Previous Article | Next Article 
Journal of Virology, April 2001, p. 3371-3382, Vol. 75, No. 7
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.7.3371-3382.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Construction and Molecular Analysis of Gene
Transfer Systems Derived from Bovine Immunodeficiency Virus
Robert
Berkowitz,*
Heini
Ilves,
Wei Yu
Lin,
Karl
Eckert,
Andrea
Coward,
Stan
Tamaki,
Gabor
Veres, and
Ivan
Plavec
Systemix Inc., Palo Alto, California 94304
Received 20 October 2000/Accepted 4 January 2001
 |
ABSTRACT |
Because lentiviruses are able to infect nondividing cells, these
viruses might be utilized in gene therapy applications where the target
cell does not divide. However, it has been suggested that the
introduction of primate lentivirus sequences, particularly those of
human immunodeficiency virus, into human cells may pose a health risk
for the patient. To avoid this concern, we have constructed gene
transfer systems based on a nonprimate lentivirus, bovine
immunodeficiency virus. A panel of vectors and packaging constructs was
generated and analyzed in a transient expression system for virion
production and maturation, vector expression and encapsidation, and
envelope protein pseudotyping. Virion preparations were also analyzed
for transduction efficiency in a panel of human and nonhuman
primary cells and immortalized cell lines. The virion preparations
transduced most of the target cell types, with efficiencies up to 90%
and with titers of unconcentrated virus up to 5 × 105
infectious doses/ml. In addition, infection of nondividing human cells,
including unstimulated hematopoietic stem cells and irradiated endothelial cells, was observed.
 |
INTRODUCTION |
One method of transferring
therapeutic genes into human cells for disease applications involves
inserting the gene into a virus genome and letting the modified virus
infect the cells. Because retroviruses integrate their genomes into the
target cell chromosomes, retrovirus-mediated gene transfer
theoretically provides for long-term expression of the therapeutic gene
in the transduced cell. However, the retroviral preintegration complex
does not traverse the nuclear membrane pore, requiring target cell
division in order for the viral genome to be integrated (27,
44). Lentiviruses also integrate their genomes but do not
require target cell division, since the lentivirus preintegration
complex can traverse the nuclear membrane pore (8, 26).
Therefore, lentiviruses are attractive vehicles for gene therapy
applications requiring long-term expression of a therapeutic gene in
nondividing cells (for reviews, see references 7 and 47).
Gene transfer systems based on human immunodeficiency virus type 1 (HIV-1) are by far the most developed lentivirus systems, with
documented in vivo transduction of rat brain (5, 37, 38),
retina (34, 36), muscle and liver (23), and
mouse trachea (22). Mouse pancreatic islets were
transduced ex vivo and transplanted in vivo, with stable expression of
the transgene (17). In addition, HIV-1-derived vectors
have transduced human corneal tissue ex vivo (50).
Moreover, unstimulated human hematopoietic stem cells (HSCs) transduced
in vitro have developed into mature T (14) and B cells
(35) in in vivo models of lymphocyte maturation. Gene
transfer systems have been derived from other lentiviruses as well,
including HIV-2, simian immunodeficiency virus, feline immunodeficiency
virus, (13a, 42), equine infectious anemia virus
(33, 40), and visna virus (4a).
Although HIV-1 vectors are the most well studied, some authors have
suggested that HIV-based vectors pose safety risks for human clinical
applications (7, 47). The possibility has been raised that
if the HIV-1 vector recombines with endogenous human retroviruses
present in the cells (29, 32) or with exogenous viruses
present during transient infections, there is a chance of generating
replication-competent HIV-1 or transferring the vector to other cells
in the patient. Such a recombination event is less likely to occur for
nonhuman or even nonprimate vectors. In addition, even if the
nonprimate lentivirus were to become replication competent, it may not
be as destructive in humans as HIV-1, although the point has been
debated (47).
Bovine immunodeficiency virus (BIV) is a lentivirus which infects cows
and causes AIDS-like disease after a variable asymptomatic phase
(19). Although the virus has a set of accessory genes similar to those of HIV and simian immunodeficiency virus, it is the
most ancient known lentivirus and does not readily infect T cells.
Instead, the virus is found predominantly in monocytes and splenic
macrophages in vivo (19). In this report we describe the
generation and characterization of gene transfer systems based on BIV
clone 127 (18). The vectors were observed to transduce proliferating and nondividing human and nonhuman cell lines and primary
cells, in some instances with virus titers almost as high as that of an
HIV-1 gene transfer system (14).
 |
MATERIALS AND METHODS |
Plasmids.
All restriction endonucleases were purchased from
Roche Molecular Biochemicals (Indianapolis, Ind.). Plasmid pBIV,
containing BIV proviral clone 127 (18), was obtained from
the National Institutes of Health, Rockville, Md. Plasmid pCI was
obtained from Promega (Madison, Wis.). Plasmid pCIGL contains the
vesicular stomatitis virus glycoprotein (VSV-G) cDNA (9,
51) in the pCI polylinker, downstream of the human
cytomegalovirus (CMV) immediate-early promoter and chimeric intron and
upstream of the simian virus 40 (SV40) late polyadenylation signal.
Plasmid pCrev, containing the HIV-1 rev cDNA under control
of the CMV promoter, has been described previously (30).
Plasmid pBH1 was generated by sequential insertion of two pBIV segments
into the pCI polylinker using standard techniques: a 5.5-kb
SmaI-XbaI fragment containing the gag, pol,
vif, vpw, and vpy genes, as well as the first coding exons of the tat and rev genes; and a 1.3-kb
DraIII-PvuII fragment containing the putative
rev-response element (RRE) and the second coding exons of the
tat and rev genes. Plasmids pBH2 and pBH3 were
constructed in the same way, but the chimeric intron was deleted;
moreover, the pBH2 5' BIV fragment also contained the 3' 70 bp of the
leader, including the major splice donor site. Plasmids pBH1 and pBH3
were also modified by insertion of (1) an approximately
500-bp fragment of HIV-1 containing the RRE, (2) an
internal ribosome entry site (IRES) from encephalomyocarditis virus
(21), and (3) the puromycin
N-acetyltransferase cDNA (49). Plasmid pBBB was
generated by digesting plasmid pBIV with BfrI and
BglII to remove most of the coding region and inserting into
the gap a short polylinker created by annealing oligonucleotides BB5
(5'-TTAAGATTTAAATACGCGTGCGGCCGCA-3') and BB3
(5'-GATCTGCGGCCGCACGCGTATTTAAATC-3').
Packaging construct BH2 and an HIV-1 packaging construct
(14) were each modified by insertion of two hemagglutinin
(HA) oligonucleotides immediately upstream of the gag stop
codon and deletion of most of the pol coding region as
follows. First, a small fragment containing the gag stop
codon of each packaging construct (290-bp
ApaI-AccI fragment of BIV, 360-bp
ApaI-BstXI fragment of HIV-1) was ligated to
ApaI/EcoRV-digested pBluescript SK(+)
(Stratagene, La Jolla, Calif.). Next, each subclone was subjected to
reverse PCR amplification using primers containing the HA tags HHAS
(5'-TATCCATACGATGTTCCAGATTATGCTTAAAGATAGGGGGGCAATTAAAG-3') and
HHAA(5'-AGCATAATCTGGAACATCGTATGGATATTGTGACGAGGGGTCGCTG-3') for HIV-1 and BHAS
(5'-TATCCATACGATGTTCCAGATTATGCTTAGACAAACAGCCTTTTATAAAG-3') and BHAA
(5'-AGCATAATCTGGAACATCGTATGGATAATCTAATATAAGAGGGGGTGC-3') for
BIV. Each PCR product was circularized, and then the modified gag fragment was excised with
ApaI/SmaI and ligated to the parental packaging
construct deleted between the ApaI site in gag
and the 3' end of pol (Asp718 for HIV-1,
NsiI for BIV).
The CMV immediate-early enhancer-promoter was used to replace the BIV
promoter in the 5' LTR in plasmids pBIV and pBBB as
follows. First, the
CMV region upstream of the TATA box was subjected
to PCR amplification
with primers CB5 (5'-CGGGATCCCGTAGTTATTAATAGTAATCAATTACGG-3')
and CMVBIV3 (5' AGATATGGTTTATATAGACCTCCCACCGTACA-3')
while the
BIV region downstream of the TATA box was subjected to
PCR amplification
with primers CMVBIV5
(5'-GGGAGGTCTATATAAACCATATCTTCACTCTGT-3')
and Bgag3
(5'-GCCGTTTCTGTACTCTCTGGT-3'). Second, the two amplified
products were mixed and subjected to amplification using primers
CB5
and Bgag3. The final product was digested with
XmaCI and
ligated
to plasmids pBIV and pBBB, previously digested with
NruI and
XmaCI,
generating plasmids pBIVC and
pBBBC. Plasmid pBIVC was then digested
with
SmaI and
AflIII to remove most of the coding region and blunt-end
ligated to a DNA segment containing either the CMV promoter or
the
mouse phosphoglycerate kinase (PGK) promoter (
1) linked
to
the enhanced green fluorescent protein (eGFP) cDNA (Promega)
generating
plasmids pBCCG and pBCPG, respectively. Plasmid pBIVC
was also digested
with
BfrI and
BglII to remove a smaller segment
of the coding region and then blunt-end ligated to the CMV-eGFP
and PGK-eGFP cassettes, as well as a DNA segment containing eGFP
linked
to MND, a modified version of the myeloid proliferative
sarcoma virus
long terminal repeat (LTR) (
43), generating plasmids
pBC2CG, pBC2PG, and pBC2MG, respectively. Plasmid pBBBC was
digested
with
MunI and
HpaI to remove BIV
sequences between the putative
RRE and the 3' LTR and then ligated to
the MND-eGFP and PGK-eGFP
cassettes to generate plasmids pBC3MG and
pBC3PG, respectively.
The CMV-eGFP cassette was also inserted into the
BstEII site of
plasmid pBIV to generate
pBCG.
Plasmid pBC3MG was digested with
BfrI and
BglII
to remove the short polylinker and then (i) ligated to an ~500-bp
BglII fragment
of the pBIV
pol gene (containing
the putative central polypurine
tract) to produce plasmid pBC3MGppt;
(ii) ligated to an ~1-kb
BfrI fragment of pBIV (containing
the 3' end of the BIV
gag gene)
to produce plasmid
pBC3MGgag; or (iii) ligated to an ~800-bp fragment
containing the
human beta interferon scaffold attachment region
(SAR) (
2)
to produce plasmid pBC3MGsar. Plasmid pBC3MGgag was
linearized with
BfrI and ligated to the SAR and central polypurine
tract
(cPPT) fragments to produce plasmids pBC3MGgagSAR and
pBC3MGgagppt,
respectively. Plasmid pBC3MGppt was linearized with
BfrI and ligated
to the SAR fragment to produce plasmids
pBC3MGpptsar. Plasmids
pBC3MP and pBC3MPsar were generated from
plasmids pBC3MG and pBC3MGsar,
respectively, by replacement of the eGFP
cDNA with the puromycin
N-acetyltransferase cDNA
(
49).
Plasmids pBC4MG and pBC4MGppt, in which the 3' LTR contains a large
deletion in the U3 region and an insertion of the SV40
late
polyadenylation signal upstream enhancer element (USE)
(
45),
were generated from plasmids pBC3MG and pBC3MGppt,
respectively,
as follows. First, the 5' portion of the LTR and SV40
regions
was subjected to PCR amplification with primers GFP5
(5'-GAGGACGGCAACATCCTGG-3')
and BSINSV3
(5'-AGCAATAGCATCACAAATTTCACAAATAAACACATATGGGAAGTCCGGG-3')
while the 3' portion was subjected to PCR amplification with
primers
BSINSV5
(5'-GTG AAATTTGTGATGCTATTGCTTTATTTGTAATCTTGTACTTCAGCTCGT
GTAG-3')
and BIV3 (5'-TCGCCGACATCACCGATGG-3'). Second, the two
amplified products were mixed and subjected to amplification using
primers GFP5 and BIV3. The final product was digested with
SspBI
and
SphI and ligated to plasmids pBC3MG and
pBC3MGppt previously
digested with
SspBI and
SphI. The resulting plasmids, pBC4MG and
pBC4MGppt, contain
the 40-bp SV40 USE in place of 332 bp of the
U3
region.
For the relative assessment of the BIV gene transfer system, HIV-1 and
murine leukemia virus (MLV) gene transfer systems were
used. Details of
the construction of the packaging constructs
and vectors have been
published elsewhere (
14).
Immortalized cells.
293T cells were obtained from Gary Nolan
(Stanford University, Palo Alto, Calif.). CEMSS cells were obtained
from the AIDS Reagent Program (Rockville, Md.). A-10 and D-17 cells
were obtained from the American Tissue Type Collection (Manassas, Va.).
MN9D cells (13) were obtained from Rainer Ortman
(Novartis, Basel, Switzerland). Embryonal rabbit epithelial (EREp)
cells (39) were obtained from the National Institutes of
Health. Human umbilical vein endothelial cells (HUVEC)
(20) and primary rat aorta (smooth muscle) cells were
obtained from Clonetics (San Diego, Calif.). HUVEC were cultured in EBM
basal medium with the FGM bullet kit containing 0.1% human epidermal
growth factor, 2% fetal calf serum (FCS), 0.4% bovine brain extract
with heparin, 0.1% gentamicin-amphotericin B, and 0.1%
hydrocortisone. Rat aorta cells were maintained in EBM basal medium
with the EGM-MV bullet kit containing 0.1% human epidermal growth
factor, 5% FCS, 0.4% bovine brain extract with heparin, 0.1%
gentamicin-amphotericin B, 0.1% hydrocortisone and cultured in
Primaria tissue culture flasks (Becton Dickinson Biosciences, San Jose,
Calif.). CEMSS cells were cultured in RPMI 1640 medium supplemented
with 10% FCS. All other cell lines were cultured in Dulbecco's
modified Eagle medium supplemented with 10% FCS. HUVEC (1.25 × 105) were suspended in 5 ml of medium and irradiated with
8,000 rads from a 137Cs source irradiator (J. L. Shepherd, San Fernando, Calif.) and then transferred to a six-well dish
and incubated for 2 days to allow for synchronization in the
G2/M phase of the cell cycle.
Virus production.
293T cells (4 × 106 to
10 × 106 293T cells) were seeded into 10-cm-diameter
dishes overnight and transfected the next day with 20 to 30 µg of
plasmid DNA by the calcium phosphate method (Clontech, Palo Alto,
Calif.). Typically, 20 µg of the vector, 10 µg of the packaging
construct, and 3 µg of the VSV-G plasmid were used. In cases where
the HIV-1 rev protein was required, 4 µg of plasmid pCrev was added.
After 24 to 72 hr, the cells or the virus-containing medium was
collected and analyzed in a variety of ways (see below). To assess the
efficiency of transfection, a portion of the cells were analyzed for
eGFP expression by flow cytometry, using a FACScan apparatus (Becton
Dickinson Biosciences). To measure the amount of virus shed into the
medium, the medium was cleared of cellular debris by low-speed
centrifugation, and then 10 µl was lysed and analyzed for reverse
transcriptase (RT) activity using a commercial kit (Roche Molecular Biochemicals).
Analysis of RNA levels: Northern blotting.
Transfected cells
were lysed and cytoplasmic RNA was prepared using a commercial kit
(Qiagen, Valencia, Calif.). In addition, virus-containing medium was
collected, subjected to low-speed centrifugation to remove cellular
debris, and then subjected to high-speed centrifugation
(50,000 × g for 90 min at 4°C) to collect the virus
particles. The viral pellet was lysed and the viral RNA was prepared
using a commercial kit (Qiagen). A fixed amount of cytoplasmic RNA (10 µg) or viral RNA (one-third of the RNA preparation, not quantitated)
was subjected to 1% agarose gel electrophoresis and transferred to a
nylon filter (Bio-Rad, Hercules, Calif.). The filter was exposed to
40 × 106 cpm of a DNA fragment random primed with
[32P]dCTP using a commercial kit (Ambion, Austin,
Tex.) and then washed and analyzed for bound probe with a
PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.). The probes
included a BIV gag fragment and an HIV-1 gag
fragment (both ~1 kb), an ~330-bp BIV U3 fragment, and an ~800-bp
eGFP fragment.
Analysis of protein levels: Western blotting assay.
Transfected cells were lysed on ice for 1 h in a buffer containing 1%
NP-40, 150 mM NaCl, 10 mM Tris-Cl (pH 7.4), 1 mM EDTA, and Pefabloc
protease inhibitor (Roche Molecular Biochemicals). The lysate was
subjected to centrifugation at 8,000 × g for 20 min at
4°C to remove precipitated proteins and other debris. Alternatively, virus-containing medium was collected, subjected to brief
centrifugation to remove cellular debris, and then subjected to
high-speed centrifugation (50,000 × g for 90 min at
4°C) to collect the virus particles. The viral pellet was lysed
directly in sodium dodecyl sulfate-polyacrylamide gel electrophoresis
sample buffer (Novex, San Diego, Calif.). A fixed amount of cell or
viral lysate was subjected to acrylamide gel electrophoresis and
transferred to a nitrocellulose filter. The filter was exposed to
rabbit serum specific for BIV Gag protein (obtained from the
National Institutes of Health), then to horseradish peroxidase
(HRP)-conjugated goat anti-rabbit immunoglobulin (Ig) antibody (Zymed,
South San Francisco, Calif.), and then to the HRP substrate
o-phenylenediamine dihydrochloride (OPD; Sigma, St. Louis,
Mo.). Prestained molecular weight standards (Bio-Rad) were used to
determine the approximate molecular weight of the BIV Gag bands. For
the HIV Western blot, the filter was exposed to biotinylated anti-HIV
Gag antibody (Beckman Coulter, Fullteron, Calif.) and then to
steptavidin-conjugated HRP (Beckman Coulter) before the OPD reaction.
For the HA Western blot, the filter was exposed to a biotinylated
anti-HA antibody (Roche Molecular Biochemicals) and then to the
steptavidin-conjugated HRP before the OPD reaction. For the VSV-G
Western blot, the filter was exposed to mouse anti-VSV-G monoclonal
antibody (MAb) (Sigma) and then to an HRP-conjugated goat anti-mouse Ig
antibody (Zymed) before the OPD reaction.
Analysis of transduction.
To transduce cells, the
virus-containing medium was subjected to brief centrifugation to remove
cellular debris and then 1 ml was added to fresh cells in polypropylene
tubes (5 × 105 CEMSS cells) or in six-well dishes
(3 × 105 to 6 × 105 adherent cells
seeded per well the previous day). Protamine sulfate (Sigma) was added
to the wells at a final concentration of 8 µg/ml and the tubes or
dishes were subjected to centrifugation ("spinoculation") at 1,500 × g for 2 to 3 h at 32 to 37°C. In later
experiments, the tubes or wells were also supplemented with 10 mM HEPES
buffer prior to spinoculation to prevent the pH of the medium from
rising while the cells were in the centrifuge. After spinoculation, the tubes and dishes were processed in different ways: supernatant was
aspirated from the tubes, and the CEMSS cells were suspended in fresh
medium and transferred to six-well dishes. In contrast, the
spinoculated dishes were placed back into the incubator for 30 to 60 min, and then the medium was removed and fresh medium was added to the
wells. At 2 to 3 days postspinoculation, a portion of the cells were
removed from the plate and analyzed for eGFP expression by flow
cytometry, using a FACScan apparatus (Becton Dickinson Biosciences).
For virus preparations containing the vectors pBC3MP and pBC3MPsar,
293T cells were subjected to spinoculation with serial dilutions of the
virus-containing medium, and fresh medium supplemented with puromycin
(5 µg/ml) was added to the cells 24 h postspinoculation. Seven
to ten days later, colonies were counted by direct visualization.
Infection of primary T cells.
Human peripheral blood
mononuclear cells (PBMC) were isolated from adult peripheral whole
blood by Ficoll density gradient centrifugation, rinsed in
phosphate-buffered saline, and suspended in RPMI 1640 medium
supplemented with 10% FCS. A portion of the PBMC were activated by
adding interleukin 2 (Peprotech, Rocky Hill, N.J.) to the medium at a
final concentration of 200 U/ml and culturing the cells for 3 days in
12-well dishes (3 × 106 cells per well) precoated as
follows: the dishes were incubated with 1 µg of goat anti-mouse Ig Fc
(Pierce, Rockford, Ill.) per ml for 3 h, rinsed with
phosphate-buffered saline, incubated with a mixture of MAbs (1 µg of
anti-CD3 [OKT3] per ml and 10 ng of anti-CD28 [BD PharMingen, San
Diego, Calif.] per ml) for 1 h and rinsed with medium. Activated or
unstimulated PBMC (5 × 105) were spinoculated with
viral supernatant in polypropylene tubes similar to CEMSS cells (see
above); after spinoculation, the cells were rinsed and suspended in
medium containing interlenkin-2 and cultured in 24-well dishes
precoated with the anti-CD3 and anti-CD28 MAbs. Four days and 2 weeks
later, a portion of the cells was removed from the well and analyzed
for eGFP expression by flow cytometry, using a FACScan apparatus
(Becton Dickinson Biosciences). T cells were identified by light
scatter properties and by expression of CD4 and CD8, using
allophycocyanin (APC)-conjugated anti-CD4 and PerCP-conjugated anti-CD8
MAbs (Becton Dickinson Biosciences).
Infection of HSCs.
Human CD34+ cells were
isolated from granulocyte colony-stimulating factor-mobilized
peripheral whole blood from healthy donors using Isolex 300SA (Baxter
Healthcare, Deerfield, Ill.). The cells (80 to 90% pure
CD34+) were aliquoted (107) and frozen in
medium consisting of 45% Iscove's modified Eagle medium, 45% FCS and
10% dimethyl sulfoxide. Prior to transduction, the frozen cells were
first thawed in buffer containing 2% FCS, 1% HEPES, and 10 U of
heparin per ml. After thawing, the cells (5 × 105)
were either spinoculated (see above) with viral supernatant in the
absence of cytokines or cultured for 48 h in cytokine-containing medium
(X-vivo15 medium [BioWhittaker, Walkersville Md.], thrombopoietin [tpo] mimetic [50 ng/ml; Novartis], flt3 ligand [100 ng/ml], and c-kit ligand [100 ng/ml; both from Systemix, Palo alto, Calif.]), and
then spinoculated with viral supernatant. After infection, the cells
were cultured in cytokine-containing medium. Three days or 2 weeks
later, a portion of the cells was stained with APC-conjugated anti-CD34
antibody (Becton Dickinson Biosciences) and analyzed for eGFP on the
CD34+ cells on a FACScan apparatus (Becton Dickinson Biosciences).
 |
RESULTS |
Can BIV transduce human cells?
To determine whether BIV could
transduce human cells, the wild-type BIV genome (Fig.
1A) was modified by insertion of the eGFP
marker gene, producing construct BCG. The eGFP gene was inserted into
an interior position within the viral envelope gene so as not to affect
viral rev or tat expression or RRE function. The human kidney carcinoma cell line 293T was cotransfected with construct BCG and a plasmid encoding VSV-G; 2 days later, the virus-containing medium was collected and exposed to fresh 293T cells. In addition, the
medium was added to the embryonal rabbit epithelial cell line EREp,
which supports wild-type BIV replication (39). Three days later, the exposed cells were assayed for eGFP expression by flow cytometry (Fig. 1B). A subset of the 293T cells (approximately 5%)
expressed eGFP, indicating that BIV could carry out all of the
functions (including reverse transcription and integration) required
for transduction of human cells. Similar transduction efficiencies were
noted for the EREp cell line (Fig. 1B).


View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Wild-type BIV genome. Viral coding regions
are arranged in three horizontal lines representing the different
reading frames. The rev and tat genes are
composed of two coding regions each. The first coding region of
rev and the tmx coding region are in the same
reading frame as env. The approximate position of the
insertion of CMV-eGFP (in construct BCG) is indicated above the top
line. (B) BIV can transduce human cells. VSV-G-pseudotyped construct
BCG was produced in 293T cells and exposed to EREp (right column) and
fresh 293T (left column) cells; 3 days later, the cells were analyzed
for eGFP expression by flow cytometry. The percentage of
eGFP+ cells is indicated inside each histogram.
|
|
BIV packaging constructs.
As a first step towards setting up a
BIV-based gene transfer system, in which the eGFP gene and viral genes
are encoded on separate plasmids, packaging constructs (containing the
viral genes) were generated (Fig. 2A) and
assayed for gag mRNA expression (Fig. 2B) and virus
production (Table 1) in the transient
expression system. One construct, BIVC, is identical to wild-type BIV
except for a precise replacement of the 5' LTR U3 region with the human CMV immediate-early promoter. The junction between the two segments is
located at the identical TATA boxes to maximize the chances that the
viral RNA would contain the proper 5' end for infection of target
cells. The three other BIV packaging constructs contain the CMV
promoter and transcription initiation site linked to the BIV leader
near of the gag gene, deleting the 5' LTR and primer binding
site and
in the case of constructs BH1 and BH3
the major splice
donor. Construct BH1 contains a small chimeric intron inserted between
the CMV and BIV segments. Downstream of the pol gene, construct BH2 contains all viral coding sequences except for a deletion
(approximately 1 kb) of the interior of env (not predicted to affect tat and rev expression or RRE
function), while constructs BH1 and BH3 contain BIV sequences
terminating approximately 250 bp downstream of the pol gene.
Since BH1 and BH3 lack the rev gene and the RRE, the HIV-1
RRE was inserted downstream of the BIV sequences and HIV-1 rev protein
was provided in trans when the constructs were
characterized. In addition, these two constructs contain the puromycin
N-acetyltransferase cDNA (49) coupled to an
IRES from the encephalomyocarditis virus (21), for
selecting cell lines stably producing the packaging construct.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
BIV packaging constructs and expression in
transfected 293T cells. (A) wild-type BIV, CMV-driven BIV, and
three packaging constructs (BH1 to -3) are depicted for their
gag, pol, and env genes; accessory genes are not
shown. Also depicted are the viral major splice donor (MSD), a small
chimeric intron (in), the HIV-1 RRE, the puromycin
N-acetyltransferase cDNA linked to an IRES from
encephalomyocarditis virus (IRES-puro), and the SV40 late
polyadenylation signal (SV40 polyA). (B) Northern analysis
of the constructs' steady-state cytoplasmic expression levels.
Cytoplasmic RNA from transfected 293T cells was probed for
gag sequences; the high-molecular weight band in each lane
corresponds to the construct's gag mRNA.
|
|
Northern analysis of transfected cell cytoplasmic RNA (Fig.
2B)
indicated that construct BIVC produced higher steady-state
levels of
gag mRNA (816 cpm) than did wild-type BIV (249 cpm)
or
construct BCG (113 cpm) (Fig.
1A), suggesting that the CMV
promoter was
more active than the BIV LTR in 293T cells. Packaging
constructs BH1
(70 cpm) and BH3 (39 cpm) expressed low levels
of
gag mRNA,
but BH2 (861 cpm) expressed high levels comparable
to construct BIVC.
For comparison, a CMV-driven HIV-1-derived
packaging construct
(
14) was observed to express even higher
levels of
gag mRNA (1,120
cpm).
RT assay (Table
1) and Western blot analysis (data not shown) of virus
collected from the transfected cells indicated that
BIVC produced more
virus particles than did wild-type BIV, BH1,
and BH3, but much less
than BH2 or the HIV-1 packaging construct.
The low amount of BIVC virus
may have been due to toxicity in
the transfected cells resulting from
BIVC's high-level expression
of the wild-type BIV envelope protein, as
cytopathic effects and
small syncytia were observed in the culture.
Western blot analysis
indicated that both the BIVC and BH2 virus
preparations had undergone
maturation, i.e., the Gag polyprotein was
almost entirely cleaved
(data not shown and Fig.
3, see
below).
The RT assay indicated that the amount of virus produced by BH2 was
similar to that produced by the HIV-1 packaging construct.
To verify
that the amounts of virus were similar, these two packaging
constructs
were modified by insertion of two consecutive HA tags
immediately
upstream of the
gag stop codon. The HA-tagged constructs,
which had further deletions of most of the
pol gene to block
Gag
polyprotein cleavage, were introduced into 293T cells alongside
the
parental constructs. The modified virus was collected 2 days
later and
compared to the parental virus by Western blot assay
using antibodies
specific for Gag protein: both modified constructs
produced amounts of
virus similar to the parental constructs (Fig.
3). The modified viruses were then
normalized by RT assay of the
parental constructs (649 pg for HIV-1,
205 pg for BH2) and analyzed
for HA tag content by Western blot assay.
The amounts of HA-tagged
HIV-1 Gag polyprotein and HA-tagged BIV Gag
polyprotein were similar
(Fig.
3), corroborating the RT assay: the BH2
packaging construct
produced levels of virus roughly similar to the
HIV-1 packaging
construct.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
BIV produces levels of virus similar to HIV-1. BIV
packaging construct BH2 and an HIV-1 packaging construct were each
modified by insertion of HA tags at the C terminus of Gag and deletion
of pol (see text). Parental and modified viruses were
produced in 293T cells, collected and subjected to anti-HIV-1 Gag
(lanes 1 and 2), anti-BIV Gag (lanes 3 and 4), or anti-HA (lanes 5 and
6) Western blotting. Lane 1, parental HIV-1 packaging construct. Most
of the Gag precursor polyprotein (PrGag) has been cleaved. Lane 2, modified HIV-1 packaging construct. The amount of uncleaved Gag
polyprotein is similar to the amount of capsid protein (CA) in the
parental virus preparation, indicating that the modifications did not
alter virus production substantially. Lane 3, parental BIV packaging
construct. Lane 4, modified BIV packaging construct. As with the case
of the HIV-1 packaging construct, the modification did not alter virus
production. Lane 5, modified HIV-1 packaging construct. Lane 6, modified BIV packaging construct, after normalization by RT assay of
the parental constructs. The amount of Gag precursor polyprotein is
similar to the amount in lane 5, indicating that the RT assay has
comparable sensitivity for BIV and HIV-1 virus and hence, that the
packaging constructs produce similar levels of virus.
|
|
Western blot analysis was also performed on the BH2 and HIV-1 virus
preparations to assess the efficiency of VSV-G incorporation.
Virus was
collected from 293T cells transfected with each packaging
construct and
the VSV-G construct, then normalized by RT assay
and subjected to
Western blot analysis using a MAb specific for
VSV-G. The amounts of
VSV-G detected in the BH2 and HIV-1 samples
were similar (data not
shown), indicating that BIV incorporated
VSV-G as efficiently as did
HIV-1.
BIV vectors.
Next, BIV-derived vectors were generated,
containing the eGFP marker gene and all viral elements required in
cis for transfer into target cells. A panel of vectors
was generated (Fig. 4), differing in
(i) the amount of gag and env sequences (BC
versus BC2 prefix), (ii) the internal promoter driving eGFP expression: CMV (constructs with a CG suffix) versus PGK (1)
(constructs with a PG suffix) versus MND (modified myeloid
proliferative sarcoma virus promoter [43]) (constructs
with an MG suffix); (iii) the placement of eGFP within the vector
(i.e., upstream or downstream of the putative BIV RRE) (BC2 versus BC3
prefix); and (iv) additional segments inserted downstream of the
putative BIV packaging signal (constructs with gag, ppt, and sar
suffixes). In addition, two vectors contained a modified 3' LTR in
which a large portion of U3 (including the TATA box) was replaced by a
small SV40 segment containing the late polyadenlyation signal USE
(45) (BC3 versus BC4 prefix).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
BIV vectors and transduction efficiencies. All vectors
contain the CMV immediate-early promoter, ending in the TATA box,
linked to the BIV 5' LTR starting immediately after the TATA box. BIV
sequences terminate at the gag start codon (BCCG and BCPG)
or approximately 510bp into the gag coding region (all
others). All vectors contain the eGFP cDNA linked to a heterologous,
"internal" promoter: CMV, PGK, or MND (see text). Some vectors
contain one or more insertions between the BIV 5' segment and the
internal promoter: these insertions include a potential BIV cPPT, the
3' segment of the gag gene, the beta interferon SAR, and the
putative BIV RRE. Downstream of the eGFP cDNA lies the BIV 3' LTR and
approximately 130 bp (BCCG and BCPG), 1.2 kb (BC2CG, BC2PG, and BC2MG)
or 80 bp (all others) of adjacent env sequences. Two vectors
(BC4MG and BC4MGppt) contain modified 3' LTRs in which most of the 3'
LTR U3 region has been replaced by the SV40 late polyadenylation signal
enhancer element (SINSV). Transcription start sites and directions are
indicated with arrows. At the bottom are depicted two HIV-1 control
vectors used in this study. At the right are the transduction
efficiencies of the vectors in 293T cells 3 days postinfection, using
packaging construct BH2 and VSV-G, in a series of experiments.
Infections from experiments 3 to 5 were performed in the presence of an
additional buffer to retard pH elevation during spinoculation. As a
result, transduction efficiencies were elevated.
|
|
First, the two vectors (BCCG and BCPG) containing the full leader, but
no
gag sequences, and minimal
env sequences
(i.e.,
no RRE) were compared to the analogous vectors (BC2CG and BC2PG)
containing approximately 500 bp of
gag sequences and 1.2 kb
of
env sequences (including the putative RRE). The latter
vectors
were generated because previous studies with other retroviruses
have indicated that the 5' end of the
gag gene increases the
extent
of vector RNA encapsidation in the virus particles, either by
containing packaging elements or by stabilizing packaging elements
further upstream (
3,
6,
41). In addition, studies with
HIV-1 have indicated that the
gag gene contains sequences
which
block RNA export from the nucleus and that the RRE removes this
block in the presence of the rev protein (
31,
46). The two
vectors containing the PGK internal promoter were analyzed for
transduction in 293T cells, using the BH2 packaging construct
pseudotyped with VSV-G: BC2PG transduced 5% of the cells, while
BCPG
transduced none of the cells (Fig.
4, experiment 1). All
four vectors
were then assessed for cytoplasmic RNA expression
in transfected 293T
cells and in collected BH2 virions by Northern
blot analysis. Each of
the vectors produced high levels of full-length
vector RNA in the
transfected cell cytoplasm, but only the BC2CG
and BC2PG full-length
RNAs were encapsidated efficiently by the
BH2 virions (Fig.
5). Therefore, the 5' end of the BIV
gag gene
is likely to contain sequences directly or
indirectly required
for viral RNA encapsidation. Interestingly, without
those sequences
on the BCPG and BCCG full-length RNAs, subgenomic
vector mRNAs
(presumably internally initiated, based on expected
mobility)
were encapsidated, suggesting that other packaging elements
reside
in the 3' portion of the BIV genome (
4).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
Northern analysis of BIV RNA in transfected 293T cells
(left) and in virus particles shed from the transfected cells (right).
Cytoplasmic RNA was probed with BIV sequences at the 3' end of the
genome, to detect all packaging construct and vector RNAs. Viral RNA
was probed with eGFP sequences, to detect full-length vector RNA and
RNA initiating at the internal promoter. Lane 1, vector BC2PG; lanes 2 and 7, packaging construct BH2; lanes 3 and 8, BH2 and BC2PG; lanes 4 and 9, BH2 and BC2CG; lanes 5 and 10, BH2 and BCPG; lanes 6 and 11, BH2
and BCCG. The positions of certain RNAs are indicated: gag, the
gag mRNA encoded by BH2; BC2F, full-length BC2PG and BC2CG
vector mRNA; BC2I, internally initiated BC2PG and BC2CG vector mRNA;
BCF, full-length BCPG and BCCG vector RNA; BCI, internally initiated
BCPG and BCCG vector mRNA; BC2S, spliced BC2PG and BC2CG vector mRNA.
Note that this last RNA is only present in the BC2 vectors, since the
rev splice acceptor is present in the BC2 vectors but not
the BC vectors.
|
|
Next, the PGK promoter was compared to the MND promoter in two
contexts, i.e., with the promoter-eGFP cassette upstream (BC2PG
and
BC2MG) or downstream (BC3PG and BC3MG) of the putative BIV
RRE. In 293T
cells, the latter context produced slightly higher
transduction
efficiencies than the former (14 versus 6% for the
PGK vectors and 35 versus 29% for the MND vectors), and in both
contexts the MND promoter
performed better than the PGK promoter
(Fig.
4, experiment 2). However,
all vectors transduced substantially
fewer cells than did an HIV-1
virus containing an analogous PGK-eGFP
vector (75%
transduction).
Virus containing the optimal vector, BC3MG, was then produced and
analyzed for its ability to be concentrated by centrifugation,
for its
ability to transduce a lymphoid cell line, and for the
change in the
frequency of eGFP expression over 2 weeks postinfection
(Fig.
6). A portion of the virions were
collected by centrifugation,
suspended in a volume 100-fold lower than
the original volume,
and then diluted either 10-fold (to generate
"10×" virus) or 100-fold
("1×" virus). Although the 1× virus
exhibited low transduction
efficiencies, the T-lymphoid cell line CEMSS
was transduced more
efficiently (12%) than the 293T cells (5%). In
addition, the 10×
virus transduced a 10-fold-higher percentage of 293T
cells and
a 4.5-fold-higher percentage of CEM cells. Moreover, the
percentage
of eGFP
+ cells decreased approximately fivefold
over 2 weeks in the 293T
line and to a much lesser extent in the CEMSS
line. Subsequent
infections with new, unconcentrated virus preparations
indicated
that the fold reduction in the percentage of
eGFP
+ 293T cells over time correlated inversely with the
initial percentage
of eGFP
+ cells. For example, 293T cells
which were 73% eGFP
+ 2 days postinfection were found to be
43% eGFP
+ 2 weeks postinfection and 28% eGFP
+
4 weeks postinfection (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of virus concentration and the duration of
transgene expression in transduced human cell lines. A BIV preparation
consisting of packaging construct BH2, VSV-G, and vector BC3MG was
collected by centrifugation, then suspended in the original volume (1×
virus) or in a 10-fold-lower volume (10× virus) and exposed to fresh
293T or CEMSS cells. eGFP expression was measured at 3 and 16 days
postinfection by flow cytometry; the percentage of transduced cells is
indicated in each histogram.
|
|
The higher transduction efficiencies exhibited by the BC3 vectors
relative to the BC2 vectors might have been due to an increased
stability of the packaging signal, due to its positioning farther
away
from non-viral sequences, i.e., the internal promoter
(
24).
Additional viral segments were therefore inserted
immediately
downstream of the
gag region in vector BC3MG,
including an approximately
500-bp segment of the
pol gene,
containing polypurine tracts that
might function in an analogous manner
to the cPPT region of HIV-1
(
11,
12). In addition, the 3'
portion (approximately 1 kb)
of the
gag gene was inserted:
this vector (BC3MGgag) contains
the entire
gag gene except
for approximately 200 bp in the capsid
domain. The two new vectors were
found to transduce slightly higher
frequencies of 293T cells (70 and
73%) than the parental vector
BC3MG (55%) when used with BH2 and
VSV-G (Fig.
4, experiment 3).
For comparison, an HIV-1 strain
containing an MND-eGFP vector
transduced 100% of the
cells.
The beta interferon SAR, which has been shown to potentiate vector
expression from integrated proviral DNA (
2), was also
inserted immediately downstream of the packaging signal. This
vector,
BC3MGsar, transduced a slightly higher frequency of 293T
cells than did
the BC3MGppt vector (71 versus 60% [Fig.
4, experiment
4]). In
addition, vectors containing pairwise combinations of
the SAR segment,
the 3'
gag segment, and the cPPT segment were
generated;
however, none of these vectors exhibited higher transduction
efficiencies than the vectors containing the individual segments
alone
(Fig.
4, experiment
4).
The BC3MG and BC3MGppt vectors were then compared to their SIN
counterparts, BC4MG and BC4MGppt. These SIN vectors had deletions
in
the interior 322 bp of the U3 region of the 3' LTR, retaining
55 bp at
the 5' end and 7 bp at the 3' end; as a result, the TATA
box and most
of the promoter elements were removed. Vectors with
deletions in this
area are termed self-inactivating, or SIN, because
the integrated
vector in the target cell possesses a 5' LTR incapable
of directing
transcription (
34,
52). This effect not only
increases the
safety of the vector, but in cases where transcription
from the 5' LTR
interferes with transcription from the vector's
internal promoter, the
SIN deletion may also increase transgene
expression in the transduced
cell. It has also previously been
reported that read-through
transcription occurs from an integrated
HIV-1 provirus
(
15), suggesting that HIV-1 transcripts do not
always
terminate at the 3' LTR. Since this phenomenon might also
occur in the
BIV vectors and might decrease the titer of the gene
transfer system
(
10), the SV40 late polyadenylation signal USE
(
45) was inserted into the gap created by the SIN
deletion.
The two new vectors (BC4MG and BC4MGppt) were analyzed for
transduction
efficiency with packaging construct BH2 and VSV-G: BC4MG
transduced
68% of the 293T cells, while BC4MGppt transduced 90%
(Fig.
4,
experiment 5). However, since the parental, non-SIN
vectors exhibited
similar transduction efficiencies (68 and 84%,
respectively),
the SIN deletion and SV40 USE insertion did not
substantially
increase the titer of the BIV gene transfer
system.
To determine the titer of the BIV viruses with precision, the
eGFP cDNA was removed from vectors BC3MG and BC3MGsar and
replaced
with the puromycin
N-acetyltransferase cDNA
(
49), generating
vectors BC3MP and BC3MPsar. The same was
done for the HIV-1 vector
containing the MND-eGFP cassette. The three
viruses were prepared
in 293T cells, and serial dilutions were exposed
to fresh 293T
cells; after 2 days, the cells were treated with
puromycin to
kill the nontransduced cells. After a week in culture, the
number
of colonies growing in the dishes was determined and used to
calculate
the titer of the original viruses. The HIV titer was 1.2 × 10
7 per ml, the BC3MP titer was 3 × 10
5 per ml, and the BC3MPsar titer was 4.5 × 10
5 per ml, nearly 30-fold lower than the HIV
titer.
Transduction of other cell lines and nondividing cells.
Concentrated BIV, prepared in 293T cells using packaging construct BH2,
vector BC3MG, and VSV-G, was used to transduce a panel of cell lines:
D-17, a dog osteosarcoma line; A-10, a rat smooth muscle cell line;
HUVEC, a human endothelial cell line; and MN9D, a mouse neuronal cell
line. In each of these cell lines, the BIV preparation transduced a
large percentage (63 to 88%) of the cells, even 2 weeks postinfection
(Fig. 7). In addition, primary rat endothelial cells were transduced by BIV, albeit not as efficiently as
the immortalized lines (22%).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
BIV can transduce a variety of cell lines and primary
cells. A 1× (D-17 cells) or 10× (all others) BIV preparation
consisting of packaging construct BH2, VSV-G, and vector BC3MG was
exposed to the indicated cell lines or primary cells (see text for
details on each cell type). Two weeks later, the cells were analyzed
for eGFP expression by flow cytometry; the percentage of transduced
cells is indicated in each histogram. For comparison, the HIVPG
histograms indicate the cells exposed to an unconcentrated HIV-1
preparation consisting of a packaging construct, VSV-G, and a vector
containing the PGK internal promoter.
|
|
To assess the ability of BIV to transduce nondividing cells, the
concentrated BIV (10×) was assayed for transduction of irradiated
HUVEC and resting human peripheral blood lymphocytes (PBLs). The
HUVEC
line was irradiated 2 days before exposure to BIV, to synchronize
the
cells at the G
2/M phase of the cell cycle. As expected, an
MLV preparation was observed to readily transduce the untreated
cells
but not the irradiated cells (Fig.
8). In
contrast, both
BIV and HIV-1 transduced the untreated and irradiated
cells with
similar efficiencies, indicating that each lentivirus was
able
to transduce the nondividing cells efficiently.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 8.
BIV can transduce nondividing cells. A 10× BIV virus
preparation consisting of packaging construct BH2, VSV-G, and vector
BC3MG was exposed to HUVEC 2 days after the cells were irradiated to
abrograte cell division (right column) or to nonirradiated HUVEC (left
column). Two days later, the cells were analyzed for eGFP expression by
flow cytometry; the percentage of transduced cells is indicated in the
histogram (right column). For comparison, the HIVCG histograms indicate
cells exposed to an unconcentrated HIV-1 preparation consisting of a
packaging construct, VSV-G, and a vector containing the CMV internal
promoter. In addition, the MLV histograms indicate cells exposed to an
MLV preparation consisting of a packaging construct, VSV-G, and an
LTR-driven eGFP vector.
|
|
In unstimulated human PBLs, BIV exhibited transduction efficiencies
similar to those of HIV-1 when the cells were assayed
4 days after
infection, although most of the BIV-transduced cells
expressed very low
levels of eGFP (Fig.
9). Two weeks
postinfection,
however, these dim cells were nearly absent from the
population.
As a result, the percentage of transduced cells was low:
1% for
the 10× virus and 6% for the 40× virus. However, the virus
also
exhibited low transduction efficiencies in preactivated (i.e.,
proliferating) PBLs, as the 10× virus transduced only 5% of the
cells
(data not shown). In contrast, 10× HIV-1 transduced 81%
of the
preactivated cells and 44% of the unstimulated cells, while
10× MLV
transduced 43% of the preactivated cells but only 1% of
the
unstimulated cells.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 9.
BIV can transduce resting human lymphocytes.
Unstimulated human PBLs were infected with 10× and 40× BIV consisting
of packaging construct BH2, VSV-G, and vector BC3MG. After infection,
the cells were activated and cultured for 4 days (left column) or 2 weeks (right column) in the presence of antibodies specific for CD3 and
CD28, after which a portion of the cells were analyzed for eGFP
expression by flow cytometry. The percentage of transduced cells is
indicated in each histogram. For comparison, the cells were infected
with the 10× HIV-1 PGK preparation.
|
|
Finally, the concentrated BIV was used to transduce unstimulated
mobilized peripheral CD34
+ HSCs, most of which are
quiescent (
25,
48). The 10× BIV preparation
transduced
19% of the HSCs 3 days postinfection, while the 40×
BIV virus
transduced 31% of the cells (Fig.
10).
Interestingly,
almost all of the cells transduced with the 10× BIV
virus expressed
high levels of eGFP, and these cells did not disappear
when the
cells were analyzed 11 days later. The cells infected with the
40× BIV virus contained two eGFP
+ populations: one (18%
of the cells) which expressed very low
levels of eGFP and one (13% of
the cells) which expressed higher
levels of eGFP. Both populations
exhibited sixfold reductions
in frequency over the next 11 days.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 10.
BIV can transduce resting HSCs Unstimulated human HSCs
were infected with 10x and 40x BIV consisting of packaging construct
BH2, VSV-G, and vector BC3MG. After infection, the cells were activated
and cultured for 3 days (left column) or 2 weeks (right column) in the
presence of tpo mimetic, flt3 ligand, and c-kit ligand, after which a
portion of the cells were analyzed for eGFP expression by flow
cytometry. The percentage of transduced cells is indicated in each
histogram. For comparison, the cells were infected with the 10× HIV-1
PGK preparation.
|
|
 |
DISCUSSION |
In this study, we have demonstrated that gene transfer systems
derived from BIV can transduce a variety of cell types from a variety
of organisms in vitro. Transduction was observed in cell lines and
primary cells, including resting human HSCs, as well as irradiated,
nondividing human endothelial cells. In several cell types,
transduction efficiencies approached those of an HIV-1 gene transfer
system (14), and in most cell types, transgene expression
was stable for at least 2 weeks. In addition, the titer of
VSV-G-pseudotyped BIV preparations could be increased by centrifugation of the virus. One of the unconcentrated VSV-G-pseudotyped BIV preparations possessed a titer of approximately 5 × 105 infectious units (IU) per ml in the human kidney
epithelial cell line 293T. With virus concentration, the titer could be
raised much higher.
With these results, BIV is the third nonprimate lentivirus to be
reported to efficiently transduce nondividing cells in vitro. VSV-G-pseudotyped gene transfer preparations derived from feline immunodeficiency virus were observed to transduce
G1/S-arrested human and nonhuman cell lines, as well as
postmitotic human monocyte-derived macrophages and neurons; viral
concentration yielded titers (in growing HeLa cells) of 1.8 × 107 IU/ml (42). VSV-G-pseudotyped gene
transfer preparations derived from equine infectious anemia virus were
observed to transduce G1/S-arrested human (40)
and canine cell lines, as well as postmitotic primary rat neurons, with
titers in the canine cells as high as 5 × 106 IU/ml
(33). In contrast, VSV-G-pseudotyped gene transfer
preparations derived from visna virus transduce human and sheep cells
poorly, due to blocks in reverse transcription and integration
(4a).
Although the VSV-G-pseudotyped BIV gene transfer preparations
transduced all of the human cells tested, the relative transduction efficiencies varied greatly. The epithelial cell line 293T, the T
lymphoid cell line CEMSS and the endothelial cell line HUVEC were all
transduced efficiently, although the percentage of eGFP+
cells declined over time in the 293T cells. In addition, although CEMSS
cells were efficiently transduced, the same was not true for primary
lymphocytes: BIV preparations transduced 16-fold fewer proliferating
PBLs and 29 to 44-fold fewer unstimulated PBLs than did an HIV-1
preparation. This relative inefficiency is not surprising, in light of
the BIV's lack of tropism for lymphocytes in vitro and in vivo
(19). In contrast, BIV transduced HSCs moderately well, as
a BIV preparation transduced only 2.5-fold fewer unstimulated HSCs than
did the HIV-1 preparation.
In unstimulated human PBLs and unstimulated human HSCs, BIV transduced
a portion of the cells in such a way as to express very low levels of
eGFP, and only for a short duration (i.e., less than 2 weeks). One
possible explanation for this phenomenon is pseudotransduction: eGFP
protein expressed in the transfected cells is associated with the virus
particles and transferred to the target cells during infection and then
is diluted out of the cells as they divide. Pseudotransduction can
occur with other transgenes besides eGFP and has been observed for
VSV-G-pseudotyped MLV vectors (16, 28) and spleen necrosis
virus vectors (J. Douglas and S. Tamaki, unpublished data). Other
possible explanations for the transient eGFP phenomenon include eGFP
expression from unintegrated forms of the vector which are degraded
over time and transgene promoter inactivation occurring on integrated
forms of the vector.
The HSCs infected with the 40× BIV contained, in addition to the
population expressing very low levels of eGFP, a population which
expressed high levels of eGFP. Despite being exposed to more virions,
this population expressed slightly lower levels of eGFP per cell and
was less stable over 2 weeks than the cells transduced with the 10×
BIV. Since VSV-G protein is toxic to cells, it is possible that the
40× BIV contained levels of VSV-G that damaged the HSCs during infection.
The lower transduction efficiencies exhibited by BIV, relative to
HIV-1, could be due to deficiencies during infection. For example, BIV
RT or integrase might interact with human proteins less efficiently
than do the HIV-1 counterparts. However, it is also possible that the
BIV preparations contained fewer infectious virus particles than the
HIV-1 preparations. Although the two viruses' packaging constructs
were often found to produce comparable numbers of virus particles and
to incorporate VSV-G with comparable efficiency, the extent of virion
encapsidation of the full-length vector RNA and primer tRNA was not
analyzed thoroughly. Preliminary experiments indicate that HIV-1
preparations contain up to 3.5-fold more full-length vector RNA
than do BIV preparations (R. D. Berkowitz, unpublished
data). In any regard, the transduction efficiencies exhibited by BIV
should certainly rise as the titer of infectious virus is increased,
i.e. by increasing virus production or the efficiency of vector RNA
encapsidation. Such increases in titer should be particularly valuable
for cell types that require a high multiplicity of infection for
efficient transduction or high-level transgene expression.
In addition to increasing viral titer, future studies on BIV gene
transfer systems should evaluate the possibilities of potentially harmful side effects of such systems, i.e., generation of
replication-competent retrovirus and propagation by or recombination
with HIV virions during natural HIV infection. BIV does not infect
human cells, presumably due to a number of blocks including the lack of
a competent viral envelope, but nevertheless BIV-transduced cells must
be monitored closely with a sensitive replication-competent retrovirus detection assay. In addition, if an individual containing
BIV-transduced cells is infected with HIV, it is theoretically possible
that the HIV virions could spread the BIV vector to new cells and/or recombine with the vector. Although it is not known if such an event
would be harmful, the likelihood of the event could be measured by in
vitro cross-packaging (13a) and recombination studies.
 |
ACKNOWLEDGMENT |
CEMSS cells were obtained from the AIDS Reagent Program, Division
of AIDS, National Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Present address: Chemocentryx,
1539 Industrial Rd., San Carlos, CA 94070. Phone: (650) 632-2900. E-mail: rberkowitz{at}chemocentryx.com.
 |
REFERENCES |
| 1.
|
Adra, C. N.,
P. H. Boer, and M. W. McBurney.
1987.
Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter.
Gene
60:65-74[CrossRef][Medline].
|
| 2.
|
Agarwal, M.,
T. W. Austin,
F. Morel,
J. Chen,
E. Böhnlein, and I. Plavec.
1998.
Scaffold attachment region-mediated enhancement of retroviral vector expression in primary T cells.
J. Virol.
72:3720-3728[Abstract/Free Full Text].
|
| 3.
|
Bender, M. A.,
T. D. Palmer,
R. E. Gelinas, and A. D. Miller.
1987.
Evidence that the packaging signal of Moloney murine leukemia virus extends into the gag region.
J. Virol.
61:1639-1646[Abstract/Free Full Text].
|
| 4.
|
Berkowitz, R. D.,
J. Fisher, and S. P. Goff.
1996.
RNA packaging.
Curr. Top. Microbiol. Immunol.
214:177-218[Medline].
|
| 4a.
|
Berkowitz, R. D.,
H. Ilves,
I. Plavec, and G. Veres.
2001.
Gene transfer systems derived from Visna virus: analysis of virus production and infectivity.
Virology
279:116-129[CrossRef][Medline].
|
| 5.
|
Blomer, U.,
L. Naldini,
T. Kafri,
D. Trono,
I. M. Verma, and F. H. Gage.
1997.
Highly efficient and sustained gene transfer in adult neurons with a lentivirus vector.
J. Virol.
71:6641-6649[Abstract].
|
| 6.
|
Buchschacher, G. L., and A. T. Panganiban.
1992.
Human immunodeficiency virus vectors for inducible expression of foreign genes.
J. Virol.
66:2731-2739[Abstract/Free Full Text].
|
| 7.
|
Buchschacher, G. L., and F. Wong-Staal.
2000.
Development of lentiviral vectors for gene therapy for human disease.
Blood
95:2499-2504[Abstract/Free Full Text].
|
| 8.
|
Bukrinsky, M.,
N. Sharova,
M. P. Dempsey,
T. L. Stanwick,
A. G. Bukrinskaya,
S. Haggerty, and M. Stevenson.
1992.
Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.
Proc. Natl. Acad. Sci. USA
89:6580-6584[Abstract/Free Full Text].
|
| 9.
|
Burns, J. C.,
T. Friedmann,
W. Driever,
M. Burrascano, and J. K. Yee.
1993.
Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells.
Proc. Natl. Acad. Sci. USA
90:8033-8037[Abstract/Free Full Text].
|
| 10.
|
Carswell, S., and J. C. Alwine.
1989.
Efficiency of utilization of the simian virus 40 late polyadenylation site: effects of upstream sequences.
Mol. Cell. Biol.
9:4248-4258[Abstract/Free Full Text].
|
| 11.
|
Charneau, P.,
M. Alizon, and F. Clavel.
1992.
A second origin of DNA plus-strand synthesis is required for optimal human immunodeficiency virus replication.
J. Virol.
66:2814-2820[Abstract/Free Full Text].
|
| 12.
|
Charneau, P.,
R. G. Mirambeau,
P. S. Paulous,
H. Buc, and F. Clavel.
1994.
HIV-1 reverse transcription. A termination step at the center of the genome.
J. Mol. Biol.
241:651-662[CrossRef][Medline].
|
| 13.
|
Choi, H. K.,
L. A. Won,
P. J. Kontur,
D. N. Hammond,
A. P. Fox,
B. H. Wainer,
P. C. Hoffmann, and A. Heller.
1991.
Immortalization of embryonic mesencephalic dopaminergic neurons by somatic cell fusion.
Brain Res.
552:67-76[CrossRef][Medline].
|
| 13a.
|
Curran, M. A.,
S. M. Kaiser,
P. L. Achacoso, and G. P. Nolan.
2000.
Efficient transduction of non-dividing cells by optimised feline immunodeficiency virus vectors.
Mol. Ther.
1:31-38[CrossRef][Medline].
|
| 14.
| Douglas, J., W.-Y. Lin, M. Panis, and G. Veres. Efficient HIV-based vector transduction of unstimulated
human CD34+ cells in the SCID-hu Thy/Liv model of human T cell
lymphopoiesis. Gene Ther., in press.
|
| 15.
|
Dron, M.,
L. Hameau,
L. Benboudjema,
J. Guymarho,
C. Cajean-Feroldi,
P. Rizza,
C. Godard,
C. Jasmin,
M. G. Tovey, and M. C. Lang.
1999.
Cloning of a long HIV-1 readthrough transcript and detection of an increased level of early growth response protein-1 (Egr-1) mRNA in chronically infected U937 cells.
Arch. Virol.
144:19-28[CrossRef][Medline].
|
| 16.
|
Gallardo, H. F.,
C. Tan,
D. Ory, and M. Sadelain.
1997.
Recombinant retroviruses pseudotyped with the vesicular stomatitis virus G glycoprotein mediate both stable gene transfer and pseudotransduction in human peripheral blood lymphocytes.
Blood
90:952-957[Abstract/Free Full Text].
|
| 17.
|
Gallichan, W. S.,
T. Kafri,
T. Krahl,
I. M. Verma, and N. Sarvetnick.
1998.
Lentivirus-mediated transduction of islet grafts with interleukin 4 results in sustained gene.
Hum. Gene Ther.
10:2717-2726.
|
| 18.
|
Garvey, K. J.,
M. S. Oberste,
J. E. Elser,
M. J. Braun, and M. A. Gonda.
1990.
Nucleotide sequence and genome organization of biologically-active proviruses of the bovine immunodeficiency-like virus.
Virology
175:391-409[CrossRef][Medline].
|
| 19.
|
Gonda, M. A.,
D. G. Luther,
S. E. Fong, and G. J. Tobin.
1994.
Bovine immunodeficiency virus: molecular biology and virus-host interactions.
Virus Res.
32:155-181[CrossRef][Medline].
|
| 20.
|
Hoshi, H., and W. L. McKeehan.
1984.
Brain- and liver cell-derived factors are required for growth of human endothelial cells in serum-free culture.
Proc. Natl. Acad. Sci. USA
81:6413-6417[Abstract/Free Full Text].
|
| 21.
|
Jang, S. K.,
M. V. Davies,
R. J. Kaufman, and E. Wimmer.
1989.
Initiation of protein synthesis by internal entry of ribosomes into 5' nontranslated region of encephalomyocarditis virus RNA in vivo.
J. Virol.
63:1651-1660[Abstract/Free Full Text].
|
| 22.
|
Johnson, L. G.,
J. C. Olsen,
L. Naldini, and R. C. Boucher.
2000.
Pseudotyped human lentiviral vector-mediated gene transfer to airway epithelia in vivo.
Gene. Ther.
7:568-574[CrossRef][Medline].
|
| 23.
|
Kafri, T.,
U. Blomer,
D. A. Peterson,
F. H. Gage, and I. M. Verma.
1997.
Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors.
Nat. Genet.
17:314-317[Medline].
|
| 24.
|
Kaye, J. F.,
J. H. Richardson, and A. M. L. Lever.
1995.
cis-acting sequences involved in human immunodeficiency virus type 1 RNA packaging.
J. Virol.
69:6588-6592[Abstract].
|
| 25.
|
Knaan-Shanzer, F.,
D. Valerio, and V. W. van Beusechem.
1996.
Cell cycle state, response to hemopoietic growth factors and retroviral vector-mediated transduction of human hemopoietic stem cells.
Hum. Gene Ther.
3:323-333.
|
| 26.
|
Lewis, P.,
M. Hensel, and M. Emerman.
1992.
Human immunodeficiency virus infection of cells arrested in the cell cycle.
EMBO J.
11:3053-3058[Medline].
|
| 27.
|
Lewis, P. F., and M. Emerman.
1994.
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus.
J. Virol.
68:510-516[Abstract/Free Full Text].
|
| 28.
|
Liu, M. L.,
B. L. Winther, and M. A. Kay.
1996.
Pseudotransduction of hepatocytes by using concentrated pseudotyped vesicular stomatitis virus G glycoprotein (VSV-G)-Moloney murine leukemia virus-derived retrovirus vectors: comparison of VSV-G and amphotropic vectors for hepatic gene transfer.
J. Virol.
70:2497-2502[Abstract].
|
| 29.
|
Lower, R.,
J. Lower, and R. Kurth.
1996.
The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences.
Proc. Natl. Acad. Sci. USA
93:5177-5184[Abstract/Free Full Text].
|
| 30.
|
Malim, M. H.,
J. Hauber,
R. Fenrick, and B. R. Cullen.
1988.
Immunodeficiency virus rev trans-activator modulates the expression of the viral regulatory genes.
Nature
335:181-183[CrossRef][Medline].
|
| 31.
|
Malim, M. H.,
J. Hauber,
S. Y. Le,
J. V. Maizel, and B. R. Cullen.
1989.
The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA.
Nature
338:254-257[CrossRef][Medline].
|
| 32.
|
Mayer, J.,
M. Sauter,
A. Racz,
D. Scherer,
N. Mueller-Lantzsch, and E. Meese.
1999.
An almost-intact human endogenous retrovirus K on human chromosome 7.
Nat. Genet.
21:257-258[CrossRef][Medline].
|
| 33.
|
Mitrophanous, K.,
S. Yoon,
J. Rohll,
D. Patil,
F. Wilkes,
V. Kim,
S. Kingsman,
A. Kingsman, and N. Mazarakis.
1999.
Stable gene transfer to the nervous system using a non-primate lentiviral vector.
Gene. Ther.
6:1808-1818[CrossRef][Medline].
|
| 34.
|
Miyoshi, H.,
U. Blomer,
M. Takahashi,
F. H. Gage, and I. M. Verma.
1998.
Development of a self-inactivating lentivirus vector.
J. Virol.
72:8150-8157[Abstract/Free Full Text].
|
| 35.
|
Miyoshi, H.,
K. A. Smith,
D. E. Mosier,
I. M. Verma, and B. E. Torbett.
1999.
Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors.
Science
283:682-686[Abstract/Free Full Text].
|
| 36.
|
Miyoshi, H.,
M. Takahashi,
F. H. Gage, and I. M. Verma.
1997.
Stable and efficient gene transfer into the retina using an HIV-based lentiviral vector.
Proc. Natl. Acad. Sci. USA
94:10319-10323[Abstract/Free Full Text].
|
| 37.
|
Naldini, L.,
U. Blomer,
F. H. Gage,
D. Trono, and I. M. Verma.
1996.
Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector.
Proc. Natl. Acad. Sci. USA
93:11382-11388[Abstract/Free Full Text].
|
| 38.
|
Naldini, L.,
U. Blomer,
P. Gallay,
D. Ory,
R. Mulligan,
F. H. Gage,
I. M. Verma, and D. Trono.
1996.
In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector.
Science
272:263-267[Abstract].
|
| 39.
|
Oberste, M. S.,
J. C. Williamson,
J. D. Greenwood,
K. Nagashima,
T. D. Copeland, and M. A. Gonda.
1993.
Characterization of bovine immunodeficiency virus rev cDNAs and identification and subcellular localization of the rev protein.
J. Virol.
67:6395-6405[Abstract/Free Full Text].
|
| 40.
|
Olsen, J. C.
1998.
Gene transfer vectors derived from equine infectious anemia virus.
Gene Ther.
5:1481-1487[CrossRef][Medline].
|
| 41.
|
Parolin, C. P.,
T. Dorfman,
G. Palu,
H. Gottlinger, and J. Sodroski.
1994.
Analysis in human immunodeficiency virus type 1 vectors of cis-acting sequences that affect gene transfer into human lymphocytes.
J. Virol.
68:3888-3895[Abstract/Free Full Text].
|
| 42.
|
Poeschla, E.,
F. Wong-Staal, and D. Looney.
1998.
Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors.
Nat. Med.
4:354-357[CrossRef][Medline].
|
| 43.
|
Robbins, P. B.,
X. J. Yu,
D. M. Skelton,
K. A. Pepper,
R. M. Wasserman,
L. Zhu, and D. B. Kohn.
1997.
Increased probability of expression from modified retroviral vectors in embryonal stem cells and embryonal carcinoma cells.
J. Virol.
71:9466-9474[Abstract].
|
| 44.
|
Roe, T.,
T. C. Reynolds,
G. Yu, and P. O. Brown.
1993.
Integration of murine leukemia virus DNA depends on mitosis.
EMBO J.
12:2099-2108[Medline].
|
| 45.
|
Schek, N.,
C. Cooke, and J. C. Alwine.
1992.
Definition of the upstream efficiency element of the simian virus 40 late polyadenylation signal by using in vitro analyses.
Mol. Cell. Biol.
12:5386-5393[Abstract/Free Full Text].
|
| 46.
|
Schwartz, S.,
B. K. Felber, and G. N. Pavlakis.
1992.
Distinct RNA sequences in the gag region of human immunodeficiency virus type 1 decrease RNA stability and inhibit expression in the absence of Rev protein.
J. Virol.
66:150-159[Abstract/Free Full Text].
|
| 47.
|
Trono, D.
2000.
Lentiviral vectors: turning a deadly foe into a therapeutic agent.
Gene Ther.
7:20-23[CrossRef][Medline].
|
| 48.
|
Uchida, N.,
D. He,
A. Friera,
M. Reitsma,
D. Sasaki,
B. Chen, and A. Tsukamoto.
1997.
The unexpected G0/G1 cell cycle status of mobilized hematopoietic stem cells from peripheral blood.
Blood
89:465-472[Abstract/Free Full Text].
|
| 49.
|
Vara, J. A.,
A. Portela,
J. Ortin, and A. Jimenez.
1986.
Expression in mammalian cells of a gene from Streptomyces alboniger conferring puromycin resistance.
Nucleic Acids Res.
14:4617-4624[Abstract/Free Full Text].
|
| 50.
|
Wang, X.,
B. Appukuttan,
S. Ott,
I. R. Pate,
J. Irvine,
J. Song,
J. H. Park,
R. Smith, and J. T. Stout.
2000.
Efficient and sustained transgene expression in human corneal cells mediated by a lentiviral vector.
Gene Ther.
7:196-200[CrossRef][Medline].
|
| 51.
|
Yee, J. K.,
A. Miyanohara,
P. Laporte,
K. Bouic,
J. C. Burns, and T. Friedmann.
1994.
A general method for the generation of high-titer, pantropic retroviral vectors: highly efficient infection of primary hepatocytes.
Proc. Natl. Acad. Sci. USA
91:9564-9568[Abstract/Free Full Text].
|
| 52.
|
Zufferey, R.,
T. Dull,
R. J. Mandel,
A. Bukovsky,
D. Quiroz,
L. Naldini, and D. Trono.
1998.
Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery.
J. Virol.
72:9873-9880[Abstract/Free Full Text].
|
Journal of Virology, April 2001, p. 3371-3382, Vol. 75, No. 7
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.7.3371-3382.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bjarnadottir, H., Gudmundsson, B., Gudnason, J., Jonsson, J. J.
(2006). Encapsidation Determinants Located Downstream of the Major Splice Donor in the Maedi-Visna Virus Leader Region. J. Virol.
80: 11743-11755
[Abstract]
[Full Text]
-
Kang, Y., Stein, C. S., Heth, J. A., Sinn, P. L., Penisten, A. K., Staber, P. D., Ratliff, K. L., Shen, H., Barker, C. K., Martins, I., Sharkey, C. M., Sanders, D. A., McCray, P. B. Jr., Davidson, B. L.
(2002). In Vivo Gene Transfer Using a Nonprimate Lentiviral Vector Pseudotyped with Ross River Virus Glycoproteins. J. Virol.
76: 9378-9388
[Abstract]
[Full Text]
-
O'Rourke, J. P., Newbound, G. C., Kohn, D. B., Olsen, J. C., Bunnell, B. A.
(2002). Comparison of Gene Transfer Efficiencies and Gene Expression Levels Achieved with Equine Infectious Anemia Virus- and Human Immunodeficiency Virus Type 1-Derived Lentivirus Vectors. J. Virol.
76: 1510-1515
[Abstract]
[Full Text]