Kozak translation initiation sequence. Lane 5 contains N-terminally FLAG-tagged OBPH7 expressed from pCMV-Tag 2B. The circle indicates the 37-kDa FLAG-tagged OBPH7 fusion protein. The solid and open triangles indicate the 33- and 29-kDA products generated from constructs containing the carboxyl-terminal portion of HHV-7 U73.

View larger version (72K): [in this window] [in a new window]   FIG. 4.   Identification of an OBPH7-binding site in the HHV-7 oriLyt. (A) Schematic diagram of the genomic location of the 600-bp HHV-7 minimal oriLyt region (27). The triangles indicate the putative HHV-7 OBP-2 and OBP-1 sites. (B) The 18 double-stranded 55-bp oligonucleotides (1 to 18) shown in panel A were used for EMSA. 32P-labeled oligonucleotides were reacted with IVTT lysate programmed with truncated U73 in the reverse orientation (negative control, left lane for each oligonucleotide) or with truncated U73 in the correct forward orientation (right lane for each oligonucleotide). Asterisks indicate oligonucleotides with the putative OBP-2 and OBP-1 sites. Oligonucleotide 13 labeled inefficiently to lower specific activity; no specific binding was detected upon long exposure or by PhosphorImager analysis (data not shown). The arrowhead indicates the complex generated in the presence of oligonucleotide 4 and OBPH7-containing IVTT.

The high-affinity OBP_H7 site in the HHV-7 oriLyt is identical to the HHV-6 OBP-2 site. In preliminary EMSA experiments, we found that OBP_H7 recognized an oligonucleotide containing the putative HHV-7 OBP-2 site (data not shown). The reaction buffer used in the initial experiments (buffer B) was previously identified as optimal for OBP_H6B (14). Subsequent titrations indicated that higher NaCl and MgCl₂ concentrations (125 mM NaCl and 5 mM MgCl₂) were required for optimal OBP_H7 binding (buffer A); these binding conditions were used in the following series of experiments.

View larger version (52K): [in this window] [in a new window]   FIG. 5.   Specificity of the OBPH7 protein-OBP-2 DNA interaction by competitive EMSA. OBPH7 binding to oligonucleotides 4, 6, and 8 (Fig. 4) was analyzed in competition analysis. Sixteen- and 80-fold molar excesses of the oligonucleotides were added as competitors for binding to labeled oligonucleotide 4. Oligonucleotide 8 and TAR are double-stranded oligonucleotides with no sequence similarity to an OBP site. NP, no protein added to the binding reaction; R, binding reaction contained protein from an IVTT reaction mixture programmed with a plasmid containing HHV-7 U73 in the reverse orientation; , no competitor present; arrow, the specific shift with OBPH7.

OBP_H7 is present in the specific shifted complex. To verify that the specific shifted complex contained OBP_H7, we did an antibody supershift experiment. A truncated OBP_H7 protein with an amino-terminal FLAG epitope was reacted with oligonucleotide 7-2 (see Fig. 7C) in the presence of specific and nonspecific antibodies. The 50-bp 7-2 is similar to the 55-bp oligonucleotide 4 except the OBP-2 site is in a slightly different location in relation to the flanking sequence. As shown in Fig. 6, in the absence of added antibodies, both FLAG-OBP_H7 and OBP_H7 generated protein-DNA complexes with similar mobilities. DNA-protein complexes containing FLAG-OBP_H7 were recognized by the antibody against the FLAG epitope to generate tertiary supershifted complexes. This antibody did not affect the mobility of DNA complexes containing OBP_H7 protein that lacked the FLAG epitope. The specificity of this interaction was further demonstrated by the absence of a higher-mobility product upon addition of antibody of the same immunoglobulin G (IgG) subclass (IgG1) against an epitope (Xpress) not present in the OBP proteins. This experiment also demonstrates that the other shifts seen are due to interactions with other proteins of the reticulocyte lysate and are not the specific shifts of interest involving OBP_H7.

View larger version (88K): [in this window] [in a new window]   FIG. 6.   Specificity of the OBPH7 protein-OBP-2 DNA interaction by supershift. OBPH7 was incubated with increasing amounts of MAbs against the Xpress (Invitrogen) or FLAG (Stratagene) epitope before the addition of the labeled 7-2 oligonucleotide (see Fig. 7C) containing the HHV-7 OBP-2 site. The triangles below -Xpress indicate 97.6 pg and 6.25 ng of input IgG MAb. The triangles below -FLAG indicate the addition of 97.6 pg, 0.391 ng, 1.58 ng, and 6.25 ng of IgG MAb. , no antibody added; R, negative control lysate; arrow, the specific shift with OBPH7 protein; vertical bars, the supershifted complexes.

The OBP_H7 minimal recognition element. The following series of experiments was intended to define the boundaries of the minimal OBP_H7 recognition element. Three sets of shorter oligonucleotides derived from the 50-bp 7-2 oligonucleotide were generated and examined for their ability to bind OBP_H7. The first set of overlapping 34-bp oligonucleotides (7-2A, -B, and -C) (Fig. 7C) collectively spans the 50-bp region. In both direct binding and competition experiments, 7-2B and 7-2C were strongly bound by OBP_H7 while 7-2A reacted only weakly (Fig. 7A and B). These results indicate that the 8-bp sequence to the right of the 7-2A boundary is not essential for recognition but does influence binding efficiency. A second set of overlapping 20-bp DNA duplexes that span 7-2B was then tested for competition against labeled 7-2 (Fig. 7B); as summarized in Fig. 7C, only 7-2E competed.

View larger version (91K): [in this window] [in a new window]   FIG. 7.   Mapping the OBP-2-binding site. (A) Oligonucleotides that span the 50-bp 7-2 oligonucleotide that contains the OBP-2 site were tested for their ability to be directly bound by OBPH7. For each oligonucleotide target, lane 1 contains a binding reaction mixture without any reticulocyte lysate, lane 2 contains reverse negative control lysate, and lane 3 contains lysate with truncated OBPH7 protein. (B) Competition EMSA with unlabeled oligonucleotides at 16- and 80-fold molar excess. , no competitor was added. NP and R are negative controls as described in the Fig. 5 legend. In panels A and B, arrows point to the specific shifts. (C) Schematic diagram of oligonucleotides used and summary of binding and competition assay results shown in panels A and B. NT, not tested. ++ indicates a stronger degree of interaction of an oligonucleotide with OBPH7 than +; , no competition observed.

The OBP_H7 and the OBP_H6B consensus recognition sequences are closely related. The consensus recognition sequence for a DNA binding protein is a powerful tool for understanding the basis of sequence specificity for a protein-DNA interaction. In addition, comparison of the consensus sequences among OBPs enables an evaluation of their evolutionary divergence. To determine the OBP_H7 consensus recognition sequence, we used the saturation mutagenesis technique described previously for OBP_H6B (15) and OBP_H1 (13). We designed a panel of double-stranded oligonucleotides that contained all possible single base pair substitutions at each position of the 14-bp minimal recognition element; 60-fold molar excesses of these oligonucleotides were then tested for their ability to compete with 7-2B for binding to OBP_H7. The effect of each substitution was determined by quantifying the radioactivity of the shifted band and expressing this value as the percentage of binding inhibition relative to that of the wild-type 7-2E or 7-2Eext oligonucleotide.

View larger version (70K): [in this window] [in a new window]   FIG. 8.   Effect of substitutions in the 14-bp core OBP-2 sequence and the resulting OBPH7 consensus recognition sequence. (A) Saturation mutagenesis of the minimal OBPH7 recognition sequence (Table 1, oligonucleotide L0R5). At each position of the 14-bp minimal recognition sequence, oligonucleotides were generated that contained changes to the other three possible base pairs. The label beneath each lane of the gel indicates the position and change made in the competitor used. Sixty-fold molar excesses of unlabeled mutated oligonucleotides were used in competitive EMSA against 32P-labeled 7-2B. The amount of residual shifted radioactivity after competition was quantified by PhosphorImager analysis (Molecular Dynamics). The inhibition of binding of 32P-labeled 7-2B DNA to truncated OBPH7 by each competitor DNA duplex is shown beneath the gel as the percent inhibition relative to the wild-type DNA duplex (WT). The other competitor DNA duplexes shown in panel B were analyzed similarly (data not shown). Positions 10 to 14 were analyzed in the context of the sequence of the longer 7-2Eext oligonucleotide, AATTAGCGTCCACCTCACTCGTAATAGT (WT'), to avoid effects that might be more dependent on proximity to the end of the oligonucleotide than sequence alone. , no competitor was added. (B) Summary of saturation mutagenesis and the resulting consensus recognition sequence. Open blocks indicate that the given alteration at that position did not result in loss of recognition (competition was at least 70% of WT) and is therefore a permissive change. Hatched and solid blocks indicate that the alteration reduced the binding ability partially or severely, respectively. These designations were based on quantitative trends observed in at least three independent experiments. The asterisk on the N at position 11 indicates that although two of the changes were slightly below the cutoff for recognition, the slight gradient in recognition of all alterations at this position did not enable identification of a clearly preferred sequence. In the consensus sequence, B is a T, G, or C; R is a G or A; Y is a T or C; W is a T or A; and N is any nucleotide.

Identification of OBP-1 as a low-affinity binding site. As described above, the only sites in the HHV-7 oriLyt that exactly match the OBP_H7 consensus sequence are the OBP-2 site we identified in the previous mapping experiments and the putative OBP-1 site, which is in a position and context that suggest its possible function as an OBP-binding site. Because oligonucleotides containing the putative OBP-1 site were not recognized in any of the preceding experiments, we examined the effect of different buffer conditions on DNA binding activity. As measured by signal intensity in the absence of competitor, the ability of OBP_H7 to bind an oligonucleotide that contains the OBP-2 site, 7-2B, was reduced 10-fold in buffer B (the buffer optimized for OBP_H6B) (14) compared to buffer A (the buffer optimized for OBP_H7), but the protein-DNA interactions were concomitantly altered to allow binding to the 34-bp 7-1B oligonucleotide that contained the OBP-1 sequence (Fig. 9). As shown in Fig. 9B, a second oligonucleotide that contained the OBP-1 sequence, the 55-bp oligonucleotide 6 (Fig. 4A), was also bound by OBP_H7 in buffer B. This reactivity was not due to a loss of specificity in buffer B conditions, since the nonspecific TAR oligonucleotide does not compete for binding to OBP_H7 (Fig. 9B) and the oligonucleotide M3A, which contains a single nonpermissive mutation, was not recognized (data not shown). OBP_H7 had a higher affinity for oligonucleotides containing the OBP-2 site than for those containing the OBP-1 site in both binding conditions.

View larger version (63K): [in this window] [in a new window]   FIG. 9.   Identification of a second, lower-affinity OBP site (OBP-1) by competitive EMSA. (A) Competition with 16- and 80-fold molar excesses of unlabeled DNA duplexes containing HHV-7 OBP-2 (7-2B) and OBP-1 (7-1B, GGAGGGTTCATTGATCCTCCTTGCCTGCAATTCT) with 32P-labeled 7-2 for binding to OBPH7 in buffers A and B (see Materials and Methods). The amount of residual shifted target was quantitated by PhosphorImager analysis. The percentage of inhibition of binding to 32P-labeled 7-2 DNA relative to 7-2B at 80-fold molar excesses by each competitor DNA duplex is shown beneath the gel. , no competitor present; R, negative control lysate. (B) Conditions are the same as described for panel A, except that binding buffer B was used. Oligonucleotide 6 contains the OBP-1 site and is described in the legend to Fig. 4. TAR is described in the legend for Fig. 5.

Heteroduplex analysis suggests that OBP_H7 interacts with one face of the DNA helix. To identify the strand-specific base interactions required for OBP_H7 recognition of the high-affinity OBP-2 site, we generated heteroduplex oligonucleotides derived from the 7-2E sequence (Fig. 7C) that contain single mismatched base pairs at positions 2 through 9. The heteroduplex oligonucleotides and corresponding oligonucleotides with complementary substitutions on both strands (nonheteroduplex) were compared for their ability to compete for binding against the wild-type sequence in oligonucleotide 7-2E. Sense strand alterations at positions 2, 3, 4, and 9 as well as complementary strand alterations at positions 5 through 8 resulted in loss of recognition by OBP_H7 at levels similar to or greater than alterations on both strands at these positions (Fig. 10A). Changes on the opposite strand at these positions resulted in at least a threefold-greater inhibition of binding than the alteration on both strands, indicating that the principal interaction is not on this strand at this position. For example, when both strands (Fig. 10A, lane b) at position 2 were changed from a GC to a TA base pair, the resulting oligonucleotide did not compete for binding. A sense strand changed to a T at position 2 (lane sT) was also unable to compete; this is in contrast to the effect of a complementary strand change to an A (lane cA), which competes as well as the wild-type sequence. This indicates that the base on the sense strand of the oligonucleotide at position 2 is a possible contact point for OBP_H7.

View larger version (87K): [in this window] [in a new window]   FIG. 10.   EMSA to measure recognition of heteroduplexes. (A) Heteroduplex oligonucleotides containing single mismatched base pairs at positions 2 through 9 were created by annealing a wild-type 7-2Eext oligonucleotide to complementary oligonucleotides containing single nucleotide substitutions. For positions 2 through 9, 60-fold molar excesses of heteroduplex oligonucleotides with a mutation on the 5'-to-3' sense strand (s) or a mutation of the 3'-to-5' complementary strand (c) were compared for their ability to compete for binding with truncated OBPH7 against oligonucleotides containing the mutation on both strands (b). , no competitor; WT, wild-type 7-2E is the competitor; R, negative control protein lysate. (B) Helical wheel representation of heteroduplex analysis. The 9-bp OBP-2 core sequence is arranged on a helical wheel to approximate the 10.4 base residues per turn of a B-form DNA helix. For each position, two heteroduplex oligonucleotides were synthesized with changes on the sense strand (first set of parentheses) and two were made with changes on the complementary strand (second set of parentheses). Purine-to-purine and pyrimidine-to-pyrimidine changes are indicated by triangles. Purine-to-pyrimidine and pyrimidine-to-purine changes are indicated as circles. Solid symbols indicate that strand-specific alteration is responsible for loss of recognition at that position in the core sequence. Asterisks indicate the side of the DNA helix that is critical for recognition; thus, a change on the complementary strand that affects recognition is indicated by an asterisk on the opposite side of the helix (e.g., the T at position 6). (C) A B-form DNA model of the OBP-2 site, CGTCCACCTCA, was produced using Insight II, Release 2000 (Molecular Simulations, Incorporated, San Diego, Calif.). Labeled positions indicate strand mismatches that resulted in the loss of recognition by OBPH7.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

We have characterized the interaction of OBP_H7 with the HHV-7 oriLyt. As with alphaherpesviruses, this is likely the first step in a cascade of events required for initiation of viral replication. Specifically, we determined that (i) the carboxyl-terminal 304 aa are sufficient for DNA binding activity, (ii) there are two binding sites with markedly different affinities for OBP_H7 in the HHV-7 oriLyt, (iii) BRTYCWCCT is the OBP_H7 consensus recognition sequence, and (iv) strand-specific interactions in the 9-bp OBP core occur along one face of the DNA helix.

OBP_H7 sequence recognition. The minimal OBP_H7 recognition element is 14 bp in length, similar to the 13-bp minimal element of OBP_H6B (15) and the 15-bp element of OBP_H1 (13). For both OBP_H6B and OBP_H7, additional sequence was required on the right flank of the 9-bp core recognition sequence, suggesting that the flanking sequence is required to stabilize the protein-DNA interaction. The roseolovirus OBPs have identical sequence specificity in the central 5-bp region of the 9-bp recognition core (YCWCC); outside the 5-bp region, their specificity diverges. This difference in specificity does not appear to have been substantially influenced by differences in the buffers used during determination of the consensus sequences (data not shown). For both viruses, the consensus sequences are consistent with the authentic OBP-1 sites. Ultimate proof would require evaluation of these sequences under physiologic conditions such as transient replication assays.

Comparison of the OBP-binding regions of roseoloviruses and alphaherpesviruses. The HHV-7 oriLyt has features conserved in the lytic origin regions of alphaherpesviruses and of HHV-6A and HHV-6B (Fig. 11). Like HHV-6A and HHV-6B, the HHV-7 AT-rich spacer region is longer than in alphaherpesvirus ori regions and has imperfect dyad symmetry. Unlike the other origin regions shown here, the AT-rich spacer element in HHV-7 contains few AT repeats.

View larger version (42K): [in this window] [in a new window]   FIG. 11.   Comparison of the OBP sites in the ori regions of alphaherpesviruses and roseoloviruses. OBP-binding regions of the oriLyts of alphaherpesviruses and roseoloviruses are shown. HSV1 L, HSV-1 oriL; HSV1 S, HSV-1 oriS; HSV2 L, HSV-2 oriL; HSV2 S, HSV-2 oriS; EHV1 S, equine herpesvirus 1 oriS; PRV, pseudorabies virus; VZV, varicella-zoster virus; MDV2, Marek's disease virus 2; I, II, and III, Box I, II, and III of HSV-1 oriS. Residues that match the HHV-7 consensus are shaded. Horizontal arrows indicate a structure with dyad symmetry in the HHV-7 sequence. The HHV-7 Box III-like sequence is underlined.

Differences in the interaction of roseolovirus OBPs with their oriLyts. OBP_H7 and OBP_H6B have similarities in their DNA binding properties, namely, that their consensus recognition sequences overlap and they recognize an identical 9-bp element in their oriLyt regions. However, in transient replication-infection assays, the HHV-7 replication machinery replicated an HHV-6 oriLyt-containing plasmid while an HHV-7 oriLyt-containing plasmid did not replicate in HHV-6B-infected cells (27). The basis for the lack of reciprocity may simply lie in differences in sequence recognition between OBP_H6B and OBP_H7: the 9-bp core of the HHV-6B OBP-1 site differs by a single base from the OBP_H7 consensus recognition sequence while the HHV-7 OBP-1 site and OBP_H6B consensus sequence differ at two positions. This interaction could be further affected by differences in proximal flanking sequences. In addition, as described above, the HHV-7 oriLyt lacks the long IDRs and putative DNA unwinding element of the HHV-6 oriLyts but contains a putative Box III-like element. The sum of these differences within and around the OBP sites is likely to affect OBP_H6B and OBP_H7 activities in the oriLyts.