Previous Article | Next Article 
Journal of Virology, April 2001, p. 3666-3674, Vol. 75, No. 8
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.8.3666-3674.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
AlaArg Motif in the Carboxyl Terminus of the
134.5 Protein of Herpes Simplex Virus Type 1 Is Required
for the Formation of a High-Molecular-Weight Complex That
Dephosphorylates eIF-2
Guofeng
Cheng,1
Martin
Gross,2
Marie-Elena
Brett,1 and
Bin
He1,*
Department of Microbiology and Immunology, College of
Medicine, The University of Illinois at Chicago, Chicago, Illinois
60612,1 and Department of Pathology, The
University of Chicago, Chicago, Illinois
606372
Received 1 December 2000/Accepted 25 January 2001
 |
ABSTRACT |
The
134.5 protein of herpes simplex virus (HSV) type
1 functions to prevent the shutoff of protein synthesis mediated by the
double-stranded-RNA-dependent protein kinase PKR. This is because
134.5 associates with protein phosphatase 1 (PP1)
through its carboxyl terminus, forming a high-molecular-weight complex that dephosphorylates the
subunit of translation initiation factor
eIF-2 (eIF-2
). Here we show that Val193Glu and
Phe195Leu substitutions in the PP1 signature motif of the
134.5 protein abolished its ability to redirect PP1 to
dephosphorylate eIF-2
and replication of mutant viruses was
severely impaired. The
134.5 protein, when expressed in
Sf9 cells using a recombinant baculovirus, was capable of directing
specific eIF-2
dephosphorylation. Deletions of amino acids 258 to
263 had no effect on activity of
134.5. However,
deletions of amino acids 238 to 258 abolished eIF-2
phosphatase
activity but not PP1 binding activity. Interestingly, deletions in the
AlaArg motif of the carboxyl terminus disrupted the
high-molecular-weight complex that is required for dephosphorylation of
eIF-2
. These results demonstrate that
134.5 is
functionally active in the absence of any other HSV proteins. In
addition to a PP1 binding domain, the carboxyl terminus of
134.5 contains an effector domain that is required to
form a functional complex.
 |
INTRODUCTION |
The cellular response to virus
infection is a complex process involving different components. The
double-stranded-RNA-dependent protein kinase (PKR) is one of the
components that play a critical role in antiviral defense
(16). In mammalian cells, PKR is induced by interferon,
and it is activated by double-stranded RNA. Upon viral infection, PKR
is activated to phosphorylate serine 51 on the
subunit of
translation initiation factor eIF-2 (eIF-2
). Phosphorylation of
eIF-2
increases its affinity for guanine nucleotide exchange factor
eIF-2B, thus sequestering eIF-2B complex in an inactive complex with
phosphorylated eIF-2 and GDP (12, 13). As a result, eIF-2B
is not available to catalyze nucleotide exchange on nonphosphorylated
eIF-2, which leads to inhibition of protein synthesis
(23). Because viruses synthesize double-stranded RNA during their replication, many of them have evolved mechanisms to
counteract PKR, such as blocking the activation of PKR, preventing the
phosphorylation of eIF-2
, or promoting the degradation of PKR
(16, 35). In addition to its role in antiviral defense, PKR has also been implicated in cellular functions such as growth regulation (4, 5, 33), differentiation (35),
and apoptosis in uninfected cells (27, 36).
Previous studies demonstrated that PKR is activated in cells infected
with wild-type or mutant herpes simplex virus type 1 (HSV-1). But only
in cells infected with
134.5 null mutants is eIF-2
phosphorylated (6, 18). Therefore, in cells
infected with
134.5 null mutants, initiation
of DNA replication triggers the shutoff of total protein synthesis
(6, 8, 9). Subsequent studies demonstrated that when human
cells are infected with wild-type virus, the
134.5 protein binds to protein phosphatase 1 (PP1), forming a high-molecular-weight complex that specifically
dephosphorylates eIF-2
and thereby prevents the shutoff of protein
synthesis (20, 21). Thus, unlike most viruses studied so
far, HSV uses a unique strategy to evade the antiviral action of PKR
(16).
The
134.5 protein of HSV-1 consists of 263 amino acids with a large amino-terminal domain, a linker (or
swivel) region containing repeats of three amino acids
(AlaThrPro), and a carboxyl-terminal domain (10, 11). The
triplet repeats are a constant feature of all strains, but the number
of repeats varies from strain to strain (10). The carboxyl
terminus of the
134.5 protein is required to
interact with PP1 and prevent translation shutoff during HSV-1
infection (9, 19, 21). A prominent feature of this domain
is a 64-amino-acid region containing a PP1-interacting signature motif
(Arg/Lys)(Val/Ile)XaaPhe (20), which is also present in a
number of proteins that complex with PP1 (3, 14, 24, 37, 38,
40). These complexes are involved in diverse functions such as
cell division, gene expression, glycogen metabolism, and neurotransmission.
The carboxyl terminus of the
134.5 protein is
homologous to a set of proteins known as GADD34 in human, hamster, and
mouse (25, 30, 31, 41) (Fig.
1). GADD34 belongs to a family of
proteins expressed under conditions of DNA damage, growth arrest, differentiation, and apoptosis (25, 41). Overexpression of GADD34 facilitates apoptosis induced by gamma radiation; however, its
physiological role remains unknown (2, 25). Interestingly, the carboxyl terminus of GADD34 functionally substitutes for the corresponding domain of the
134.5 protein
within the context of HSV-1 genome (19). A hypothesis
derived from these studies is that the conserved carboxyl-terminal
domain represents a functional module with a common role in virus
infection and cellular processes.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Amino acid sequence alignment of the carboxyl-terminal
domains of the 134.5 proteins of HSV-1 (10)
and HSV-2 (32) and of GADD34 proteins of human
(25), mouse (30), and hamster
(41).
|
|
In the present study, we further examined the role of the
carboxyl-terminal domain of the
134.5 protein.
We demonstrate that activation of eIF-2
phosphatase (PP1) by the
134.5 protein is essential for replication of
HSV-1 in infected cells. We also show that
134.5 protein functions independently of other
HSV proteins and provide evidence that the AlaArg motif in the carboxyl terminus of the
134.5 protein is required to
form a high-molecular-weight complex that dephosphorylates eIF-2
.
 |
MATERIALS AND METHODS |
Cells and viruses.
The Vero, HeLa, and SK-N-SH cell lines
were obtained from the American Type Culture Collection and propagated
in Dulbecco's modified Eagle's medium supplemented with 5% (HeLa and
Vero) or 10% (SK-N-SH) fetal bovine serum. Sf9 cells were purchased
from GIBCO and grown in serum-free, Sf-900 SFM medium supplied by the manufacturer.
HSV-1(F) is a prototype HSV-1 strain used in these studies
(
15). In recombinant virus R3616, a 1-kb fragment from the
coding
region of the
134.5 gene was deleted
(
7). In recombinant virus
R8321 (
20), codons
encoding Val
193 and Phe
195
of the
134.5 gene were replaced with those
encoding Glu and
Leu, respectively. In addition, this virus contained a
0.5-kb
deletion in the thymidine kinase gene. Recombinant virus H9813
was constructed by cotransfection of viral DNA of R8321
(
20)
with plasmid pRB4867 on rabbit skin cells to restore
the thymidine
kinase gene. The recombinant progeny was selected and
purified
in hypoxanthine-aminopterin-thymidine medium. The
construct was
verified by hybridization of electrophoretically
separated restriction
enzyme digests with a
32P-labeled
BamHI Q fragment as
described previously (
19). Preparation
of viral stock and
titration of infectivity were performed on
Vero
cells.
Recombinant baculoviruses were constructed as suggested by the
manufacturer (GIBCO). Briefly, to construct GF9909, the donor
plasmid
pGF9907 was transformed into
Escherichia coli DH10BAC
cells,
which contained the bacmid with a mini-attTn
7 target site
and the helper plasmid. White colonies containing recombinant
bacmids
were selected on Luria-Bertani plates containing kanamycin
(50 µg/ml), gentamicin (7 µg/ml), tetracycline (10 µg/ml), X-Gal
(5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside;100
µg/ml) and
isopropyl-

-
D-thiogalactopyranoside (40 µg/ml). Purified recombinant
bacmid DNA was then used to transfect
Sf9 cells using CellFectin
reagent (GIBCO). Virus was harvested 3 days
after transfection.
In a similar way, plasmids pBH0010, pBH0011,
pGF9908, pFastBacHT-gus,
pGF2002, pGF2007, pGF2009, and pGF2011 were
used to construct
recombinant baculoviruses BH0010, BH0011, GF9910,
GF9911, GF2003,
GF2022, GF2023, and GF2024. Virus constructs were
verified by
PCR with primers OGF0019
(ATGCAGGATCCGCTAACCCCTCCCACCCCCCCTCACGCCCC)
and OGF0013
(ATGCATCCGGATTACAGGGCCCGGGCACGGGCCTCGGGCCCC), which
are
specific to the
134.5 gene. Virus titers were
determined
by plaque assay on Sf9
cells.
Plasmids.
Plasmid pRB4867 contains a BamHI Q
fragment of HSV-1(F) in the BamHI site of pUC9
(19). pRB143 contains a BamHI S fragment of
HSV-1(F) in the BamHI site of pBR322 (34).
pRB4789 contains a BamHI S fragment from pRB143
(26). pGEX-PKR contains cDNA encoding full-length PKR
fused in frame to glutathione S-transferase (GST) (a gift
from William G. Bryan). pRB4897 contains a BamHI S fragment
in which the codons for V193 and
F195 in the
134.5 gene
were mutated to those for E and L, respectively (20).
pRB4892 contains the coding domain of GST fused to the entire coding
domain of PP1 except for the initiator methionine codon
(21). pFastBacHTa and pFastBacHTb are expression
vectors for making recombinant baculoviruses (GIBCO).
pFastBac-gus contains the DNA encoding
-glucuronidase
(GIBCO). pRB3027 contains approximately 100 bp of the 5' untranslated
region, the entire coding region of the
134.5 gene, and the 3' untranslated region
derived from the BamHI S fragment (19).
To construct pGF9908, an
EcoRI-
SalI fragment,
encoding PP1 from pRB4892, was cloned into the
EcoRI and
SalI sites of pFastBacHTb.
To construct pGF9907, a
BamHI-
StuI PCR fragment containing the
entire
coding region of the
134.5 gene was ligated
into the
BamHI
and
EcoRV sites of pBluescript II
SK(+), resulting in plasmid
pGF9901. An
NcoI-
HindIII fragment from pGF9901 was then
ligated
into the
NcoI and
HindIII sites of
pFastBacHTb, resulting in plasmid
pGF9907. To construct pGF2002, a
BstEII-
DraIII fragment from pRB4897
was ligated
into the
BstEII and
DraIII sites of pRB3027,
resulting
in plasmid pBH9902. A
BamHI-
StuI
fragment from pBH9902 was then
cloned into the
BamHI and
EcoRV sites of the pBluescript II SK(+),
producing pGF2001.
An
NcoI-
HindIII fragment from pGF2001 was
cloned
into the
NcoI and
HindIII sites of
pFastBacHTb, yielding pGF2002.
In this plasmid,
Val
193 and Phe
195 in the
134.5 gene were mutated to Glu and Leu,
respectively.
Cloning and deletions in the
134.5 gene were done with PCR using
pRB143 as
the template. To construct pGF2007, a
BstEII-
BspEI PCR
fragment was amplified with
oligoBH9716 (CATGGCCCGCCGCCGCCGCCATCGC)
and OGF0013 and
ligated into the
BstEII and
BspEI sites of
pGF9901,
resulting in plasmid pGF2006. An
NcoI-
BspEI-Klenow fragment was
then
ligated into the
NcoI and
StuI sites of
pFastBacHTb, yielding
pGF2007, which contains the region of the
134.5 gene encoding
amino acids 1 to 253. To
construct pGF2009, a
BstEII-
BspEI PCR
fragment
was amplified with oligoBH9716 and OGF0015
(ATGCATCCGGATTAGCCGGCTCCGCGGGCCAGGGCCCGGGCA)
and
ligated into the
BstEII and
BamHI sites of
pGF9901, resulting
in plasmid pGF2008. A
NcoI-
BspEI-Klenow fragment was then ligated
into
the
NcoI and
StuI sites of pFastBacHTb, yielding
pGF2009,
which contains the region of the
134.5 gene encoding amino acids
1 to 258. To
construct pGF2011, a
BstEII-
BspEI PCR fragment
was
amplified with oligoBH9716 and OGF0016
(ATGCATCCGGATTACGCCGGGCCGGCTCCGCGGGCCAGGGCC)
and ligated
into the
BstEII and
BspEI sites of pGF9901,
resulting
in plasmid pGF2010. A
NocI-
BspEI-Klenow
fragment was then ligated
into the
NcoI and
StuI
sites of pFastBacHTb, yielding pGF2011,
which contains the region of
the
134.5 gene encoding amino acids
1 to 260. To construct pBH0010, a
BstEII-
BspEI PCR fragment
encoding
amino acids 28 to 238 was amplified and ligated into the
BstEII
and
BspEI sites of pRB4789, yielding
plasmid pBH0002. The primers
used were oligoBH9716 and oligoBH0005
(AGTCATCCGGATTAGCGGCGCGCCAGGCGGGCGGCCGAGGC).
An
NcoI-
StuI fragment from pBH0002 was then ligated
into the
NcoI
and
StuI sites of pFastBacHTa,
resulting in pBH0010, which contains
the region of
134.5 encoding amino acids 1 to 238. To
construct
pBH0003, a
BstEII-
BspEI PCR fragment
encoding amino acids 28 to
248 was amplified with oligoBH9716 and
oligoBH0004 (AGTCATCCGGATTAGGCCTCCGCCACCCGGCGCCGGAACCG).
The
PCR fragment was ligated into the
BstEII and
BspEI sites of
pRB4789, yielding plasmid pBH0003. A
NcoI-
StuI fragment from pBH0003
was then ligated
into the
NcoI and
StuI sites of pFastBacHTa,
resulting in pBH0011, which contains the region encoding amino
acids 1 to 248. For plasmids pBH0010, pBH0011, pGF9907, pGF9908,
pGF2002,
pGF2007, pGF2009, and pGF2011, a His tag was fused in
frame to the
initiator methionine codon of the
134.5
gene.
GST pull-down assay.
GST protein and a GST-PP1 fusion
protein were induced by the addition of
isopropyl-
-D-thiogalactoside to the medium with E. coli BL21 cells transformed with plasmid pGEX4T-1 or pRB4892, followed by affinity purification of the fusion protein from bacterial lysates on agarose beads conjugated with glutathione. Infected Sf9
cells were harvested, washed with cold phosphate-buffered saline, and
lysed in buffer containing 50 mM HEPES (pH 7.6), 150 mM NaCl, 10 mM
MgCl2, 1% Triton X-100, 0.5 mM
phenylmethylsulfonyl fluoride, and 2 mM benzamidine. After 30 min on
ice and centrifugation to remove nuclei, the supernatant was precleared
with GST beads and then incubated with GST-PP1 fusion protein-bound
beads at 4°C overnight. After three washes, the proteins bound to
beads were resuspended in disruption buffer containing 50 mM Tris-HCl (pH 7.0), 5% 2-mercaptoethanol, 2% sodium dodecyl sulfate (SDS), and
2.75% sucrose. Samples were subjected to electrophoresis and processed
for immunoblot analysis with anti-His tag antibody (1, 8).
eIF-2
phosphatase assays.
Cells either mock infected or
infected with viruses were harvested 15 h (HeLa cells) or 48 h (Sf9 cells) postinfection, rinsed with phosphate-buffered saline,
resuspended in lysis buffer containing 10 mM HEPES (pH 7.6), 150 mM
NaCl, 10 mM MgCl2, 0.2% Triton X-100, 10%
glycerol, 0.5 mM phenylmethylsulfonyl fluoride, and 2 mM benzamidine, placed on ice for 30 min, and subjected to centrifugation to remove nuclei. The supernatant fluids were saved for analysis. eIF-2 was
purified from rabbit reticulocytes as previously described (17). GST-PKR fusion protein was expressed and purified
from E. coli BL21 cells as described above. To
prepare 32P-labeled eIF-2
, eIF-2 was incubated
with GST-PKR in buffer containing 20 mM Tris-HCl (pH 7.5), 40 mM KCl,
2.0 mM MgCl2, and 0.17 mM [
32P]ATP (10 Ci/mmol) for 30 min at 34°C.
Aliquots of cell lysates were then incubated with phosphorylated
eIF-2
in buffer containing 20 mM Tris-HCl (pH 7.5), 40 mM KCl, 2.0 mM MgCl2, and 0.1 mM EDTA at 34°C for 2 min.
The reaction was stopped by adding disruption buffer containing 50 mM
Tris-HCl (pH 7.0), 5% 2-mercaptoethanol, 2% SDS, and 2.75% sucrose,
followed by electrophoresis on a SDS-12% polyacrylamide gel,
transferred onto a nitrocellulose membrane, and subjected to
autoradiography (21). In addition, the nitrocellulose membrane was scanned by the PhosphorImage SI system, and the
radioactivity of eIF-2
was quantitated using ImageQuant NT software
(Molecular Dynamics Inc.).
Gel filtration chromatography.
A Superdex 200 HR 10/30
column (1.0 by 30 cm; Amersham Pharmacia Biotech) was equilibrated with
10 mM Tris-HCl (pH 7.5), 50 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, and 0.1 mM EDTA and pumped at 0.5 ml/min, using a
Amersham Pharmacia Biotech fast protein liquid chromatography system.
Samples were injected, 0.5-ml fractions were collected on ice, and the
absorbance at 280 nm was monitored (20).
Immunoblotting.
Samples were solubilized in the disruption
buffer described above, sonicated, boiled, subjected to electrophoresis
on SDS-polyacrylamide gels, transferred to nitrocellulose membranes,
blocked with 5% nonfat milk, and reacted with
anti-
134.5 antibody (a gift from Bernard
Roizman), anti-His tag antibody (Qiagen Inc.), or anti-eIF-2
antibody (a gift from Robert Schneider). The membranes were then rinsed
in phosphate-buffered saline and reacted with either goat anti-rabbit
or mouse immunoglobulin conjugated to alkaline phosphatase (Bio-Rad) or
donkey anti-rabbit or anti-mouse immunoglobulin conjugated to
horseradish peroxidase (Amersham Pharmacia Biotech. Inc.) (8, 19).
 |
RESULTS |
Activation of eIF-2
phosphatase by the
134.5
protein is crucial for replication of HSV-1 in infected cells.
The
134.5 protein of HSV-1 prevents the total
shutoff of protein synthesis in cells infected with HSV-1, which
requires an interaction of PP1 with the PP1-interacting motif within
the carboxyl terminus of the
134.5 protein. To
determine the contribution of this interaction to viral replication, we
constructed a recombinant HSV-1, H9813, by cotransfection of the DNA of
R8321 with plasmid pRB4867 to restore the thymidine kinase gene as
described in Materials and Methods. In this virus,
Val193 and Phe195 in the
PP1 signature motif were mutated to Glu and Leu, respectively. The
virus construct was verified by restriction digestion and Southern blot
analysis (data not shown). Expression of the
134.5 protein was detected by Western blot
analysis with anti-
134.5 antibody. Mutant
H9813 expressed the
134.5 protein to a level that is similar to that of wild-type HSV-1(F) (see Fig. 3A).
To examine the role of Val
193 and
Phe
195 of the
134.5
protein in viral replication, confluent human neuroblastoma cells
(SK-N-SH)
were infected with HSV-1(F), R3616, or H9813 at 0.01 PFU per
cell.
At different time points postinfection, the cells were harvested
and virus yields were determined by plaque assay on Vero cells.
As
indicated in Fig.
2, in cells infected
with HSV-1(F), there
was an approximately 3-log increase in viral yield
24 h after
infection, reaching a peak titer of
10
8 PFU/ml. The titer then dropped slightly
96 h postinfection. In
contrast, in cells infected with the
134.5 deletion mutant R3616,
the viral yields
did not increase after infection and the titer
remained approximately
10
5 PFU/ml. Interestingly, in cells infected with
H9813, viral replication
resembled that of R3616, in which the
134.5 gene has been deleted.
The results
suggest that Val
193 and
Phe
195 in the PP1 interacting motif of the
134.5 protein are crucial
for virus
replication.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 2.
Replication of wild-type HSV-1(F) and the
134.5 mutants R3616 and H9813 in SK-N-SH cells.
Confluent monolayers of cells were infected with viruses at 0.01 PFU
per cell and incubated at 37°C. At various times postinfection, the
cells were harvested, freeze-thawed three times, and titrated on Vero
cells. Duplicate samples were analyzed in parallel at each time point,
and the data represent assays from three experiments.
|
|
Next, we sought to delineate whether viral replication is linked to
eIF-2

phosphatase activity. In this experiment, cell
extracts were
prepared from HeLa cells either mock infected or
infected with
HSV-1(F), R3616, or H9813 and tested for their ability
to
dephosphorylate
32P-labeled eIF-2

. Purified
eIF-2 was phosphorylated with GST-PKR
and
[
32P]ATP in vitro and then incubated with cell
lysates. As shown
in Fig.
3B, the control
reaction mixture lacking cell lysate contained
two phosphorylated
bands, one representing phosphorylated eIF-2
and one
representing phosphorylated GST-PKR (lane 1). Incubation
of
HSV-1(F)-infected cell lysate with the eIF-2-GST-PKR reaction
mixture
resulted in dephosphorylation of
[
32P]eIF-2

but not
[
32P]GST-PKR (Fig.
3B, lane 3). In
contrast, cell lysates from cells
which were mock infected or
infected with R3616 exhibited little
or no eIF-2

-specific
phosphatase activity (Fig.
3B, lanes 2 and
4). Similarly,
H9813-infected cell lysate did not exhibit eIF-2
phosphatase
activity (Fig.
3B, lane 5). Western blot analysis
with anti-eIF-2

showed that eIF-2

was present in all reaction
mixtures (Fig.
3C),
confirming that the disappearance of radioactive
eIF-2

is due to
dephosphorylation. The larger amount of eIF-2
in reaction mixture
containing cell lysates is likely due to the
presence of endogenous
eIF-2

in the lysates (Fig.
3C, lanes 2
to 5). These results
demonstrate that Val
193 and
Phe
195 in the PP1 signature motif are critical
for the
134.5 protein
to enhance eIF-2

dephosphorylation and that activation of PP1
by the
134.5 protein is required for viral
replication in infected
cells.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Expression of the 134.5 protein. HeLa
cells were mock infected or infected with HSV-1(F), R3616 (in which the
coding region of the 134.5 gene was deleted), or H9813
(in which Vla193Glu and Phe195Leu substitutions
were made in the 134.5 gene) at 10 PFU per cell). At
15 h postinfection, cells were harvested, washed with
phosphate-buffered saline, and resuspended in disruption buffer
containing 50 mM Tris-HCl (pH 7.0), 5% 2-mercaptoethanol, 2% SDS, and
2.75% sucrose. Samples were then electrophoretically separated on
denaturing 12% polyacrylamide gels and transferred to a nitrocellulose
membrane. The blot was probed with anti- 134.5 antibody
(1). (B) eIF-2 phosphatase activity in HeLa cells which
were mock infected or infected with the indicated viruses.
32P-labeled eIF-2 , prepared as described in Materials
and Methods, was incubated with lysates of HeLa cells which were mock
infected or infected with indicated viruses at 34°C. After incubation
for 2 min, the reaction was stopped by the addition of disruption
buffer, and samples were separated electrophoretically on a denaturing
12% polyacrylamide gel, transferred to a nitrocellulose membrane, and
subjected to autoradiography (21). Lanes 1, 32P-labeled eIF-2 and GST-PKR not reacted with cell
lysates; lanes 2 to 5, 32P-labeled eIF-2 reacted with
lysates of cells which were mock infected or infected with the
indicated viruses. (C) Immunoblot of the autoradiogram in panel B.
|
|
The activity of the
134.5 protein is independent of
other HSV proteins.
We investigated whether the
134.5 protein was functionally active in the
absence of other HSV proteins. We constructed the following recombinant
baculoviruses: GF9909, expressing the wild-type
134.5 protein; GF2003, expressing the
134.5 protein with
Val193Glu and Phe195Leu
mutations in the PP1 binding motif; GF9911, expressing glucuronidase; and GF9910, expressing human PP1. Expression of the
134.5 protein and PP1 was verified by Western
blot with mouse monoclonal anti-His tag antibody, since these proteins
were His tagged at the amino terminus (see Fig. 5; also data not
shown). To assay for eIF-2
phosphatase activity, monolayers of Sf9
cells were mock infected or infected with GF9909, GF9910, GF9911, or
GF2003 at 5 PFU per cell. Forty-eight hours after infection, cells were
harvested and cell lysates were incubated with
32P-labeled eIF-2
. Samples were then separated
on an SDS-12% polyacrylamide gel, transferred to a nitrocellulose
membrane, and subjected to autoradiography. Data in Fig.
4A indicate that lysate of mock infected
cells (lane 5) or cells infected with recombinant baculovirus GF9911
expressing glucuronidase (lane 4) did not exhibit eIF-2
phosphatase
activity. In contrast, the lysate of cells infected with GF9909
expressing the wild-type
134.5 protein
was able to dephosphorylate eIF-2
(Fig. 4A, lane 3), although
it had no effect on phosphorylated GST-PKR. Lysate of cells infected
with GF9910 expressing PP1 alone did not display any eIF-2
phosphatase activity. Interestingly, the lysate of cells infected with
GF2003 lacked eIF-2
-specific phosphatase activity (Fig. 4A, lane 2).
Since GF2003 expresses the
134.5 protein with
Val193Glu and Phe195Leu
mutations in the PP1-interacting signature sequence, the result suggests that interaction of the
134.5 protein
with PP1 in Sf9 cells is essential to activate eIF-2
phosphatase. To
confirm that there was no degradation of
32P-labeled eIF-2
in the assays, Western blot
analysis with anti-eIF-2
antibody (Fig. 4B) indicated that the level
of eIF-2
is similar in all samples tested. These results demonstrate
that the
134.5 protein, when expressed in the
absence of any other HSV protein, is still capable of redirecting
endogenous protein phosphatase in Sf9 cells to dephosphorylate
eIF-2
. Importantly, the activity of the wild-type and mutant
134.5 proteins in Sf9 cells (Fig. 4A) closely
reflects the activity seen in HeLa cells infected with HSV-1(F) and
H9813 (Fig. 3B).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 4.
(A) eIF-2 phosphatase activity in Sf9 cells which
were mock infected or infected with recombinant baculoviruses. Sf9
cells (107 cells) were either mock infected or infected at
5 PFU per cell with GF9909, which expresses the wild-type
134.5 protein, GF2003, which expresses the mutant
134.5 protein with Val193Glu and
Phe195Leu substitutions, GF9910, which expresses PP1, or
GF9911, which expresses glucuronidase. At 48 h postinfection,
cells were harvested and lysates were prepared as described in
Materials and Methods. Aliquots of the lysates were then reacted with
32P-labeled eIF-2 at 34°C. After a 2-min incubation, the
reaction was stopped by adding disruption buffer, and samples were
processed as described for Fig. 3B. Lane 6, 32P-labeled
eIF-2 and GST-PKR not reacted with cell lysates; lanes 1 to 5, 32P-labeled eIF-2 and GST-PKR reacted with lysates of
cells which were mock infected or infected with the indicated
recombinant baculoviruses. (B) Immunoblot of the nitrocellulose
membrane in panel A.
|
|
The ArgAla motif in the carboxyl terminus is critical for the
function of the
134.5 protein.
Since the
134.5 protein modulates eIF-2
phosphatase
activity in Sf9 cells, we used this system to investigate the role of the carboxyl terminus of the
134.5 protein by
constructing a series of deletion mutants. Recombinant baculoviruses
were constructed to express mutant forms of the
134.5 protein with deletions from amino acids
238 to 263 (BH0010), 248 to 263 (BH0011), 253 to 263 (GF2022), 258 to
263 (GF2023), or 260 to 263 (GF2024) (Fig.
5A). These mutants, along with GF9909,
expressing wild-type
134.5 protein, and
GF2003, expressing the
134.5 protein with
Val193Glu and Phe195Leu
mutations in the PP1 signature motif, were used to infect Sf9 cells at
5 PFU per cell. Forty-eight hours after infection, cell lysates were
prepared, subjected to electrophoresis on an SDS-12% polyacrylamide
gel electrophoresis (PAGE) gel, and processed for immunoblot analysis
with mouse monoclonal anti-His tag antibody. As shown in Fig. 5B, these
mutants showed protein bands of the expected size and expressed the
134.5 protein at a level comparable to that of
GF9909 expressing wild-type
134.5 protein.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Schematic diagram of recombinant baculoviruses
expressing wild-type and mutant forms of the 134.5
protein. Line 1, domain structure of the wild-type 134.5
protein. (ATP)10 represents the triplet repeats of
AlaThrPro, which connects the amino-terminal domain and the
carboxyl-terminal domain. Numbers on the top denote the amino acid
positions. Line 2, wild-type 134.5 protein. Line 3, mutant 134.5 protein with Val193Glu and
Phe195Leu substitutions. Vertical lines indicate the
positions of substitutions. Lines 4 to 8, deletion mutants expressing
different-length segments of the 134.5 protein. Numbers
on the top of each line indicate the first and last amino acids
contained in each construct. (B) Expression of wild-type and mutants of
the 134.5 protein. Cell lysates of Sf9 cells which were
mock infected or infected with the indicated viruses were subjected to
electrophoresis on a denaturing 12% polyacrylamide gel, transferred to
a nitrocellulose membrane, and reacted with anti-His tag antibody
(Qiagen Inc).
|
|
We next tested the ability of these mutants to activate eIF-2

phosphatase in Sf9 cells. Aliquots of lysate from cells which
were mock
infected or infected with the
134.5 expressing
viruses
were reacted with
32P-labeled eIF2 and
samples were processed for autoradiography
as described above. As shown
in Fig.
6, lysate of cells which
were
mock infected or infected with GF2003 showed no eIF-2

phosphatase
activity (Fig.
6A, lanes 2 and 4). Lysates of cells infected with
GF2023 or GF2024 displayed eIF-2

phosphatase activity comparable
to
that of wild-type
134.5 protein (Fig.
6A,
lanes 3, 8, and
9), indicating that deletion of the last five amino
acids in the
carboxyl terminus had no effect on the function of the
134.5
protein. However, lysates of cells
infected with GF2022, BH0010,
or BH0011 failed to dephosphorylate
eIF-2

. PhosphorImager analysis
indicated that detectable
32P-labeled eIF-2

was less than 10% after
reaction with lysates
of cells infected with GF9909, GF2023, and
GF2024. In contrast,
the level of
32P-labeled
eIF-2

remained unchanged for GF2022, BH0010, and BH0011
compared to
that in the control reaction mixture (i.e., not reacted
with infected
cell lysates) (Fig.
6B, lanes 4 to 7 and 1). The
data demonstrate that
amino acids 238 to 258 of the
134.5 protein
are essential for dephosphorylation of eIF-2

.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Activity of the 134.5 mutants in Sf9
cells. Sf9 cells (107 cells) were mock infected (lane 2) or
infected with the indicated recombinant baculoviruses (lanes 3 to 9) at
5 PFU per cells at 27°C. At 48 h after infection, cells were
harvested and lysates were prepared as described in Materials and
Methods. Aliquots of each lysate were then incubated with
32P-labeled eIF-2 , and samples were processed for
autoradiography as described for Fig. 3B. (B) Quantitation of the
phosphorylated eIF-2 . Phosphorylated eIF-2 in each lane in panel
A was quantitated after eIF-2 phosphatase assays with a
PhosphorImage SI system (ImageQuant software). The numbers indicate
the percentages of phosphorylated eIF-2 remaining after incubation
with the cell lysates relative to that of unreacted eIF-2 .
|
|
Deletions of amino acids 238 to 263 from the carboxyl terminus do
not affect the association of the
134.5 protein with
PP1.
To address whether the deletions of amino acids 238 to 263 in
the carboxyl terminus of the
134.5 protein
altered its ability to associate with PP1, we carried out a GST
pull-down experiment. GST-PP1 was expressed, purified from E. coli, and incubated with cell extracts prepared from Sf9 cells
that were either mock infected or infected with virus at 5 PFU per
cell. The protein complexes bound to GST-PP1 were electrophoretically
separated on an SDS-PAGE gel and processed for immunoblot analysis with
anti-His tag antiserum. As shown in Fig.
7, GST-PP1, but not GST alone, pulled
down wild-type
134.5. In addition, GST-PP1
also pulled down mutant forms of the
134.5
protein expressed from BH0010, BH0011, GF2022, GF2023, and GF2024. The
results indicate that deletions of amino acids 238 to 263 from the
carboxyl terminus of the
134.5 protein do not
affect the association of this protein with PP1, as measured under
these experimental conditions.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
Interaction of PP1 with the 134.5
mutants. Sf9 cells infected with baculovirus expressing wild-type or
mutant forms of the 134.5 protein were harvested at
48 h postinfection and lysed in buffer containing 50 mM HEPES (pH
7.6), 150 mM NaCl, 10 mM MgCl2, and 1% Triton X-100. After
30 min on ice, the lysates were precleared with GST beads and then
incubated with GST-PP1 bound to beads at 4°C overnight. After washing
three times, the protein complexes were solubilized in disruption
buffer, electrophoretically separated on denaturing 12% polyacrylamide
gel, and transferred to a nitrocellulose sheet. The blot was probed
with anti-His tag antibody (Qiagen Inc).
|
|
Deletions in the AlaArg motif of the carboxyl terminus of the
134.5 protein disrupt the formation of an
eIF-2
-specific high-molecular-weight complex.
Because binding
of the
134.5 protein to PP1 generates a
high-molecular-weight complex that dephosphorylates eIF-2
in HeLa cells infected with HSV-1(F) (20), we investigated whether
this complex is formed in Sf9 cells infected with baculoviruses
expressing wild-type or mutant forms of the
134.5 protein. Sf9 cells were first infected
with recombinant baculovirus GF9909 expressing the wild-type
134.5 at 5 PFU per cell, and the cells were
harvested 48 h after infection. Lysate was then separated on a
Superdex 200 column and fractions were collected. These fractions were assayed for their ability to dephosphorylate
32P-labeled eIF2. The elution profile and
eIF-2
phosphatase activity are shown in Fig.
8A. While the bulk of proteins eluted in
fractions 15 to 20, eIF-2
phosphatase activity eluted as a single
peak in fractions 23 to 24 with a relatively minimum level of protein. Based on calibration of the column with different-sized protein standards, eIF-2
phosphatase activity eluted at a position that corresponds to a molecular weight of 340,000, the same size as the
complex containing the
134.5 protein and PP1
eluted from lysates of HeLa cells infected with HSV-1(F)
(20).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8.
(A) Superdex 200 gel filtration analysis of cytoplasmic
extracts from Sf9 cells infected with GF9909, expressing the wild-type
134.5 protein. Sf9 cells were infected with 5 PFU of
GF9909 per cell at 27°C. At 48 h postinfection, cells were
harvested and lysates were prepared and assayed for eIF-2
phosphatase activity as described in Materials and Methods. The dashed
line represents 32P-labeled eIF-2 remaining after
incubation with aliquots of indicated fractions, measured as described
in Materials and Methods. The size of the eIF-2 phosphatase complex
(340,000) was estimated with reference to the elution position of the
following protein size markers: horse spleen apoferritin (465,000),
aldolase (150,000), bovine serum albumin (69,000), ovalbumin (45,000),
and rabbit reticulocyte thioredoxin (11,600). (B) Immunoblot of
fractions from Superdex 200 column chromatography with
anti- 134.5 antibody. Lysates of Sf9 cells infected with
GF9909 or GF2022 were chromatographed as described for panel A. Aliquots of fractions 16 to 27 from each were separated on a SDS-12%
polyacrylamide gel, transferred to a nitrocellulose membrane, and
reacted with anti- 134.5 antibody as described in
Materials and Methods.
|
|
We also analyzed the distribution of the
134.5
protein in the same Superdex column fractions derived from lysates of
cells
infected with GF9909. Aliquots of these fractions were subjected
to electrophoresis in an SDS-12% PAGE gel and processed for
immunoblot
analysis with anti-
134.5 antibody.
As shown in Fig.
8B, for the
lysate of cells infected with GF9909, a
major portion of the
134.5
protein was in
fractions 16 to 19, coincident with a majority
of the
A280 and representing the void volume
of the column. These
fractions contain no eIF-2

phosphatase activity
(Fig.
8A), and
the nature of this
134.5 peak
remains unclear. However, a smaller,
second peak of
134.5 eluted in fractions 22 to 24, which is
exactly
coincident with the fractions containing eIF-2

phosphatase
activity
(Fig.
8A and B). We also analyzed lysates of Sf9 cells
infected
with GF2023 or GF2024 by chromatography on Superdex 200 and
observed
the same distribution of the
134.5
protein as was observed from
lysate of cells infected with GF9909 (data
not shown). These results
demonstrate that the
134.5 protein is a component of a
high-molecular-weight
complex in Sf9 cells that is capable of
dephosphorylating eIF-2

.
Since deletions of amino acids 238 to 258 in the carboxyl terminus of
the
134.5 protein abolished eIF-2

phosphatase activity
(Fig.
5 and
6A), we next evaluated whether these
deletions had
any effect on the formation of a high-molecular-weight
complex
in Sf9 cells. Lysate of Sf9 cells infected with GF2022, which
fails to activate eIF-2

phosphatase (Fig.
6), was chromatographed
on
the Superdex 200 column, and the distribution of the
134.5
protein in column fractions was
determined as described above.
The elution profile is similar to that
of GF9909 (data not shown).
Results in Fig.
8B indicate that the
complete absence of a
134.5-containing
peak
eluting in fractions 22 to 24 that corresponds to activated
eIF-2

phosphatase (Fig.
8A and B). In contrast, the large peak
of
134.5 not associated with eIF-2

phosphatase
in fractions
16 to 19 was not diminished. When lysates of cells
infected with
BH0010 or BH0011, which also failed to undergo activation
of eIF-2
phosphatase, were chromatographed on Superdex 200 and
similarly
analyzed, each also showed the complete absence of a
134.5-containing
complex in fractions 22 to 24 (data not shown). Collectively,
these data indicate that deletions of
amino acids 238 to 258 in
the
134.5 protein,
notably deletions in the AlaArg motif, disrupted
the formation of a
high-molecular-weight complex that dephosphorylates
the eIF-2

.
 |
DISCUSSION |
Several lines of evidence indicate that the
134.5 protein of HSV-1 is crucial in
counteracting the antiviral effect of PKR (6, 8, 9, 20, 21, 28,
29). HSV mutants that fail to express the
134.5 protein induce a premature shutoff of
protein synthesis in cell culture and are highly attenuated in
experimental animal models (7, 39). Recent studies
demonstrated that the
134.5 deletion mutants
replicate efficiently in PKR
/
knockout mice
but not in PKR+/+ mice (28, 29). We
have recently found that in HSV-infected cells the
134.5 protein binds to PP1, forming a
high-molecular-weight complex that specifically dephosphorylates
eIF-2
(20, 21), and that a PP1-interacting signature
motif, (Arg/Lys)(Val/Ile)XaaPhe, in the carboxyl terminus of the
protein is required to prevent shutoff of protein synthesis
(20). These observations indicate that interaction between
the
134.5 protein and PP1 is critical for
down-regulation of PKR activity.
To extend these studies, we further examined the role of the
PP1-interacting motif in viral replication. We constructed recombinant virus H9813 and tested its ability to replicate in cell cultures. As
shown in Fig. 2, Val193Glu and
Phe195Leu substitutions in
134.5 severely impaired replication of H9813 in SK-N-SH cells. Similar results were seen in mouse fibroblast line
T101/2 (data not shown). Moreover, lysate of cells infected with H9813
did not exhibit eIF-2
-specific phosphatase activity. These
observations strongly support the view that eIF-2
dephosphorylation mediated by the
134.5 protein is essential for
HSV-1 replication in infected cells. A linkage between viral
replication, Val193/Leu195
in the
134.5 protein, and eIF-2
phosphatase
activity underscores the importance of the PP1-interacting signature
motif in HSV-1 infection. A number of cellular PP1 binding proteins
have been reported to possess the signature sequence
(Arg/Lys)(Val/Ile)XaaPhe (3, 14, 22, 24, 38). Among them
are DARP-32 (dopamine- and cyclic AMP-regulated phosphoprotein)
(40), NIPP1 (nuclear inhibitor of PP1) (38),
G subunit (37), and splicing factor PSF (24).
The mechanism of PP1 regulation by these proteins remains unclear. It
is generally believed that these regulatory proteins either target PP1
to a particular subcellular location or modulate the PP1 catalytic
activity towards a specific substrate.
An important finding emerged from our studies is that the
134.5 protein activates eIF-2
phosphatase
activity independent of any other HSV proteins. Significantly, the
baculovirus system reproduces observation obtained from HeLa cells
infected with HSV-1 (Fig. 3B). As shown in Fig. 4, recombinant
baculovirus expressing the wild-type
134.5
protein is capable of activating eIF-2
phosphatase in Sf9 cells. In
addition, gel filtration analysis indicates that the
134.5 protein is a component of a
340,000-molecular-weight complex that dephosphorylates eIF-2
in
Sf9 cells (Fig. 8 and 9). These results parallel the previous findings
obtained from HeLa cells infected with HSV-1(F) (20) and
further demonstrate that the only HSV protein required for the
formation of the high-molecular-weight complex is the
134.5 protein. These studies also suggest that the
134.5 protein is likely to interact with
PP1 in Sf9 cells, since baculovirus expressing mutant
134.5 protein, with
Val193Glu and Phe195Leu
substitutions in the PP1 signature motif, is inactive in Sf9 cells
(Fig. 4, lane 2). The implications of these observations are twofold:
first, the baculovirus system can be employed to evaluate domain
functions of the
134.5 protein efficiently.
Second, it can be used as an alternative system to examine the
molecular nature of the
134.5-PP1 complex. Due
to a low level of expression of the
134.5
protein in HSV-infected cells, it has been difficult to obtain a
sufficient amount of the
134.5-PP1 complex
(unpublished data). The use of the baculovirus system will help to
resolve this problem.
Our studies support the notion that the carboxyl terminus of the
134.5 protein consists of a PP1 binding domain
and an effector domain. Data in Fig. 6 showed that deletions from amino
acids 258 to 263 did not have any effect on the
134.5 protein activity. Deletions from amino
acids 238 to 258 in the carboxyl terminus, however, are deleterious.
Although these mutants retain their ability to associate with PP1 (Fig.
7), they were unable to activate eIF-2
phosphatase (Fig. 6),
indicating that besides a PP1 interacting domain, the carboxyl terminus
of
134.5 contains an effector domain. It is
obvious that communication between the PP1-interacting motif and the
extreme carboxyl terminus of
134.5 determines
eIF-2
dephosphorylation. These results defined a region containing
amino acids 238 to 258, where a contiguous block of conserved amino acids is found not only in the
134.5 proteins
from HSV-1 and HSV-2 but also in GADD34 from mouse, hamster, and human
(Fig. 1). While the roles of these amino acids remain to be elucidated, their involvement in the effector function of
134.5 is intriguing. It is conceivable that
they play similar roles in GADD34 under conditions of DNA damage,
growth arrest, and differentiation (25, 30, 31, 41).
Of particular interest is the defective mutant GF2022 with a deletion
of 10 amino acids from 253 to 263. This region contains a copy of the
AlaArg motif (Fig. 1). Because amino acids 258 to 263 are dispensable
(Fig. 5A and 6A), it is most likely that a deletion in AlaArg motif
accounted for loss of the function. Although the exact role of AlaArg
remains unknown, gel filtration analysis suggests that deletions in the
AlaArg motif disrupted the formation of the active
134.5-PP1 complex (Fig. 8B) and this is
responsible for the failure of eIF2
phosphatase to become activated.
These data do not eliminate the possibility that the AlaArg repeat may serve as a structural element in the
134.5
protein. However, the fact that deletions in this motif did not affect
the ability of
134.5 to bind PP1 (Fig. 7)
suggests that overall protein structure may not have been changed. It
is possible that the AlaArg motif is involved in oligomerization of the
134.5 protein and PP1. Alternatively, the
AlaArg motif may be required for interaction with otherwise unknown
components present in the
134.5-PP1 complex. Work is in progress to address these possibilities.
 |
ACKNOWLEDGMENTS |
We thank Bernard Roizman for HSV-1(F), R3616, and
anti-
134.5 antibody, Robert Schneider for anti-eIF-2
antibody, William G. Bryan for plasmid pGEX-PKR, and William Walden and
Bellur Prabhakar for critical reading of the manuscript. We are
grateful to Suzanne Hessefort for technical assistance.
This work was supported by grant AI 46665 (B.H.) from the National
Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology (M/C 790), College of Medicine, The
University of Illinois at Chicago, 835 South Wolcott Ave., Chicago, IL
60612. Phone: (312) 996-2391. Fax: (312) 996-6415. E-mail:
tshuo{at}uic.edu.
 |
REFERENCES |
| 1.
|
Ackermann, M.,
J. Chou,
M. Sarmiento,
R. A. Lerner, and B. Roizman.
1986.
Identification by antibody to a synthetic peptide of a protein specified by a diploid gene located in the terminal repeats of the L component of herpes simplex virus genome.
J. Virol.
58:843-850[Abstract/Free Full Text].
|
| 2.
|
Adler, H. T.,
R. Chinery,
D. Y. Wu,
S. J. Kussick,
J. M. Payne,
A. J. Fornace, Jr., and D. C. Tkachuk.
1999.
Leukemic HRX fusion proteins inhibit GADD34-induced apoptosis and associate with the GADD34 and hSNF5/INI1 proteins.
Mol. Cell. Biol.
19:7050-7060[Abstract/Free Full Text].
|
| 3.
|
Aitken, A., and P. Cohen.
1982.
Isolation and characterisation of active fragments of protein phosphatase inhibitor-1 from rabbit skeletal muscle.
FEBS Lett.
147:54-58[CrossRef][Medline].
|
| 4.
|
Barber, G. N.,
M. Wambach,
S. Thompson,
R. Jagus, and M. G. Katze.
1995.
Mutants of the RNA-dependent protein kinase (PKR) lacking double-stranded RNA binding domain I can act as transdominant inhibitors and induce malignant transformation.
Mol. Cell. Biol.
15:3138-3146[Abstract].
|
| 5.
|
Chong, K. L.,
L. Feng,
K. Schappert,
E. Meurs,
T. F. Donahue,
J. D. Friesen,
A. G. Hovanessian, and B. R. Williams.
1992.
Human p68 kinase exhibits growth suppression in yeast and homology to the translational regulator GCN2.
EMBO J.
11:1553-1562[Medline].
|
| 6.
|
Chou, J.,
J. J. Chen,
M. Gross, and B. Roizman.
1995.
Association of a M(r) 90,000 phosphoprotein with protein kinase PKR in cells exhibiting enhanced phosphorylation of translation initiation factor eIF-2 and premature shutoff of protein synthesis after infection with 134.5 mutants of herpes simplex virus 1.
Proc. Natl. Acad. Sci. USA
92:10516-10520[Abstract/Free Full Text].
|
| 7.
|
Chou, J.,
E. R. Kern,
R. J. Whitley, and B. Roizman.
1990.
Mapping of herpes simplex virus-1 neurovirulence to 134.5, a gene nonessential for growth in culture.
Science
250:1262-1266[Abstract/Free Full Text].
|
| 8.
|
Chou, J., and B. Roizman.
1992.
The 134.5 gene of herpes simplex virus 1 precludes neuroblastoma cells from triggering total shutoff of protein synthesis characteristic of programmed cell death in neuronal cells.
Proc. Natl. Acad. Sci. USA
89:3266-3270[Abstract/Free Full Text].
|
| 9.
|
Chou, J., and B. Roizman.
1994.
Herpes simplex virus 1 134.5 gene function, which blocks the host response to infection, maps in the homologous domain of the genes expressed during growth arrest and DNA damage.
Proc. Natl. Acad. Sci. USA
91:5247-5251[Abstract/Free Full Text].
|
| 10.
|
Chou, J., and B. Roizman.
1990.
The herpes simplex virus 1 gene for ICP34.5, which maps in inverted repeats, is conserved in several limited-passage isolates but not in strain 17syn+.
J. Virol.
64:1014-1020[Abstract/Free Full Text].
|
| 11.
|
Chou, J., and B. Roizman.
1986.
The terminal a sequence of the herpes simplex virus genome contains the promoter of a gene located in the repeat sequences of the L component.
J. Virol.
57:629-637[Abstract/Free Full Text].
|
| 12.
|
Clemens, J. M.,
K. G. Laing,
I. W. Jeffrey,
A. Schofield,
T. V. Sharp,
A. Elia,
V. Matys,
M. C. James, and V. J. Tilleray.
1994.
Regulation of the interferon-inducible eIF-2 alpha protein kinase by small RNAs.
Biochimie
76:770-778[Medline].
|
| 13.
|
De Haro, C.,
R. Mendez, and J. Santoyo.
1996.
The eIF-2alpha kinases and the control of protein synthesis.
FASEB J.
10:1378-1387[Abstract].
|
| 14.
|
Egloff, P. M.,
D. F. Johnson,
G. Moorhead,
P. T. Cohen,
P. Cohen, and D. Barford.
1997.
Structural basis for the recognition of regulatory subunits by the catalytic subunit of protein phosphatase 1.
EMBO J.
16:1876-1887[CrossRef][Medline].
|
| 15.
|
Ejercito, P. M.,
E. D. Kieff, and B. Roizman.
1968.
Characterization of herpes simplex virus strains differing in their effects on social behaviour of infected cells.
J. Gen. Virol.
2:357-364[Abstract/Free Full Text].
|
| 16.
|
Gale, M., Jr., and M. G. Katze.
1998.
Molecular mechanisms of interferon resistance mediated by viral-directed inhibition of PKR, the interferon-induced protein kinase.
Pharmacol. Ther.
78:29-46[CrossRef][Medline].
|
| 17.
|
Gross, M., and D. A. Kaplansky.
1980.
Identification of a Mr = 39,000 phosphoprotein in highly purified preparations of rabbit reticulocyte eIF-2 that is distinct from the Mr = 35,000 subunit phosphorylated by the hemin-controlled translational repressor.
J. Biol. Chem.
255:6270-6275[Free Full Text].
|
| 18.
|
He, B.,
J. Chou,
R. Brandimarti,
I. Mohr,
Y. Gluzman, and B. Roizman.
1997.
Suppression of the phenotype of 134.5 herpes simplex virus 1: failure of activated RNA-dependent protein kinase to shut off protein synthesis is associated with a deletion in the domain of the 47 gene.
J. Virol.
71:6049-6054[Abstract].
|
| 19.
|
He, B.,
J. Chou,
D. A. Liebermann,
B. Hoffman, and B. Roizman.
1996.
The carboxyl terminus of the murine MyD116 gene substitutes for the corresponding domain of the 134.5 gene of herpes simplex virus to preclude the premature shutoff of total protein synthesis in infected human cells.
J. Virol.
70:84-90[Abstract].
|
| 20.
|
He, B.,
M. Gross, and B. Roizman.
1998.
The 134.5 protein of herpes simplex virus 1 has the structural and functional attributes of a protein phosphatase 1 regulatory subunit and is present in a high molecular weight complex with the enzyme in infected cells.
J. Biol. Chem.
273:20737-20743[Abstract/Free Full Text].
|
| 21.
|
He, B.,
M. Gross, and B. Roizman.
1997.
The 134.5 protein of herpes simplex virus 1 complexes with protein phosphatase 1alpha to dephosphorylate the alpha subunit of the eukaryotic translation initiation factor 2 and preclude the shutoff of protein synthesis by double-stranded RNA-activated protein kinase.
Proc. Natl. Acad. Sci. USA
94:843-848[Abstract/Free Full Text].
|
| 22.
|
Helps, N. R.,
H. M. Barker,
S. J. Elledge, and P. T. Cohen.
1995.
Protein phosphatase 1 interacts with p53BP2, a protein which binds to the tumour suppressor p53.
FEBS Lett.
377:295-300[CrossRef][Medline].
|
| 23.
|
Hershey, J. W.
1991.
Translational control in mammalian cells.
Annu. Rev. Biochem.
60:717-755[CrossRef][Medline].
|
| 24.
|
Hirano, K.,
F. Erdodi,
J. G. Patton, and D. J. Hartshorne.
1996.
Interaction of protein phosphatase type 1 with a splicing factor.
FEBS Lett.
389:191-194[CrossRef][Medline].
|
| 25.
|
Hollander, C. M.,
Q. Zhan,
I. Bae, and A. J. Fornace, Jr.
1997.
Mammalian GADD34, an apoptosis- and DNA damage-inducible gene.
J. Biol. Chem.
272:13731-13737[Abstract/Free Full Text].
|
| 26.
|
Lagunoff, M., and B. Roizman.
1994.
Expression of a herpes simplex virus 1 open reading frame antisense to the 134.5 gene and transcribed by an RNA 3' coterminal with the unspliced latency-associated transcript.
J. Virol.
68:6021-6028[Abstract/Free Full Text].
|
| 27.
|
Lee, S. B., and M. Esteban.
1994.
The interferon-induced double stranded RNA-activated protein kinase induced apoptosis.
Virology
199:491-496[CrossRef][Medline].
|
| 28.
|
Leib, D. A.,
T. E. Harrison,
K. M. Laslo,
M. A. Machalek,
N. J. Moorman, and H. W. Virgin.
1999.
Interferons regulate the phenotype of wild-type and mutant herpes simplex viruses in vivo.
J. Exp. Med.
189:663-672[Abstract/Free Full Text].
|
| 29.
|
Leib, D. A.,
M. A. Machalek,
B. R. Williams,
R. H. Silverman, and H. W. Virgin.
2000.
Specific phenotypic restoration of an attenuated virus by knockout of a host resistance gene.
Proc. Natl. Acad. Sci. USA
97:6097-6101[Abstract/Free Full Text].
|
| 30.
|
Lord, K. A.,
B. Hoffman-Liebermann, and D. A. Liebermann.
1990.
Sequence of MyD116 cDNA: a novel myeloid differentiation primary response gene induced by IL6.
Nucleic Acids Res.
18:2823[Free Full Text].
|
| 31.
|
McGeoch, D. J., and B. C. Barnett.
1991.
Neurovirulence factor.
Nature
353:609[Medline].
|
| 32.
|
McGeoch, D. J.,
C. Cunningham,
G. McIntyre, and A. Dolan.
1991.
Comparative sequence analysis of the long repeat regions and adjoining parts of the long unique regions in the genomes of herpes simplex viruses types 1 and 2.
J. Gen. Virol.
72:3057-3075[Abstract/Free Full Text].
|
| 33.
|
Meurs, E. F.,
J. Galabru,
G. N. Barber,
M. G. Katze, and A. G. Hovanessian.
1993.
Tumor suppressor function of the interferon-induced double-stranded RNA-activated protein kinase.
Proc. Natl. Acad. Sci. USA
90:232-236[Abstract/Free Full Text].
|
| 34.
|
Post, L. E.,
A. J. Conley,
E. S. Mocarski, and B. Roizman.
1980.
Cloning of reiterated and nonreiterated herpes simplex virus 1 sequences as BamHI fragments.
Proc. Natl. Acad. Sci. USA
77:4201-4205[Abstract/Free Full Text].
|
| 35.
|
Proud, C. G.
1995.
PKR: a new name and new roles.
Trends Biochem. Sci.
20:241-246[CrossRef][Medline].
|
| 36.
|
Srivastava, S. P.,
K. U. Kumar, and R. J. Kaufman.
1998.
Phosphorylation of eukaryotic translation initiation factor 2 mediates apoptosis in response to activation of the double-stranded RNA-dependent protein kinase.
J. Biol. Chem.
273:2416-2423[Abstract/Free Full Text].
|
| 37.
|
Tang, P. M.,
J. A. Bondor,
K. M. Swiderek, and A. A. DePaoli-Roach.
1991.
Molecular cloning and expression of the regulatory (RG1) subunit of the glycogen-associated protein phosphatase.
J. Biol. Chem.
266:15782-15789[Abstract/Free Full Text].
|
| 38.
|
Van Eynde, A.,
S. Wera,
M. Beullens,
S. Torrekens,
F. Van Leuven,
W. Stalmans, and M. Bollen.
1995.
Molecular cloning of NIPP-1, a nuclear inhibitor of protein phosphatase-1, reveals homology with polypeptides involved in RNA processing.
J. Biol. Chem.
270:28068-28074[Abstract/Free Full Text].
|
| 39.
|
Whitley, R. J.,
E. R. Kern,
S. Chatterjee,
J. Chou, and B. Roizman.
1993.
Replication, establishment of latency, and induced reactivation of herpes simplex virus 134.5 deletion mutants in rodent models.
J. Clin. Investig.
91:2837-2843.
|
| 40.
|
Williams, K. R.,
H. C. Hemmings, Jr.,
M. B. LoPresti,
W. H. Konigsberg, and P. Greengard.
1986.
DARPP-32, a dopamine- and cyclic AMP-regulated neuronal phosphoprotein. Primary structure and homology with protein phosphatase inhibitor-1.
J. Biol. Chem.
261:1890-1903[Abstract/Free Full Text].
|
| 41.
|
Zhan, Q.,
K. A. Lord,
I. Alamo, Jr.,
M. C. Hollander,
F. Carrier,
D. Ron,
K. W. Kohn,
B. Hoffman,
D. A. Liebermann, and A. J. Fornace, Jr.
1994.
The gadd and MyD genes define a novel set of mammalian genes encoding acidic proteins that synergistically suppress cell growth.
Mol. Cell. Biol.
14:2361-2371[Abstract/Free Full Text].
|
Journal of Virology, April 2001, p. 3666-3674, Vol. 75, No. 8
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.8.3666-3674.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Verpooten, D., Feng, Z., Valyi-Nagy, T., Ma, Y., Jin, H., Yan, Z., Zhang, C., Cao, Y., He, B.
(2009). Dephosphorylation of eIF2{alpha} Mediated by the {gamma}134.5 Protein of Herpes Simplex Virus 1 Facilitates Viral Neuroinvasion. J. Virol.
83: 12626-12630
[Abstract]
[Full Text]
-
Feng, Z., Cerveny, M., Yan, Z., He, B.
(2007). The VP35 Protein of Ebola Virus Inhibits the Antiviral Effect Mediated by Double-Stranded RNA-Dependent Protein Kinase PKR. J. Virol.
81: 182-192
[Abstract]
[Full Text]
-
Jing, X., He, B.
(2005). Characterization of the triplet repeats in the central domain of the {gamma}134{middle dot}5 protein of herpes simplex virus 1. J. Gen. Virol.
86: 2411-2419
[Abstract]
[Full Text]
-
Cheng, G., Feng, Z., He, B.
(2005). Herpes Simplex Virus 1 Infection Activates the Endoplasmic Reticulum Resident Kinase PERK and Mediates eIF-2{alpha} Dephosphorylation by the {gamma}134.5 Protein. J. Virol.
79: 1379-1388
[Abstract]
[Full Text]
-
Jing, X., Cerveny, M., Yang, K., He, B.
(2004). Replication of Herpes Simplex Virus 1 Depends on the {gamma}134.5 Functions That Facilitate Virus Response to Interferon and Egress in the Different Stages of Productive Infection. J. Virol.
78: 7653-7666
[Abstract]
[Full Text]
-
Cheng, G., Yang, K., He, B.
(2003). Dephosphorylation of eIF-2{alpha} Mediated by the {gamma}134.5 Protein of Herpes Simplex Virus Type 1 Is Required for Viral Response to Interferon but Is Not Sufficient for Efficient Viral Replication. J. Virol.
77: 10154-10161
[Abstract]
[Full Text]
-
Brush, M. H., Weiser, D. C., Shenolikar, S.
(2003). Growth Arrest and DNA Damage-Inducible Protein GADD34 Targets Protein Phosphatase 1{alpha} to the Endoplasmic Reticulum and Promotes Dephosphorylation of the {alpha} Subunit of Eukaryotic Translation Initiation Factor 2. Mol. Cell. Biol.
23: 1292-1303
[Abstract]
[Full Text]
-
Cheng, G., Brett, M.-E., He, B.
(2002). Signals That Dictate Nuclear, Nucleolar, and Cytoplasmic Shuttling of the {gamma}134.5 Protein of Herpes Simplex Virus Type 1. J. Virol.
76: 9434-9445
[Abstract]
[Full Text]
-
Wu, D. Y., Tkachuck, D. C., Roberson, R. S., Schubach, W. H.
(2002). The Human SNF5/INI1 Protein Facilitates the Function of the Growth Arrest and DNA Damage-inducible Protein (GADD34) and Modulates GADD34-bound Protein Phosphatase-1 Activity. J. Biol. Chem.
277: 27706-27715
[Abstract]
[Full Text]
-
Mao, H., Rosenthal, K. S.
(2002). An N-terminal Arginine-rich Cluster and a Proline-Alanine-Threonine Repeat Region Determine the Cellular Localization of the Herpes Simplex Virus Type 1 ICP34.5 Protein and Its Ligand, Protein Phosphatase 1. J. Biol. Chem.
277: 11423-11431
[Abstract]
[Full Text]
-
Petrowsky, H., Roberts, G. D., Kooby, D. A., Burt, B. M., Bennett, J. J., Delman, K. A., Stanziale, S. F., Delohery, T. M., Tong, W. P., Federoff, H. J., Fong, Y.
(2001). Functional Interaction between Fluorodeoxyuridine-Induced Cellular Alterations and Replication of a Ribonucleotide Reductase-Negative Herpes Simplex Virus. J. Virol.
75: 7050-7058
[Abstract]
[Full Text]