Previous Article | Next Article 
Journal of Virology, April 2001, p. 3277-3290, Vol. 75, No. 7
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.7.3277-3290.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Epitope Mapping Porcine Reproductive and Respiratory Syndrome
Virus by Phage Display: the nsp2 Fragment of the Replicase Polyprotein
Contains a Cluster of B-Cell Epitopes
M. B.
Oleksiewicz,*
A.
Bøtner,
P.
Toft,
P.
Normann, and
T.
Storgaard
Danish Veterinary Institute for Virus
Research, Lindholm, 4771 Kalvehave, Denmark
Received 12 September 2000/Accepted 19 December 2000
 |
ABSTRACT |
We screened phage display libraries of porcine reproductive and
respiratory syndrome virus (PRRSV) protein fragments with sera
from experimentally infected pigs to identify linear B-cell epitopes that are commonly recognized during infection in vivo. We
identified 10 linear epitope sites (ES) 11 to 53 amino acids in
length. In the replicase polyprotein, a total of eight ES were identified, six of which localized to the Nsp2 replicase
polyprotein processing end product. In the structural proteins,
a total of two ES were identified, in the ORF3 and ORF4 minor envelope
glycoproteins. The ORF4 ES was previously identified by
monoclonal antibody mapping (J. J. M. Meulenberg, A. P. van Nieuwstadt, A. van Essen-Zandenbergen, and J. P. M. Langeveld, J. Virol. 71:6061-6067, 1997), but its immunogenicity
had not been examined in pigs. We found that six experimentally
PRRSV-infected pigs consistently had very high antibody titers against
the ORF4 ES. In some animals, sera diluted 1:62,500 still gave weak
positive enzyme immunoassay reactivity against the ORF4 ES. This
hitherto unrecognized immunodominance likely caused phages displaying
the ORF4 ES to outcompete phages displaying other ES during library
screening with porcine sera and accounted for our failure to identify
more than two ES in the structural genes of PRRSV. Genetic analysis
showed that variable ES were also the most immunogenic in vivo.
Serological analysis indicated differences in the immunoglobulin A
responses between short-term and longer-term viremic pigs towards
some ES. The implications of these findings for PRRSV diagnostics and
immunopathogenesis are discussed.
 |
INTRODUCTION |
Porcine reproductive and
respiratory syndrome virus (PRRSV) is a recently emerged pathogen
of domesticated swine. The virus, which belongs to the
Arteriviridae family, has a 15-kb positive-sense, single-stranded RNA genome. PRRSV encodes an approximately
4,000-amino-acid large replicase polyprotein (open reading
frame [ORF] 1a and 1b) and six structural proteins of 130 to 265 amino acids (ORFs 2 to 7) (reviewed in references 6, 36, and
45). The replicase polyprotein is processed by
autoproteolytic cleavage into nonstructural protein fragments (Nsps).
The replicase polyprotein processing cascade has recently been
reviewed by Ziebuhr et al. (45), and the Nsp and protease
domain nomenclature suggested by Ziebuhr et al. is used throughout
this article. Two main PRRSV genotypes exist, the American (US) and
European (EU) types, which are only approximately 60% identical at the
nucleotide level. For reasons currently not understood, these two
distantly related PRRSV types emerged virtually simultaneously on their
respective continents in the late 1980s. Since then, intermingling of
the genotypes has occurred through the use of a live, US-type PRRSV
vaccine in Europe (2, 18).
PRRSV infection poses a challenge to current serodiagnostic and
vaccination strategies. Although live PRRSV vaccines provide protection
against homologous challenge, the genetic diversity of field PRRSV
isolates is very high, and vaccine effect against heterologous
challenge may be limited (39). Also, live PRRSV vaccines
have been observed to revert to virulence (2, 38), and the
safer, killed vaccines have so far proved less effective (28). Finally, PRRSV can persist in some animals despite
high levels of antiviral antibodies; in boars, this is associated with long-term, intermittent seminal excretion of the virus (3, 13). Serological tests cannot discriminate between seropositive animals which have cleared PRRSV infection and carrier animals. Addressing these problems might involve improving the design of antigens for vaccines and diagnostic tests. For example, PRRSV envelope
glycoproteins are candidates for use in subunit vaccines (11), and the nonstructural ORF 1 polyprotein
could be a possible candidate antigen for the development of
serological tests to identify carrier animals (24).
Production of full-length recombinant proteins to explore such
potential applications may be hampered by the presence of hydrophobic
regions and, for the ORF 1 polyprotein, a very large size and
the ability to undergo autoproteolytic cleavage. This could be overcome
by expression of protein subunits, guided by prior knowledge of
naturally antigenic regions. However, no knowledge currently exists
about epitopes in the PRRSV ORF 1 nonstructural polyprotein, and only two epitopes have been mapped in the
envelope glycoproteins (23, 30), one of which
was mapped using monoclonal antibodies (MAbs) and thus is of unknown
significance for PRRSV infection in vivo (23). To address
these questions, we have in the present study screened 97% of the
PRRSV protein mass for linear porcine B-cell epitopes using phage display.
 |
MATERIALS AND METHODS |
Construction of phage libraries of random PRRSV fragments.
Routine M13 methods, such as phage amplification in liquid cultures of
F' Escherichia coli, purification of phages from E. coli culture supernatants by polyethylene glycol (PEG)-NaCl
precipitation, titration of phages, and preparation of phage DNA for
sequencing were done as described in reference 35 and the
Ph.D-7 phage display kit manual from New England Biolabs (Hitchin,
Hertfordshire, U.K.).
PRRSV 111/92, a Danish European-type isolate (1), was used
for library construction. Long reverse transcription (RT)-PCR was
performed using the primers detailed in Table
1 and previously described protocols
(27). The three PCR fragments described in Table 1 were
cloned in the pCR-XL TOPO vector (Invitrogen, Groningen, The
Netherlands). To prepare random PRRSV fragments, 6 µg of pCR-XL
construct was digested at 15°C in 95-µl reactions containing 100 µg of bovine serum albumin per ml-50 mM Tris (pH 7.6)-1 mM
MnCl2-0.3 U of DNase I (Pharmacia, Allerød, Denmark). DNase digestion times were adjusted to produce fragments with an
average of 70 to 100 nucleotides (nt), estimated by agarose gel
electrophoresis. The random fragments were blunt-ended with T4 DNA
polymerase (Novagen, Madison, Wis.), and size fractionated on Chroma
Spin 30 gel filtration columns (Clontech, Basingstoke, Hampshire,
U.K.).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
RT-PCR primers used to amplify three fragments of the
PRRSV 111/92 genome for the manufacture of ORF 1, ORF 2-3, and
ORF 4-7 phage display librariesa
|
|
To prepare M13 vector, 1 µg of M13KE gIII replicative-form DNA (New
England Biolabs) was digested with 15 U Eag-I (New England
Biolabs) for
5 h at 37°C in a 20-µl reaction, blunt ended with
Klenow DNA
polymerase (New England Biolabs), and dephosphorylated
with calf
intestinal phosphatase
(Pharmacia).
Approximately 10 to 100 ng of random PRRSV fragments were ligated
overnight at 16°C to 100 ng of M13 vector in 20-µl reactions
containing 400 U of T4 DNA ligase (New England Biolabs). Following
chloroform extraction, ethanol precipitation, and a 70% ethanol
wash,
ligation reactions were used to electroporate 80 µl of TOP10F'
E. coli (Invitrogen) in a single 0.1-cm cuvette (Bio-Rad,
Hemel
Hempstead, Hertfordshire, U.K.). Electroporated bacteria were
incubated in 500 µl of SOC medium for 20 min at 37°C and 250 rpm,
added to 100 ml of a 100-fold-diluted overnight culture of TOP10F'
E. coli in Luria-Bertani (LB) medium, and grown at 250 rpm
and
37°C for 5 h. M13 phages were prepared from culture
supernatants
by two rounds of PEG-NaCl precipitation. Phage pellets
were resuspended
in 400 µl of 44% glycerol in phosphate-buffered
saline (PBS, pH
7.6), and stored at

20°C.
To characterize libraries, PCR was done across the
EagI site
with primers 5'GTGGTACCTTTCTATTCTCAC3' and
5'GACGTTAGTAAATGAATTTTCTG3',
which produced a 70-nt band
from phages without the insert. In
initial experiments, libraries were
characterized in terms of
frequencies of insert-bearing phage as well
as insert sizes by
PCR performed on 10 to 20 individual plaques. In a
later approach,
a sample of 10
6 phages taken from a library
were used as the template for a single
PCR. When run on 3% agarose
gels, such whole-library PCRs produced
a discrete 70-nt band from
phages without inserts and a >70-nt
smear from phages with inserts of
different sizes. The intensity
and size distribution of the >70-nt
smear, judged by eye from
Polaroid photographs, proved an excellent
indicator of library
quality.
Typically, three to six ligation reactions with different insert-vector
ratios were set up for each preparation of random
PRRSV fragments, and
the phage library containing the highest
proportion of insert-bearing
phages was used for selection (see
below). Thus, altogether, three
different phage libraries based
on the cloned PCR fragments described
in Table
1 were constructed:
an ORF 1 (nonstructural protein) library,
an ORF 2-3 (structural
proteins) library, and an ORF 4-7 (structural
proteins) library.
From 40 to 60% of the phages in these libraries
contained
inserts.
Experimental infections and characterization of PRRSV-immune
sera.
Six specific-pathogen-free pigs, 4 weeks of age, were
intranasally inoculated with 105.4 50% tissue
culture-infective doses (TCID50) of PRRSV 111/92, the same
Danish European-type isolate used for phage library construction. Serum
samples were prepared prior to infection (0 days postinfection [dpi])
and at 3- to 7-day intervals thereafter for up to 56 days. The pigs
were euthanized at 42 dpi (pigs 9 and 10) or 56 dpi (pigs 11, 12, 13, and 14), at which time tonsil homogenates, lung homogenates, and lung
washings were tested for PRRSV by RT-PCR (29).
In-house routine diagnostic assays were used to characterize the serum
samples. Antibodies to PRRSV were detected by blocking
enzyme-linked
immunosorbent assay (ELISA) as well as immunoperoxidase
monolayer assay
(
1,
38). Viremia was detected by culturing
serum samples
on primary cultures of porcine pulmonary alveolar
macrophages
(
1). Neutralizing antibodies were determined by
mixing 100 TCID
50 of PRRSV 111/92 with serial dilutions of
heat-inactivated
test serum, followed by inoculation on MARC-145 cells
(
15),
essentially as described (
43).
Selection of phage libraries with porcine sera and
characterization of selected phages by sequencing.
Serum to be
used for selection of phage libraries was filtered (0.45-µm pore
size), sodium azide was added to 0.02%, and UV-inactivated M13KO7
helper phage (New England Biolabs) was added to 1012
particles/ml. Sera were stored at 4°C. Prior to being used in the
selection described below, protein A- and G-Sepharose particles (Pharmacia) were blocked for 30 min at room temperature (or 4°C overnight) in bovine serum albumin (BSA) (100 mg/m). The selection protocol below was modified from the PhD-7 kit manual (New England Biolabs). First, to remove nonspecifically binding phage, 10 µl of
phage library (typically 1011 PFU) was added to 190 µl of
PBS-0.5% Tween 20-20% protein A-Sepharose in a
polypropylene tube and incubated for 20 min at room temperature with
vigorous shaking. The Sepharose particles were centrifuged for 20 s in a tabletop microcentrifuge and discarded. The supernatant was
transferred to a new polypropylene tube, 0.25 to 2 µl of whole serum
was added, and the phage-serum mix was incubated for 20 min at room
temperature with shaking. To isolate antibody-bound phages, protein
A-Sepharose was added to 20%, and the tubes were incubated for a
further 15 min at room temperature with shaking. The Sepharose
particles were washed 15 times with 1 ml of PBS-0.5% Tween 20 and
once with 1 ml of PBS without detergent. During washing, the Sepharose
suspensions were twice transferred to new polypropylene tubes to reduce
the background of nonspecifically binding or adsorbing phage. Finally,
phages were eluted through a 7-min incubation of the Sepharose in 1 ml
of 200 mM glycine-1 mg of BSA per ml (pH 2.2). The Sepharose
particles were centrifuged for 60 s in a table-top microcentrifuge and
discarded. The eluate was neutralized by adding 150 µl 1 M Tris (pH
9.1) and stored at 4°C. At this stage, the phage content of the
eluate (the output from the selection) and of the phage library (the
input to the selection) were determined by titration on E. coli ER2537 (New England Biolabs). Eluates were amplified in 30 ml
of 100-fold-diluted overnight culture of E. coli ER2537 in
LB medium. Eluates thus amplified were subjected to further cycles of
selection with porcine sera, as described above. Typically, a total of
three or four cycles of selection and amplification were carried out.
To reduce the occurrence of background phage, protein A and protein
G-Sepharose particles were used alternately in successive selection cycles.
For sequencing, plaques were amplified in 1 ml of 100-fold-diluted
overnight culture of
E. coli ER2537 in LB medium for 5
h at 37°C and 250 rpm. Only plaques from nonamplified eluates
were
used to reduce bias caused by differences in replication
of phages
displaying inserts of different sizes. Cycle sequencing
was done using
the BigDye kit (PE Biosystems, Allerød, Denmark),
and a reverse
sequencing primer (5' GAC GTT AGT AAA TGA ATT TTC
TG 3'),
which anneals 30 nt downstream from the M13KE gIII
EagI
site.
The sequences of the phage-displayed peptides were read using the
SeqMan-II software (DNASTAR Inc.) and matched to PRRSV using
the dot
plot function of the Omiga software (Oxford Molecular
Ltd., Oxford,
U.K.). Inserts displayed by phages selected from
the ORF 2-3 and
ORF 4-7 structural protein libraries were matched
to the ORF
2-7 sequence of the 111/92 PRRSV isolate, which was
used for
library construction and experimental infection (GenBank
accession no.
AJ223078). Inserts displayed by phages selected
from the ORF 1 (nonstructural protein) library were matched to
the ORF 1 sequence of
the Lelystad PRRSV isolate (GenBank accession
no.
M96262), since ORF 1 of 111/92 has not yet been
sequenced.
Phage ELISA.
Phages for ELISA were plaque purified and
underwent two rounds of PEG-NaCl precipitation. The particle content of
phage preparations was determined spectrophotometrically by measurement
of the absorbance at 269 nm (5). A total of 4 × 1010 phage particles in 100 µl of PBS were added per well
to Maxisorp U-96 ELISA plates (Nunc, Life Technologies, Tåstrup,
Denmark) and incubated at 4°C overnight. Prior to addition of the
antibody layers, plates were blocked for 1 h at room temperature
with 10% dried skimmed milk in PBS (Blotto). In the following,
reagents were used at 100 µl/well, incubations, unless otherwise
stated, were for 1 h at room temperature (with shaking), and
washes between antibody layers were done with 0.5 M NaCl-15 mM
Na2HPO4-2 mM
KH2PO4-0.05% Tween 20 (ELISA buffer).
The plates were first incubated with swine serum diluted in Blotto
(1:100, unless otherwise stated) with 10
11 particles of
insertless M13KE gIII library phage per ml. The
insertless phage was a
background library phage from the selection
process described above
which was shown by sequencing not to have
any insert (i.e., did not
display any foreign epitope) at the
EagI site. To
determine total immunoglobulin (Ig) levels against
the phage-displayed
epitopes (total Ig ELISA), horseradish peroxidase
(HRP)-conjugated
rabbit anti-swine Ig (Dako, Glostrup, Denmark)
diluted 1:5,400 in
PBS-0.05% Tween 20 containing 10
11 particles of
insertless M13KE gIII library phage per ml and 1%
normal rabbit serum
(HRP conjugate buffer) was used as the secondary
antibody. To determine
IgA levels against the phage-displayed
epitopes (IgA ELISA), a
monoclonal antibody against porcine IgA
(murine IgG1 isotype;
ID-Lelystad, The Netherlands) (
40) was
used at 10 µg/ml
in Blotto, followed by an HRP-conjugated rabbit
anti-mouse Ig (Dako)
diluted 1:1,000 in HRP conjugate buffer.
For a negative isotype
control, an irrelevant MAb (anti-
Aspergillus niger glucose
oxidase, murine IgG1 isotype; Dako) was used, also
at 10 µg/ml. The
ELISA plates were developed with 0.42 mM
3,3',5,5'-tetramethylbenzidine-0.007%
H
2O
2-35 mM citric acid-67 mM
Na
2HPO
4 (pH 5.0) for 5 to 15 min
at room
temperature. The reaction was stopped with 1 M sulfuric
acid, and the
absorbance at 450 (tetramethylbenzidine substrate
product absorbance)
and 620 nm (background absorbance from dirt
and scratches on the ELISA
plates) was determined in a microplate
reader.
To avoid background problems due to the common anti-M13 reactivity
found in animal sera, each serum was tested in parallel
on wells coated
with peptide-displaying phage (test antigen),
and a well coated with
the same insertless library phage used
as the adsorbent in the antibody
dilution buffers above (negative
antigen). The specific
reactivity of the serum against the phage-displayed
peptide was
calculated as a ratio between the reactivity against
test and
negative antigen: (OD450
test antigen 
OD620
test antigen)/(OD450
negative antigen 
OD620
negative antigen). This ratio is referred to
in Fig.
1 and is hereafter called the OD450 ratio. For titration of
sera,
we examined twofold serum dilutions in the range from 1:50 to
1:3,200 and fivefold serum dilutions in the range from 1:100 to
1:1,562,500 (Table
3 and Fig.
5). The specific reactivity of
the serum
against the phage-displayed peptide was calculated as
a difference
between the reactivity against test and negative
antigen:
(OD450
test antigen 
OD620
test
antigen)

(OD450
negative antigen 
OD620
negative antigen), and the titer was expressed as the
serum
dilution range which spanned half-maximal specific ELISA
reactivity.
To score sera as seropositive or seronegative (Fig.
4 and
6), the OD450
ratio for the test serum was compared to the maximal
OD450 ratio for a
panel of 19 (total Ig ELISA) or 14 (IgA ELISA)
known PRRSV-negative
field sera. A test serum was considered PRRSV
seropositive if it
exhibited an OD450 ratio above the maximum
OD450 ratio for the negative
serum
panel.
 |
RESULTS |
Selection with PRRSV-immune sera enriches for phages
displaying PRRSV epitopes.
Three segments of the PRRSV genome
were RT-PCR amplified (Table 1), cloned, fragmented by DNase
treatment, and used to construct three separate phage display
libraries. The RT-PCR amplicon used for the ORF 1 library contained
94% of the ORF 1 coding sequence, lacking only 485 nt of the 3' end of
ORF 1b. The two RT-PCR amplicons used for ORF 2-3 and ORF 4-7 library construction provided complete, overlapping coverage of all the
structural genes of PRRSV. The cloning strategy described in
Materials and Methods resulted in the surface display of random
PRRSV fragments of 10 to 50 amino acids, fused to the N-terminus of the
phage pIII protein, which is present in three to five copies at one end
of the filamentous M13 virion. The libraries were selected in parallel
with porcine sera taken at 42 days post-PRRSV infection (42-dpi sera)
and with preinfection sera from the same animals (0-dpi sera). The
42-dpi sera used for selection had high (>1:1,000) antibody titers
against PRRSV in routine diagnostic assays and contained neutralizing antibodies. In 0-dpi sera, no anti-PRRSV antibodies could be detected. The phage display libraries underwent three or four rounds of selection, where the eluted phage population from one selection was
amplified and used for a successive selection (Table
2). To bias the screening towards
commonly recognized epitopes, sera from two individual pigs were
used alternately in successive selection cycles. Also, to bias the
screening towards identifying epitopes which induce higher-affinity
antibodies, progressively lower levels of serum were used for each
selection (Table 2). For each selection, we measured the total amount
of phage added and the total amount of phage recovered and calculated
an output-input ratio by dividing these two values. Reproducibly, the
output-input ratio increased through successive selections with 42-dpi
sera, indicating that the phage population was increasingly enriched
for antibody binders (Table 2). To assess how much of this enrichment
was due to nonspecific reaction of porcine antibodies against M13
virions, the output-input ratios obtained with 42-dpi sera were divided
by the output-input ratios obtained in parallel selections with 0-dpi
sera to yield specific enrichment ratios. The specific enrichment
ratios also increased through successive selections (Table 2),
indicating that our selection strategy was effective in specifically
enriching the libraries for phages that reacted with anti-PRRSV
antibodies, ie, phages that likely expressed PRRSV epitopes. After
three or four rounds of selection, the specific enrichment ratios were at least 10, which indicated that the majority of phages selected with
42-dpi sera might express PRRSV epitopes. At this stage, the
inserts displayed by individual phages were determined by DNA
sequencing.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Selection of PRRSV phage-display libraries with porcine
sera: description of a simple method to monitor the specific
enrichment for epitope-displaying phagesa
|
|
A total of 79 phages selected with 0-dpi sera were sequenced, and 73 of
these phages either carried no inserts at the
Eag-I
site or
displayed peptides which did not match any known PRRSV
protein. These
non-PRRSV peptides were derived from the pCR-XL
vector sequence, the
negative-sense PRRSV sequence, and alternate
reading frames in the
PRRSV positive-sense sequence. Only 6 of
the 79 phages selected with
0-dpi sera displayed peptides which
matched a known PRRSV protein (not
shown). In contrast, of 213
phages selected with 42-dpi sera (57 from
the ORF 1 library, 95
from the ORF 2-3 library, and 61 from the ORF
4-7 library), 135
displayed peptides of 10 to 47 amino acids which
matched a known
PRRSV protein. This difference in the frequency of
PRRSV-displaying
phages between populations selected with 0-dpi and
42-dpi sera
(8 and 63%, respectively) was in agreement with the
specific enrichment
observed during selection (Table
2); together,
these results
suggested that PRRSV-displaying phages identified
putative epitope
sites in the viral
proteins.
The 135 PRRSV-displaying phages which were selected with 42-dpi sera
were not all unique, i.e., did not display 135 different
peptide
sequences; repetitions of the same phage clone were common.
Also,
several unique peptides sometimes clustered at the same
site in a PRRSV
protein. For these reasons, the 135 PRRSV-displaying
phages altogether
identified 12 putative epitope sites (ES), 10
in the ORF 1 nonstructural protein and one each in the ORF 3 and
4 minor envelope
glycoproteins.
A total of 83% of putative epitope sites identified by
sequencing are real and are not unique to the sera used for library
selection.
Plaque-purified phage clones representing each putative
ES were used as the antigen in total Ig ELISA (Fig.
1A). If more than one phage clone
identified an ES, the phage clone displaying the longest insert was
used for ELISA in all cases. Of the 12 putative ES identified by
sequencing, 10 could be verified serologically (Fig. 1A). Experimental
pig sera (42-dpi sera) reacted with these ES, whereas a panel of known
negative sera did not. Also, experimental 0-dpi sera did not react with
the ES (not shown in Fig. 1A, but see Fig. 4). A phage representing one
of the epitope sites that could not be verified serologically
(ES10) was used as a negative-control antigen. Experimental 42-dpi sera
did not react with this phage, which displayed a 14-amino-acid
nonepitope fragment of the PRRSV helicase (Fig. 1A, hel).
Importantly, the serologically confirmed 10 ES reacted not only
with the two pig sera that were used for library selection but also
with one or more of the other experimental sera (Fig. 1A), indicating
that our selection procedure (Table 2) had been successful in isolating
B-cell epitopes that are commonly recognized by pigs. For most ES
(except the weak ES1 and ES11), an IgA response could also be detected
(Fig. 1B). Unsurprisingly, a strong reaction in total Ig ELISA
generally correlated with a strong reaction in IgA ELISA. More
remarkably, the opposite was also seen, with ES12 exhibiting a strong
reaction with all experimental sera in total Ig ELISA but a very weak
(albeit positive) reaction with all experimental sera in IgA ELISA
(Fig. 1, compare A and B).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 1.
Serological confirmation of ES by ELISA. ELISA to detect
total porcine Ig or porcine IgA directed against the different ES was
done as described in Material and Methods. Hel is a phage displaying a
14-amino-acid fragment from the PRRSV helicase which is not an
epitope, i.e., a negative-control antigen. To estimate the specific
reactivity of porcine sera against the phage-displayed PRRSV peptides
and to correct for any unspecific reactivity against the M13 virion,
the OD450 ratio (y axis) was calculated as described in
Materials and Methods. The 19× neg (A) and 14× neg (B) columns show
the mean reaction of negative serum panels, with bars indicating 1 standard deviation. Experimental sera (pigs 9, 10, 11, 12, 13, and 14)
were from 42-dpi PRRSV 111/92 infection. (B) Isotype control bars
indicate the reactivity of the indicated pig serum using an
isotype-matched MAb instead of the anti-IgA MAb. Sera from pigs 10 and
12 were used for phage library selection, as described in Table 2,
footnote a.
|
|
The sequences of the 10 serologically confirmed ES are presented in
Fig.
2, and the positions
of the confirmed ES in the PRRSV
genome are shown in Fig.
3.


View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
Sequences of serologically confirmed ES. For each
ES, phage-displayed sequences are shown in the top box. The
phage-displayed sequences were derived from PRRSV isolate 111/92, which
was used for library construction. The sequences shown were fused to
the phage pIII protein, in the context
MKKLLFAIPLVVPFYSHS*A?AQTVQSCLA,
where the pIII leader peptide is underlined, * is the predicted
leader peptidase cleavage site, ? is the phage-displayed PRRSV sequence
shown in the figure, and naturally phage-encoded residues immediately
neighboring the displayed sequence in the mature pIII protein are in
italics. The published PRRSV sequence is shown in the bottom box,
annotated and aligned to the phage-displayed sequences. For ES in ORF
1, only published Lelystad PRRSV sequence is shown. For ES in the
structural genes (sites 11 and 12), published 111/92 and Lelystad PRRSV
sequences are shown (111/92 top, Lelystad bottom). The sequences for
two ES which could not be confirmed by ELISA (ES8 and ES10) are not
shown. Amino acid (aa) homologies were calculated between the
phage-displayed sequences and Lelystad PRRSV, in all cases omitting the
first and last of the phage-displayed residues, which might have been
corrupted during the cloning procedure. For ES12, the 5 C-terminal
residues in the first phage sequence and the three N-terminal residues
in the second sequence likely represented a ligation artifact and were
omitted from the homology calculation. For each phage clone, the number
of times the clone was observed (numerator) in the total number of
sequenced phages from a given library (denominator) is indicated.
Altogether 57, 95, and 61 phage clones were sequenced from the ORF 1, ORF 2-3 and ORF 4-7 libraries, respectively. Where more than
one phage identified an ES, the phage displaying the longest PRRSV
sequence was used as the ELISA antigen in all cases.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Positions of serologically confirmed ES in the PRRSV
genome. The positions of the serologically confirmed ES are shown by
black boxes. Box width is proportional to the total length of the ES,
as defined in Fig. 2. Only ORF 1 features of relevance to the
identified ES are shown, using the protease domain and Nsp nomenclature
suggested by Ziebuhr et al. (45). Arrowheads indicate
predicted autoproteolytic cleavage sites in the ORF 1 replicase
polyprotein. For the PCP1 / cleavage site, the question
mark indicates that the exact position is not known. PCP1 , PCP1 ,
and CP2 denote accessory protease domains; the Nsp4 fragment is the
main arteriviral protease. RKASLSTS is a previously
identified ORF 3 epitope (30). Hopp-Woods antigenicity
predicitions were made using the built-in option of the Omiga software
and a 17-amino-acid sliding window.
|
|
Examination of seroconversion kinetics and titers.
Pigs
seroconverted to the 10 ES at different times postinfection in what
appeared to be a consistent pattern (Fig.
4). Seroconversion was first noted
towards ES12 (ORF 4 envelope glycoprotein) and ES7 (Nsp2).
Very late seroconversion was seen towards ES1 (ORF1a) and ES11 (ORF 3 envelope glycoprotein). Thus, the kinetics of seroconversion did not discriminate between ES in structural and nonstructural parts of the viral genome. This is the first report of ES
in the PRRSV replicase polyprotein, and it is noteworthy that
some of the nonstructural ES (ES7, Fig. 4) were targeted very rapidly
by the pig antibody response. To examine the relationship between the
speed and the magnitude of the porcine antibody response, total Ig
titers towards all ES were determined at 42 dpi (Table 3). We found that the speed with which ES
were recognized during infection in vivo (Fig. 4) was not generally
predictive of the 42-dpi titers (Table 3), yet the 42-dpi titers in
Table 3 are unlikely to represent a "final" antibody response; it
is possible that ES exhibiting very late seroconversion such as ES1,
ES5, and E11 (Fig. 4), attained titers higher than those shown in Table 3 at later times postinfection. In support of this, we observed that
seroconversion to ES11 did not occur untill 56 dpi in one pig (not
shown). It is an intriguing possibility that the seroconversion and
antibody titer towards such very late epitopes might be informative about late phases of PRRSV replication.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Seroconversion kinetics of six experimentally infected
pigs against phage-displayed PRRSV ES. Serum samples taken at 0, 14, 21, and 42 dpi from six experimentally PRRSV-infected pigs were
examined in total Ig ELISA against all the ES identified in this study.
Seropositive/seronegative scoring was done as described in Materials
and Methods. Hel is a phage displaying a 14-amino-acid fragment from
the PRRSV helicase which is not an epitope. No pigs seroconverted
to this negative-control antigen. Viremia levels were examined on more
closely spaced serum samples than seroconversion, as indicated.
|
|
Fine mapping of ES12.
ES12 corresponded to an epitope
identified by murine MAbs and peptide scan in the Lelystad virus ORF 4 protein by Meulenberg et al. (23). Based on the reaction
of 15 of 15 MAbs raised against recombinant ORF 4 protein with this
site, the authors noted that the region was immunodominant in mice but
did not examine its relevance in pigs. The anti-ORF 4 MAbs made by
Meulenberg et al. were neutralizing in vitro (23). We
observed that high anti-ES12 titers coexisted with viremia in
individual animals (not shown) as well as in the experimental group as
a whole (Table 3). Thus, the protective effect of anti-ES12 antibodies
appeared to be limited in vivo. Interestingly, a recent study showed
that anti-ORF 4 MAbs are inefficient at neutralization in vitro
compared to anti-ORF 5 MAbs (42). Six of six
experimentally infected pigs consistently produced very high antibody
titers towards ES12 (Table 3 and Fig. 5).
In one pig, half-maximal ELISA reaction was not reached untill a serum
dilution of 1:12,500 to 1:62,500 (Table 3), and in two pigs, weak
positive ELISA reactivity was still evident at a 1:62,500 serum
dilution (not shown). Thus, our study confirmed the immunodominance of
ES12 in pigs. In addition to inducing high antibody titers, ES12 was
special in that it appeared to be deficient in IgA induction (Fig. 1,
compare A and B). It remains to be determined whether this deficiency
is one of IgA amount, affinity, or both. The deficiency might also be
influenced by host factors, because serum from 1-year-old
experimentally PRRSV-infected boars in some cases produces a stronger
anti-ES12 signal in the IgA ELISA (M. B. Oleksiewicz,
unpublished).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Fine mapping of the immunodominant ES12. Serum samples
taken at 42 dpi from six experimentally infected pigs were titrated in
ELISA on each of the five phage clones defining the ORF 4 epitope
site (ES12). Each data point represents the average ELISA reactivity of
the six experimental sera, and bars indicate 1 standard deviation. The
boxed residues in the Lelystad PRRSV ORF 4 sequence indicate a core
epitope previously determined by Meulenberg et al. using murine
MAbs and Pepscan (23). The boxed residues in the 111/92
ORF 4 sequence indicate a core epitope defined by the sequence
overlap between the three most strongly reacting phage clones (6-1, 6-2, and 6-62). Arrows indicate two highly conserved cysteine
residues, and the heavy horizontal black bar indicates PRRSV sequence
which is hypervariable and deletion prone in field isolates
(30). The five C-terminal residues in phage 6-2, the three
N-terminal residues in phage 6-1, and the C-terminal residue in phage
8-05 do not match the 111/92 sequence and likely represent a ligation
or cloning artifact during library construction.
|
|
Immunodominant envelope protein regions have been implicated in the
pathogenesis of other RNA virus infections (
4). Therefore,
to map ES12 more precisely, each of the five phage clones identifying
ES12 were tested in an ELISA (Fig.
5). The termini of some of
the
phage-displayed peptides were corrupted, most likely by the
blunt-ending or ligation steps during library construction (Fig.
5).
Nevertheless, based on the sequence overlap between the three
clones
that reacted strongly in ELISA (Fig.
5, phages 6-1, 6-2,
and 6-62),
the porcine ES12 epitope mapped to a 13-amino-acid
segment of the
111/92 ORF 4 protein (Fig.
5, large box in the
111/92 virus sequence).
This region was slightly larger than the
9-amino-acid murine
epitope identified by Meulenberg et al. (
23)
(Fig.
5,
small box in the Lelystad virus sequence). The extra
residues in the
porcine epitope site appeared to be important
for B-cell
recognition in vivo, since a phage clone which displayed
the whole
murine site but lacked three of the four residues unique
to the porcine
site exhibited strongly reduced ELISA reactivity
(Fig.
5, phage 8-5).
The mechanisms governing immunodominance are not well understood
(
4). For example, the high anti-ES12 titers at 42 dpi
(Table
3 and Fig.
5) could not be explained by an early seroconversion
towards ES12, because ES7 induced similar early seroconversion
(Fig.
4)
but never reached titers above 1:1,600 (Table
3). Also,
the Hopp-Woods
antigenicity of ES12 was not particularly high
(Fig.
3). Finally, the
high anti-ES12 titers were not due to a
high level of antigenic
stimulation, because the ORF 4 protein
is a minor component of PRRSV
virions (
36). Interestingly, the
ES12 core epitope is
flanked by two cysteine residues which are
conserved in EU-type PRRSV
and even in US-type PRRSV (Fig.
5 and
data not shown). Based on the
results in Fig.
5, the flanking
cysteines were clearly not required for
the reaction of mature
Ig with ES12; however, disulfide bridging might
enhance presentation
of ES12 to developing B
cells.
In PRRSV, the antigenicity of linear epitopes correlates with
genetic variability.
We and others have previously found, based on
the analysis of two epitope sites, that linear epitopes in the
envelope glycoproteins of PRRSV may exhibit a very high
level of genetic variability (10, 14, 23, 30). In the
present study, we were able to examine the variability-antigenicity
relationship on a larger panel of epitope sequences and to extend
the analysis to the replicase polyprotein. The amino acid
homology between the Lelystad and 111/92 PRRSV strains was plotted
against the maximal antibody titer at 42 dpi for each of the 10 ES
(Fig. 6). Interestingly, in this plot two
main clusters of ES were apparent: one cluster exhibited a low level of
sequence conservation and induced higher levels of antibodies (cluster
A, Fig. 6), and one cluster exhibited a high level of sequence
conservation and induced lower levels of antibodies (cluster B, Fig.
6).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
For linear ES in PRRSV, antigenicity in vivo correlates
with genetic variability. The amino acid homology values (x
axis) are from Fig. 2, and the maximal antibody titers (y
axis) are from Table 3.
|
|
Antibody responses of short-term and longer-term viremic pigs are
different.
It is well known that pigs may exhibit various periods
of viremia following PRRSV infection, but the mechanisms responsible are unknown. Since our pigs were experimentally infected by the nasopharyngeal route and the initial viremic peak was likely to be
derived from acute PRRSV replication in alveolar pulmonary macrophages
(16, 17), we examined whether local mucosal humoral responses might have influenced viremia levels. We estimated viremia duration by the number of viremia-positive samples among 11 serum samples taken at 3, 7, 10, 14, 17, 21, 24, 28, 31, 35, and 42 dpi (all
pigs were viremia negative at 0 dpi). Two pigs had only three positive
samples, the latest at 14 dpi, and remained viremia negative
thereafter. One pig had four positive samples, the latest at 14 dpi,
and remained viremia negative thereafter. One pig had four viremic
samples, the latest at 21 dpi, and remained viremia negative therafter.
The remaining two pigs had seven and eight viremic samples,
respectively, the latest at 35 dpi, and were viremia negative at 42 dpi
(summarized for the group as a whole in Fig. 4). Thus, our group of
animals contained short-term as well as longer-term viremic pigs. For
analysis of IgA responses, the ES were grouped as follows: ES11 was
excluded from the analysis because seroconversion in IgA ELISA was not
consistently seen against this weak epitope (Fig. 1 and not shown).
Also, owing to large interanimal variability in which the ORF 1 ES were
targeted by the IgA response (not shown in detail, but see Fig. 1B),
the ORF 1 ES (ES1 to ES9) were analyzed collectively. Finally, ES12 was
analyzed separately because, in comparison to the ORF 1 ES, ES12
appeared to be deficient in IgA induction relative to total Ig
induction (Fig. 1, compare ES12 in A and B). Interestingly, viremia
duration correlated with the kinetics of the IgA response in individual
pigs: short-term viremic pigs also exhibited the quickest IgA response
to the "virtual antigen" consisting of the combined ORF 1 epitopes (Fig. 7). For ES12, the
kinetics of IgA production did not correlate with viremia
duration (Fig. 7).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 7.
Short-term and longer-term viremic pigs exhibit
differences in humoral immune responses. Serum samples taken from six
experimentally infected pigs at 0, 14, 21, 31, and 42 dpi were examined
in IgA ELISA. The time of seroconversion (the earliest time when ELISA
reactivity exceeded the cutoff determined by examining a negative serum
panel, as described in Materials and Methods) was plotted against the
duration of viremia for ES12 as well as for the ORF 1 ES (ES1 to ES9)
collectively. Each data point represents a single animal. All six
experimentally infected pigs, irrespective of viremia duration, were
positive for PRRSV by RT-PCR on lung or tonsil material at euthanasia
at 42 to 56 dpi.
|
|
 |
DISCUSSION |
In this study, we describe an approach based on long RT-PCR and
phage display for the screening of whole viral genomes for linear
B-cell epitopes. We show that, given an effective library selection
strategy and an appropriate monitoring of enrichment ratios (Table 2),
sequencing of phage clones is more than 80% accurate in identifying
B-cell epitopes. Sequencing phages is technically simple and well
suited to high-throughput formats. In contrast, downstream serological
confirmation of epitopes is more labor intensive and requires
larger panels of characterized sera. Thus, although the phage display
method identifies only linear epitopes and may exhibit residue bias
in the displayed peptides (32), the relatively high degree
of accuracy in epitope identification based on sequencing alone
makes it attractive for rapid first-pass epitope screening of viral
genomes using minimal amounts of immune sera and pathogen material. The
phage display method identified 10 ES in total, 8 of which were in the
replicase polyprotein. The results from the serological
characterization of the 10 ES appeared to have implications for the
diagnostics as well as immunopathology of PRRSV infection, as discussed below.
Underestimate of the total number of linear ES in the structural
genes.
Although seven ES were identified in ORF 1a, none were
identified in ORF 1b (Fig. 3). In ORF 1a, six unique phage clones
sometimes clustered at an ES (Fig. 2), indicating that the phage
display library provided at least a sixfold coverage of ORF 1. Also, by using appropriate ligands, we have isolated phage displaying ORF 1b
functional domains from the ORF 1 library (unpublished data). Thus, we
believe that the failure to identify linear ES in ORF 1b was not due to
poor library quality. The paucity of ES in ORF 1b may reflect a low
level of protein production and hence poor stimulation of porcine B
cells: translation of ORF 1b is thought to require a ribosomal
frameshift event at a "slippery knot" RNA feature just upstream of
the ORF 1a stop codon. The frameshift efficiency has been estimated at
15 to 20% in vitro (8), suggesting that significantly
more ORF 1a protein than ORF 1ab protein may be produced in vivo.
Additionally, the lack of linear ES in ORF 1b may reflect the
antigenicity-conservation relationship for short linear sequences
described in this study (Fig. 6). ORF 1b is generally more conserved
than ORF 1a and contains several very highly conserved functional
domains (22, 25). Interestingly, the Nsp2 fragment found
to contain most linear ES (Fig. 3) has been noted by others to be the
most variable part of the PRRSV genome, not excluding the structural
genes (6, 34). In short, we believe that the absence of
linear ES from ORF 1b and the clustering of linear ES in Nsp2 represent
meaningful rather than artifactual results (Fig. 3). The biological
mechanisms behind the clustering of ES in Nsp2 are unknown, but the
protein is produced in quantity in Arterivirus-infected cells, where it
carries out several functions, such as participating in the induction
of double lipid membrane vesicles, as well as acting as a membrane
anchor for the assembly of multiprotein viral replication complexes on
the surface of the vesicles (31, 41).
Only two ES were identified in the structural genes (Fig.
3). This low
level of ES was surprising, and also surprising was
the failure to
identify any ES in the ORF 7 nucleocapsid protein,
which is known to
contain linear ES (
21) and to stimulate a
strong antibody
response in pigs. However, in agreement with the
very high titers
observed against ES12, ES12-representing phages
constituted a very high
proportion of the clones sequenced from
the structural libraries
(compare Table
3 and Fig.
2). Also,
due to the location of ES12 at the
ORF 3-4 overlap, ES12-displaying
phages were present in ORF 2-3 as well as ORF 4-7 phage display
libraries (Fig.
3 and Table
1).
Thus, the most likely explanation
for the low level of ES identified
from the structural libraries
is that phages representing the very
strong ES12 outcompeted phages
representing other structural-gene ES
during the screening of
the ORF 2-3 and ORF 3-7 libraries.
Finally, the ORF 7 nucleocapsid
protein is rich in positive residues,
and it is possible that
residue bias (
32) prevented
identification, especially of ORF
7 ES. Work is in progress to
construct libraries without ES12,
to perform a more sensitive screen
for ES in the structural genes
of
PRRSV.
Antigenicity-variability relationship for linear ES in
PRRSV.
We observed that the ES exhibited an unexpectedly
marked clustering in antigenicity-variability plots (Fig. 6). Only one
of the 10 ES did not exhibit clustering (Fig. 6, ES2). The very strong ES12 localized to cluster A (Fig. 6). ES12 induced very high antibody levels in vivo (Table 3), is known to mediate neutralization in vitro (23), and is hypervariable in field PRRSV
isolates (10, 14, 23, 30). Thus, although our results
suggested that the protective effect of anti-ES12 antibodies may be
limited in vivo (see results above and Fig. 4), it nevertheless seems likely that the porcine antibody response exerts a selective
pressure, which results in the sequence diversity at the ES12 site,
as has also been suggested by others (10, 14, 23, 30). The
genetic mechanisms regulating ES12 sequence diversity may be quite
complex: the stretch of the viral genome which encodes ES12 in ORF 4 also codes for an RKASLSTS epitope in the overlapping ORF 3 (Fig.
3) (30). Nucleotide changes in the first codon position in
ORF 4 result in third-codon position changes in the overlapping ORF 3. This suggests the presence of a selective pressure amplifying and quenching mechanism, where radical (first codon position) changes in ES12 are linked with more conserved (third codon position) changes in the RKASLSTS ORF 3 epitope. This mechanism, if
it exists, is not essential; we have previously reported that whereas
the genetic locus encoding ES12 and the ORF3 RKASLSTS epitope was intact in 70% of Danish field PRRSV isolates from 1992, it is deleted in 63% of present-day Danish field PRRSV isolates
(30).
In contrast to ES12, the remaining three ES in cluster A and four of
the five ES in cluster B localized to a nonstructural
PRRSV protein
(Fig.
3 and
6), and selective pressure from the
porcine antibody
response therefore appears to be a less immediate
explanation for
the observed diversity-antigenicity relationship.
A possible
factor other than the host immune response which could
link
antigenicity and sequence conservation is tertiary protein
structure.
Tertiary structure-rich regions might impede the presentation
of
strictly linear ES to porcine B cells and might predominate
in, for
example, functional protein domains, which are in turn
more likely to
be composed of conserved than nonconserved linear
sequence. This
hypothesis would not fully explain our data, because
while ES2 and ES9
both localized to functional protein domains
(Fig.
3, ES2 in the CP2
accessory protease and ES9 in the Nsp4
main protease), ES2 induced high
and ES9 induced low antibody
titers. Alternatively, nonstructural PRRSV
protein(s) may be the
target of selective pressure from the porcine
antibody response
due to a hitherto unrecognized localization on
the surface of
infected cells or as a trace component of
PRRSV virions. Trace
amounts of replicase protein in the particle
of a positive-stranded
RNA virus is not without precedent
(
26), and the enveloping
mechanism for PRRSV may be
sufficiently leaky to allow incorporation
of
"bystander" proteins into PRRSV particles (
6).
Finally,
IgA might exert a selective pressure on nonstructural
PRRSV proteins
inside infected cells (
12,
19,
20).
Although the mechanisms behind the observed diversity-antigenicity
relationship (Fig.
6) can at present only be guessed at,
the interplay
between hypervariable epitope sites in viral envelope
glycoproteins and the host antibody response is thought to
be
of importance for the pathogenesis of, for example, human
immunodeficiency
virus and hepatitis C virus infections. For those
viruses, linear
strongly antigenic envelope glycoprotein
sequences have in some
cases been shown to be decoy epitopes, which
lure the host antibody
response away from critical, neutralizing
epitope sites (
4,
33). ES12 exhibited some features
expected of a decoy epitope,
such as the ability to induce very
high antibody levels rapidly
and consistently in all infected animals
(Table
3 and Fig.
4),
hypervariability (
10,
14,
23,
30),
poor correlation between
seroconversion and clearance of viremia in
vivo (Fig.
4), and
apparent polarization in the type of Ig induced
(Fig.
1, compare
ES12 in A and B). Thus, examination of the in vivo
protective
effect of anti-ES12 antibodies may be of value for vaccine
development.
Implications of the identified ES for PRRSV diagnostics.
ELISA
using phage-displayed ES as the antigen exhibited characteristics which
might be attractive for diagnostic tests. (i) The wide range in
seroconversion times against the different ES in effect made
seroconversion predictive of the occurrence of viremia in the group of
animals (Fig. 4, compare serology and virus isolation data). This might
be exploited to develop serological tests with improved ability to
measure disease progression at the herd level. (ii) Since preliminary
experiments indicate that the ES described in Fig. 2 are not recognized
by antibodies from animals infected with US-type PRRSV (unpublished
data), they may be applicable for highly discriminatory serodiagnostics
in areas where US- and EU-type PRRSV coexist, such as Denmark (2,
18, 38) and Canada (9). (iii) M13 phage particles
are resistant to proteolysis, allow very simple and reproducible
coating of ELISA plates with peptide antigen, and combine multivalent
display with a good presentation of peptides for antibody binding
(46). All of these features may be attractive for
detection of low-level antibodies in protease-containing sources such
as boar semen or meat juice. In fact, ELISA using phage-displayed ES as
the antigen can be used to detect antibodies in boar semen (M. B. Oleksiewicz, submitted for publication).
More generally, the wide variation in ES sequence conservation (Fig.
2)
and serological characteristics (Fig.
4 and Table
3) may allow the ES
catalogue generated in the present study
(Fig.
2 and
3) to act as a
guide for the development of new test
antigens, particularly from the
hitherto serologically uncharacterized
replicase polyprotein.
In fact, our results predicted interesting
properties for ELISAs using
the N-terminal part of Nsp2 as the
antigen, be it in the form of short
ES (Fig.
4) or as a whole
(Fig.
7). However, prior to diagnostic
exploitation, more information
is needed about the relationship between
the genetic variability
and serological cross-reactivity between
different PRRSV isolates
at the epitope sites, as well as about the
interpig variability
in anti-ES
responses.
Implications of the identified ES for PRRSV immunopathology.
For PRRSV, the demonstration of antibody-dependent enhancement of
infection in macrophages in vitro has caused interest in the effect of
humoral responses on viral replication in vivo (44). A
recent study showed a correlation between the humoral immune response
and quenching of PRRSV replication in the lungs of pigs (16). In our study, we observed a correlation between the
kinetics of the IgA response towards ES in the replicase
polyprotein and the duration of viremia (Fig. 7). Although the
presence of neutralizing ES in the replicase polyprotein cannot
be excluded, as mentioned above, it seems more likely at present to
assume that the IgA response per se, rather the IgA response
specifically against ORF 1 ES, might be of importance in shortening
viremia duration. Also, the IgA levels at late times postinfection did
not correlate with viremia duration (not shown). This indicates that
the early IgA response may directly affect viral replication, as
opposed to IgA being a marker for another, unknown protective immune
parameter. Importantly, in all six experimentally infected pigs, PRRSV
could be detected by RT-PCR on lung or tonsil material at euthanasia at
42 to 56 dpi (not shown). Thus, the IgA response did not correlate with
the clearance of virus from solid tissues. It is also noteworthy that
no correlation existed between the IgA response kinetics and viremia
duration for ES12 (Fig. 7). While further examination of the
correlation between virus replication and serological parameters is
warranted, it appears that the use of "precise" antigen, such as
the ES identified in the present study, may have inherent advantages in
examining the interactions between PRRSV and the humoral immune system.
 |
ACKNOWLEDGMENTS |
We thank H. S. Nielsen for assistance with long RT-PCR and
cloning, B. Strandbygaard for providing panels of characterized sera,
and R. Forsberg and Å. Uttenthal for critical reading and discussion of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Danish
Veterinary Institute for Virus Research, Lindholm, 4771 Kalvehave,
Denmark. Phone: 45 5586 0249. Fax: 45 5586 0300. E-mail:
mo{at}vetvirus.dk.
 |
REFERENCES |
| 1.
|
Bøtner, A.,
J. Nielsen, and V. Bille-Hansen.
1994.
Isolation of porcine reproductive and respiratory syndrome (PRRS) virus in a Danish swine herd and experimental infection of pregnant gilts with the virus.
Vet. Microbiol.
40:351-360[CrossRef][Medline].
|
| 2.
|
Bøtner, A.,
B. Strandbygaard,
K. J. Sørensen,
P. Have,
K. G. Madsen,
E. Smedegaard Madsen, and S. Alexandersen.
1997.
Appearance of acute PRRS-like symptoms in sow herds after vaccination with a modified live PRRS vaccine.
Vet. Rec.
141:497-499[Free Full Text].
|
| 3.
|
Christopher-Hennings, J.,
E. A. Nelson,
R. J. Hines,
J. K. Nelson,
S. L. Swenson,
J. J. Zimmerman,
C. L. Chase,
M. J. Yaeger, and D. A. Benfield.
1995.
Persistence of porcine reproductive and respiratory syndrome virus in serum and semen of abult boars.
J. Vet. Diagn. Investig.
7:456-464[Abstract/Free Full Text].
|
| 4.
|
Cleveland, S. M.,
E. Buratti,
T. D. Jones,
P. North,
F. Baralle,
L. McLain,
T. McInerney,
Z. Durrani, and N. J. Dimmock.
2000.
Immunogenic and antigenic dominance of a nonneutralizing epitope over a highly conserved neutralizing epitope in the gp41 envelope glycoprotein of human immunodeficiency virus type 1: its deletion leads to a strong neutralizing response.
Virology
266:66-78[CrossRef][Medline].
|
| 5.
|
Day, L. A.
1969.
Conformations of single-stranded DNA and coat protein in fd bacteriophage as revealed by ultraviolet absorption spectroscopy.
J. Mol. Biol.
39:265-277[CrossRef][Medline].
|
| 6.
|
Dea, S.,
C. A. Gagnon,
H. Mardassi,
B. Pirzadeh, and D. Rogan.
2000.
Current knowledge on the structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates.
Arch. Virol.
145:659-688[CrossRef][Medline].
|
| 7.
|
de Haan, C. A.,
H. Vennema, and P. J. Rottier.
2000.
Assembly of the coronavirus envelope: homotypic interactions between the M proteins.
J. Virol.
74:4967-4978[Abstract/Free Full Text].
|
| 8.
|
Den Boon, J. A.,
E. J. Snijder,
E. D. Chirnside,
A. A. de Vries,
M. C. Horzinek, and W. J. Spaan.
1991.
Equine arteritis virus is not a togavirus but belongs to the coronaviruslike superfamily.
J. Virol.
65:2910-2920[Abstract/Free Full Text].
|
| 9.
|
Dewey, C.,
G. Charbonneau,
S. Carman,
A. Hamel,
G. Nayar,
R. Friendship,
K. Eernisse, and S. Swenson.
2000.
Lelystad-like strain of porcine reproductive and respiratory syndrome virus (PRRSV) identified in Canadian swine.
Can. Vet. J.
41:493-494[Medline].
|
| 10.
|
Drew, T.,
J. P. Lowings, and F. Yapp.
1997.
Variation in open reading frames 3, 4 and 7 among porcine reproductive and respiratory syndrome isolates in the UK.
Vet. Microbiol.
55:209-221[CrossRef][Medline].
|
| 11.
|
Durand, J. P.,
I. Climent,
J. Sarraseca,
A. Urinza,
E. Cortes,
C. Vela, and I. Casal.
1997.
Baculovirus expression of proteins of porcine reproductive and respiratory syndrome virus strain olot/91: involvement of ORF3 and ORF5 proteins in protection.
Virus Genes
14:19-29[CrossRef][Medline].
|
| 12.
|
Fujioka, H.,
S. N. Emancipator,
M. Aikawa,
D. S. Huang,
F. Blatnik,
T. Karban,
K. DeFife, and M. B. Mazanec.
1998.
Immunocytochemical colocalization of specific immunoglobulin A with sendai virus protein in infected polarized epithelium.
J. Exp. Med.
188:1223-1229[Abstract/Free Full Text].
|
| 13.
|
Gradil, C.,
C. Dubuc, and M. D. Eaglesome.
1996.
Porcine reproductive and respiratory syndrome virus: seminal transmission.
Vet. Rec.
138:521-522[Free Full Text].
|
| 14.
|
Katz, J. B.,
A. L. Schafer,
K. Eernisse, and J. G. N. E. A. Landgraf.
1995.
Antigenic differences between European and American isolates of porcine reproductive and respiratory syndrome virus (PRRSV) are encoded by the carboxyterminal portion of viral open reading frame 3.
Vet. Microbiol.
44:65-76[CrossRef][Medline].
|
| 15.
|
Kim, H. S.,
J. Kwang,
I. J. Yoon,
H. S. Joo, and M. L. Frey.
1993.
Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line.
Arch. Virol.
133:477-483[CrossRef][Medline].
|
| 16.
|
Labarque, G. G.,
H. J. Nauwynck,
K. Van Reeth, and M. B. Pensaert.
2000.
Effect of cellular changes and onset of humoral immunity on the replication of porcine reproductive and respiratory syndrome virus in the lungs of pigs.
J. Gen. Virol.
81:1327-1334[Abstract/Free Full Text].
|
| 17.
|
Lawson, S. R.,
K. D. Rossow,
J. E. Collings,
D. A. Benfield, and R. R. R. Rowland.
1997.
Porcine reproductive and respiratory syndrome virus infection of gnotobiotic pigs: sites of virus replication and co-localization with MAC-387 staining at 21 days post-infection.
Virus Res.
51:105-113[CrossRef][Medline].
|
| 18.
|
Madsen, K. G.,
C. M. Hansen,
E. S. Madsen,
B. Strandbygaard,
A. Bøtner, and K. J. Sørensen.
1998.
Detection of porcine reproductive and respiratory syndrome virus of the American type in Danish swine herds.
Arch. Virol.
143:1683-1700[CrossRef][Medline].
|
| 19.
|
Mazanec, M. B.,
C. L. Coudret, and D. R. Fletcher.
1995.
Intracellular neutralization of influenza virus by immunoglobulin A antihemagglutinin monoclonal antibodies.
J. Virol.
69:1339-1343[Abstract].
|
| 20.
|
Mazanec, M. B.,
C. S. Kaetzel,
M. E. Lamm,
D. Fletcher, and J. G. Nedrud.
1992.
Intracellular neutralization of virus by immunoglobulin A antibodies.
Proc. Natl. Acad. Sci. USA
89:6901-6905[Abstract/Free Full Text].
|
| 21.
|
Meulenberg, J. J.,
A. P. Van Nieuwstadt,
A. Essen-Zandbergen,
J. N. Bos-de Ruijter,
J. P. Langeveld, and R. H. Meloen.
1998.
Localization and fine mapping of antigenic sites on the nucleocapsid protein N of porcine reproductive and respiratory syndrome virus with monoclonal antibodies.
Virology
252:106-114[CrossRef][Medline].
|
| 22.
|
Meulenberg, J. J. M.,
M. M. Hulst,
E. J. De Meijer,
P. L. J. M. Moonen,
A. Den Besten,
E. P. De Kluyver,
G. Wensvoort, and R. J. M. Moormann.
1993.
Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV.
Virology
192:62-72[CrossRef][Medline].
|
| 23.
|
Meulenberg, J. J. M.,
A. P. Van Nieuwstadt,
A. Van Essen-Zandbergen, and J. P. M. Langeveld.
1997.
Posttranslational processing and identification of a neutralization domain of the GP4 protein encoded by ORF4 of Lelystadt virus.
J. Virol.
71:6061-6067[Abstract].
|
| 24.
|
Neitzert, E.,
E. Beck,
P. A. de Mello,
I. Gomes, and I. E. Bergmann.
1991.
Expression of the aphthovirus RNA polymerase gene in Escherichia coli and its use together with other bioengineered nonstructural antigens in detection of late persistent infections.
Virology
184:799-804[CrossRef][Medline].
|
| 25.
|
Nelsen, C. J.,
M. P. Murtaugh, and K. S. Faaberg.
1999.
Porcine reproductive and respiratory syndrome virus comparison: divergent evolution on two continents.
J. Virol.
73:270-280[Abstract/Free Full Text].
|
| 26.
|
Newman, J. F., and F. Brown.
1997.
Foot-and-mouth disease virus and poliovirus particles contain proteins of the replication complex.
J. Virol.
71:7657-7662[Abstract].
|
| 27.
|
Nielsen, H. S.,
T. Storgaard, and M. B. Oleksiewicz.
2000.
Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis.
Vet. Microbiol.
76:221-228[CrossRef][Medline].
|
| 28.
|
Nielsen, T. L.,
J. Nielsen,
P. Have,
P. Baekbo,
J. R. Hoff, and A. Botner.
1997.
Examination of virus shedding in semen from vaccinated and from previously infected boars after experimental challenge with porcine reproductive and respiratory syndrome virus.
Vet. Microbiol.
54:101-112[CrossRef][Medline].
|
| 29.
|
Oleksiewicz, M. B.,
A. Botner,
K. G. Madsen, and T. Storgaard.
1998.
Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RT-PCR amplification of whole viral genes.
Vet. Microbiol.
64:7-22[CrossRef][Medline].
|
| 30.
|
Oleksiewicz, M. B.,
A. Botner,
P. Toft,
T. Grubbe,
J. Nielsen,
S. Kamstrup, and T. Storgaard.
2000.
Emergence of porcine reproductive and respiratory syndrome virus deletion mutants: correlation with the porcine antibody response to a hypervariable site in the ORF 3 structural glycoprotein.
Virology
267:135-140[CrossRef][Medline].
|
| 31.
|
Pedersen, K. W.,
Y. van der Meer,
N. Roos, and E. J. Snijder.
1999.
Open reading frame la-encoded subunits of the arterivirus replicase induce endoplasmic reticulum-derived double-membrane vesicles which carry the viral replication complex.
J. Virol.
73:2016-2026[Abstract/Free Full Text].
|
| 32.
|
Peters, E. A.,
P. J. Schatz,
S. S. Johnson, and W. J. Dower.
1994.
Membrane insertion defects caused by positive charges in the early mature region of protein pIII of filamentous phage fd can be corrected by prlA suppressors.
J. Bacteriol.
176:4296-4305[Abstract/Free Full Text].
|
| 33.
|
Ray, S. C.,
Y. M. Wang,
O. Laeyendecker,
J. R. Ticehurst,
S. A. Villano, and D. L. Thomas.
1999.
Acute hepatitis C virus structural gene sequences as predictors of persistent viremia: hypervariable region 1 as a decoy.
J. Virol.
73:2938-2946[Abstract/Free Full Text].
|
| 34.
|
Shen, S.,
J. Kwang,
W. Liu, and D. X. Liu.
2000.
Determination of the complete nucleotide sequence of a vaccine strain of porcine reproductive and respiratory syndrome virus and identification of the nsp2 gene with a unique insertion.
Arch. Virol.
145:871-883[CrossRef][Medline].
|
| 35.
|
Smith, G. P., and J. K. Scott.
1993.
Libraries of peptides and proteins displayed on filamentous phage.
Methods Enzymol.
217:228-257[Medline].
|
| 36.
|
Snijder, E. J., and J. J. M. Meulenberg.
1998.
The molecular biology of arteriviruses.
J. Gen. Virol.
79:961-979[Medline].
|
| 37.
|
Sørensen, K. J.,
B. Strandbygaard,
A. Bøtner,
E. S. Madsen,
J. Nielsen, and P. Have.
1998.
Blocking ELISA's for the distinction between antibodies against European and American strains of porcine reproductive and respiratory syndrome (PRRS) virus.
Vet. Microbiol.
60:169-177[CrossRef][Medline].
|
| 38.
|
Storgaard, T.,
M. Oleksiewicz, and A. Bøtner.
1999.
Examination of the selective pressures on a live PRRS vaccine virus.
Arch. Virol.
144:2389-2401[CrossRef][Medline].
|
| 39.
|
van Woensel, P. A. M.,
K. Liefkens, and S. Demaret.
1998.
Effect on viraemia of an American and a European serotype PRRSV vaccine after challenge with European wild-type strains of the virus.
Vet. Rec.
142:510-512[Abstract/Free Full Text].
|
| 40.
|
Van Zaane, D., and M. M. Hulst.
1987.
Monoclonal antibodies against porcine immunoglobulin isotypes.
Vet. Immunol. Immunopathol.
16:23-36[CrossRef][Medline].
|
| 41.
|
Wassenaar, A. L.,
W. J. Spaan,
A. E. Gorbalenya, and E. J. Snijder.
1997.
Alternative proteolytic processing of the arterivirus replicase ORF 1a polyprotein: evidence that Nsp2 acts as a cofactor for the Nsp4 serine protease.
J. Virol.
71:9313-9322[Abstract].
|
| 42.
|
Weiland, E.,
M. Wieczorek-Krohmer,
D. Kohl,
K. K. Conzelmann, and F. Weiland.
1999.
Monoclonal antibodies to the GP5 of porcine reproductive and respiratory syndrome virus are more effective in virus neutralization than monoclonal antibodies to the GP4.
Vet. Microbiol.
66:171-186[CrossRef][Medline].
|
| 43.
|
Yoon, I. J.,
H. Joo,
S. Goyal, and T. Molitor.
1994.
A modified serum neutralization test for the detection of antibody to porcine reproductive and respiratory syndrome virus in swine sera.
J. Vet. Diagn. Investig.
6:289-292[Abstract].
|
| 44.
|
Yoon, K. J.,
L. L. Wu,
J. J. Zimmerman,
H. T. Hill, and K. B. Platt.
1996.
Antibody-dependent enhancement (ADE) of porcine reproductive and respiratory syndrome virus (PRRSV) infection in pigs.
Viral Immunol.
9:51-63[Medline].
|
| 45.
|
Ziebuhr, J.,
E. J. Snijder, and A. E. Gorbalenya.
2000.
Virus-encoded proteinases and proteolytic processing in the Nidovirales.
J. Gen. Virol.
81 Pt 4:853-879[Free Full Text].
|
| 46.
|
Zwick, M. B.,
L. L. Bonnycastle,
K. A. Noren,
S. Venturini,
E. Leong,
C. F. Barbas III,
C. J. Noren, and J. K. Scott.
1998.
The maltose-binding protein as a scaffold for monovalent display of peptides derived from phage libraries.
Anal. Biochem.
264:87-97[CrossRef][Medline]. (Erratum, 266:240, 1999.)
|
Journal of Virology, April 2001, p. 3277-3290, Vol. 75, No. 7
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.7.3277-3290.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Brown, E., Lawson, S., Welbon, C., Gnanandarajah, J., Li, J., Murtaugh, M. P., Nelson, E. A., Molina, R. M., Zimmerman, J. J., Rowland, R. R. R., Fang, Y.
(2009). Antibody Response to Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Nonstructural Proteins and Implications for Diagnostic Detection and Differentiation of PRRSV Types I and II. CVI
16: 628-635
[Abstract]
[Full Text]
-
Fang, Y., Christopher-Hennings, J., Brown, E., Liu, H., Chen, Z., Lawson, S. R., Breen, R., Clement, T., Gao, X., Bao, J., Knudsen, D., Daly, R., Nelson, E.
(2008). Development of genetic markers in the non-structural protein 2 region of a US type 1 porcine reproductive and respiratory syndrome virus: implications for future recombinant marker vaccine development. J. Gen. Virol.
89: 3086-3096
[Abstract]
[Full Text]
-
Han, J., Liu, G., Wang, Y., Faaberg, K. S.
(2007). Identification of Nonessential Regions of the nsp2 Replicase Protein of Porcine Reproductive and Respiratory Syndrome Virus Strain VR-2332 for Replication in Cell Culture. J. Virol.
81: 9878-9890
[Abstract]
[Full Text]
-
Johnson, C. R., Yu, W., Murtaugh, M. P.
(2007). Cross-reactive antibody responses to nsp1 and nsp2 of Porcine reproductive and respiratory syndrome virus. J. Gen. Virol.
88: 1184-1195
[Abstract]
[Full Text]
-
Fang, Y., Rowland, R. R. R., Roof, M., Lunney, J. K., Christopher-Hennings, J., Nelson, E. A.
(2006). A Full-Length cDNA Infectious Clone of North American Type 1 Porcine Reproductive and Respiratory Syndrome Virus: Expression of Green Fluorescent Protein in the Nsp2 Region. J. Virol.
80: 11447-11455
[Abstract]
[Full Text]
-
Hanada, K., Suzuki, Y., Nakane, T., Hirose, O., Gojobori, T.
(2005). The Origin and Evolution of Porcine Reproductive and Respiratory Syndrome Viruses. Mol Biol Evol
22: 1024-1031
[Abstract]
[Full Text]
-
Guix, S., Caballero, S., Bosch, A., Pinto, R. M.
(2004). C-Terminal nsP1a Protein of Human Astrovirus Colocalizes with the Endoplasmic Reticulum and Viral RNA. J. Virol.
78: 13627-13636
[Abstract]
[Full Text]
-
Ropp, S. L., Wees, C. E. M., Fang, Y., Nelson, E. A., Rossow, K. D., Bien, M., Arndt, B., Preszler, S., Steen, P., Christopher-Hennings, J., Collins, J. E., Benfield, D. A., Faaberg, K. S.
(2004). Characterization of Emerging European-Like Porcine Reproductive and Respiratory Syndrome Virus Isolates in the United States. J. Virol.
78: 3684-3703
[Abstract]
[Full Text]
-
Hou, Y., Gu, X.-X.
(2003). Development of Peptide Mimotopes of Lipooligosaccharide from Nontypeable Haemophilus influenzae as Vaccine Candidates. J. Immunol.
170: 4373-4379
[Abstract]
[Full Text]
-
Stadejek, T., Stankevicius, A., Storgaard, T., Oleksiewicz, M. B., Belak, S., Drew, T. W., Pejsak, Z.
(2002). Identification of radically different variants of porcine reproductive and respiratory syndrome virus in Eastern Europe: towards a common ancestor for European and American viruses. J. Gen. Virol.
83: 1861-1873
[Abstract]
[Full Text]
-
Oleksiewicz, M. B., Botner, A., Normann, P.
(2002). Porcine B-cells recognize epitopes that are conserved between the structural proteins of American- and European-type porcine reproductive and respiratory syndrome virus. J. Gen. Virol.
83: 1407-1418
[Abstract]
[Full Text]
-
Ostrowski, M., Galeota, J. A., Jar, A. M., Platt, K. B., Osorio, F. A., Lopez, O. J.
(2002). Identification of Neutralizing and Nonneutralizing Epitopes in the Porcine Reproductive and Respiratory Syndrome Virus GP5 Ectodomain. J. Virol.
76: 4241-4250
[Abstract]
[Full Text]