Previous Article | Next Article 
Journal of Virology, March 2001, p. 2566-2574, Vol. 75, No. 6
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.6.2566-2574.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Nuclear Localization and Shuttling of Herpes
Simplex Virus Tegument Protein VP13/14
Michelle
Donnelly and
Gillian
Elliott*
Virus Assembly Group, Marie Curie Research
Institute, The Chart, Oxted, Surrey RH8 0TL, United Kingdom
Received 12 October 2000/Accepted 19 December 2000
 |
ABSTRACT |
The herpes simplex virus type 1 gene UL47 encodes the tegument
proteins referred to collectively as VP13/14, which are believed to be
differentially modified forms of the same protein. Here we show that
the major product of the UL47 gene during transient expression is VP14,
suggesting that some feature of virus infection is required to produce
VP13. We have tagged VP13/14 with green fluorescent protein and have
demonstrated that the protein is targeted efficiently to the nucleus,
where it often localizes in numerous punctate domains. Furthermore, we
show that removal of the N-terminal 127 residues of the protein
abrogates nuclear accumulation, and we have identified a 14-amino-acid
peptide from this region that is sufficient to function as a nuclear
targeting signal and transport a heterologous protein to the nucleus.
This short peptide contains two runs of four arginine residues,
suggesting that the VP13/14 nuclear localization signal may behave in a
manner similar to that of the arginine-rich nuclear localization
signals of the retrovirus transactivator proteins Tat, Rev, and Rex. In addition, by using heterokaryon assays, we show that VP13/14 is capable
of shuttling between the nucleus and cytoplasm of the cell, a property
that may be attributed to three leucine-rich stretches in the
C-terminal half of the protein that again bear similarity to the
nuclear export signals of Rev and Rex. This is the first demonstration
of a tegument protein that is specifically targeted to the nucleus, a
feature which may be relevant both during virus entry, when VP13/14
enters the cell as a component of the tegument, and at later times,
when large amounts of newly synthesized VP13/14 are present within the cell.
 |
INTRODUCTION |
The herpes simplex virus type 1 (HSV-1) proteins VP13 and VP14 are major structural components of the
virion tegument region, the compartment located between the capsid and
the virus envelope (50). Both proteins have been shown to
be encoded by the true late gene UL47 (31, 53), and they
are therefore referred to collectively as protein VP13/14. They have
apparent masses of 82 and 81 kDa, respectively (31) and
have been shown to be posttranslationally modified by phosphorylation,
nucleotidylylation, and glycosylation (2, 33). While the
molecular differences between the two proteins are not yet clear, it
has been suggested that differential modification may account for the
differing migration of VP13 and VP14 upon analysis by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). However, the
only variance that has been reported to date in the activities of the
two products is that VP13 alone binds to the nuclear matrix of infected
cells (44).
Despite being a major structural component, with approximately 1,800 copies in the virion tegument (23), VP13/14 has been shown
to be dispensable for virus replication in tissue culture (1,
53). Furthermore, virions made in the absence of VP13/14 appear
to have increased levels of another tegument protein, VP11/12, suggesting a possible structural redundancy of these two proteins (53). Little is known about the role of HSV-1 VP13/14
during virus infection, but there is some evidence to suggest that it may be involved in the modulation of the activity of the tegument protein VP16, the transactivator of immediate-early (IE) gene expression (6, 20, 39). McKnight and coworkers
(30) have shown that coexpression of the UL47 gene with
the gene for VP16 modulates the ability of VP16 to activate IE
promoters during transient transfection. Moreover, viruses unable to
express VP13/14 appear to be retarded in the early stages of virus
growth, supporting a potential role for the protein in gene expression
(53, 54).
In this study we have investigated the intrinsic properties of VP13/14
in the absence of other viral proteins by fusion of the UL47 gene to
the C terminus of green fluorescent protein (GFP). We show that
GFP-13/14 localizes efficiently to the cell nucleus and exhibits a
diverse range of intranuclear patterns. In addition, we identify a
14-residue nuclear localization signal (NLS) at the N terminus of
VP13/14 which is both necessary and sufficient to direct a heterologous
protein to the nucleus. Thus, VP13/14 is the first NLS-containing
tegument protein to be described. Finally, by using heterokaryon
assays, we show that VP13/14 not only localizes to the nucleus but also
is capable of shuttling between the nucleus and cytoplasm, a feature
that is consistent with a role in the regulation of gene expression.
 |
MATERIALS AND METHODS |
Cells and viruses.
Vero cells, BHK cells, and COS-1 cells
were grown in Dulbecco's modified minimal essential medium
supplemented with 10% newborn calf serum. The HSV-1 strain 17 was used
for infections and virion purification.
Plasmids.
The UL47 open reading frame, including both the
start methionine and the stop codon, was amplified by PCR from HSV-1
genomic DNA using primers which incorporated BamHI sites at
both ends. (forward primer, CGCGGATCCCCCGCGTCTATCGCCACC;
reverse primer; GCGGGATCCCGGCAGCACGGGCGGAGG). This
product was digested with BamHI and inserted into the
BamHI sites of pEGFP-C1 (Clontech), pCMV19aSV5, and
pcDNA1.Amp (Invitrogen) to create plasmids pMD10, encoding GFP-13/14, pMD12, encoding SV-5-tagged VP13/14, and pMD13, encoding wild-type (Wt) VP13/14. Plasmid pMD10.
Sac, which lacks residues 1 to
187 of VP13/14, was constructed by digesting pMD10 with
SacI, removing the 3' overhangs from the large fragment, and
religating. Residues 1 to 127 of VP13/14 were deleted by digesting
pMD10 with SalI and religating the larger fragment,
resulting in pMD10.
Sal, while residues 1 to 36 were removed by
digesting pMD10 with KpnI and end-filling the larger
fragment prior to religation to form pMD10.
Kpn. To produce the
series of plasmids expressing GFP-13/14 with mutated NLS sequences, a
range of overlapping PCRs was carried out on the N terminus of the UL47
gene, and the PCR products were inserted back into plasmid pMD10. This
resulted in plasmids pMD14 (R63 through R66 to
G), pMD15 (R72 through R75 to G), and pMD16
(R63 through R66 to G and R72
through R75 to G). The series of GFP-NLS constructs,
containing various sequences of the N terminus of VP13/14 fused to GFP,
was made as follows. The N-terminal 92, 76, 68, or 22 codons of the
UL47 gene were amplified by PCR and inserted into the BamHI
site of pEGFPC1 to make plasmids NLS1+2+3+, NLS1+2+3, NLS1+2, and NLS1,
respectively. Plasmid NLS1+3 was made by PCR amplification of the
N-terminal 76 codons of UL47 from pMD14, which were inserted as an
EcoRI/BamHI fragment into pEGFPC2 (Clontech). For
plasmids NLS2 and NLS2+3, double-stranded oligonucleotide adapters
encoding either residues 63 to 72 or residues 63 to 76 were made and
inserted into the pEGFPC1 multiple cloning site. Plasmids pCDNA3
myc-hnRNPA1 and pCDNA3 myc-hnRNPC1 were kindly provided by Gideon
Dreyfuss, University of Pennsylvania.
Antibodies.
The polyclonal anti-VP13/14 antibody R220,
kindly provided by David Meredith, was used at dilutions of 1:5,000 for
Western blotting and 1:400 for immunofluorescence. The polyclonal
antibody against GFP (RDI) was used at a dilution of 1:1,000 for
Western blotting and 1:600 for immunofluorescence. The monoclonal
antibody 336 (kindly provided by Rick Randall, University of St.
Andrews) against the SV5 epitope tag was used at a dilution of 1:2,000 for immunofluorescence. The monoclonal anti-myc antibody
(Invitrogen) against the myc epitope tag was used at a
dilution of 1:1,000 for immunofluorescence.
Transfections.
COS-1 cells were plated onto six-well dishes
at a density of 3 × 105 per well for Western
blotting. For live-cell analysis of GFP-expressing cells, COS-1 cells
were plated into two-well coverslip chambers (Life Technologies) at a
density of 105 per chamber. DNA transfection mixtures,
consisting of 200 ng of expression plasmid made up to 2 µg with pUC19
DNA, were transfected by the calcium phosphate precipitation technique
modified by substitution of BES
[N,N-bis(2-hydroxyl)-2-aminoethanesulfonic
acid]-buffered saline for HEPES-buffered saline. Transfected cells
were analyzed 40 h posttransfection unless otherwise stated.
Western blot analysis.
Proteins were separated by
electrophoresis through SDS-polyacrylamide gels cross-linked with
bisacrylamide. Gels were transferred to nitrocellulose filters for
Western blotting and reacted with an appropriate antibody. A
horseradish peroxidase-linked secondary conjugate was used, and
reactive bands were visualized by development with enhanced
chemiluminescence (ECL) detection reagents (Amersham).
Virion purification.
Virions were purified from
extracellular virus released into the infected cell medium as described
previously (14).
Heterokaryon assays.
Interspecies heterokaryons of COS-1 and
mouse NIH 3T3 cells were formed as described previously
(45). Briefly, COS-1 cells seeded at 106 per
25-cm2 flask were transfected with 6 µg of plasmid DNA.
Twenty-four hours posttransfection the COS-1 cells were seeded on 16-mm
glass coverslips in a six-well tray, and after overnight incubation these cultures were then seeded with an equal number of untransfected NIH 3T3 cells. The coculture was incubated for 3.5 h in the
presence of 50 µg of cycloheximide/ml and for 30 min in the presence
of 100 µg of cycloheximide/ml. After being fused with 50%
polyethylene glycol for 2 min, cells were washed and returned to medium
containing 100 µg of cycloheximide/ml for a further 4 h.
Immunofluorescence and microscopy.
Cells were fixed in 4%
paraformaldeyde in phosphate-buffered saline (PBS) for 20 min, washed
in PBS, and then permeabilized with 0.5% Triton X-100 in PBS for 10 min before washing with PBS. Fixed cells were blocked by incubation
with PBS containing 10% calf serum for 20 min at room temperature.
Primary antibody was added in the same solution and was incubated for
20 min at room temperature. After a wash with PBS, secondary antibodies
were added in PBS-10% calf serum and incubated for 20 min at room
temperature. Coverslips were washed with PBS prior to mounting in
Vectashield alone or Vectashield with added
4',6'-diamidino-2-phenylindole (DAPI) (both from Vector Laboratories).
Samples were analyzed using either a Zeiss LSM 410 inverted confocal
microscope or a Photometrics Quantix digital camera on an Axiovert S100
TV inverted microscope. Images were processed using Adobe Photoshop software.
 |
RESULTS |
VP14 is the major product of the UL47 gene in transfected
cells.
While VP13 and VP14 have previously been identified as
alternative products of the UL47 gene in virus-infected cells, we
wanted to determine if both proteins would be expressed from this gene in the absence of other virus gene products. Thus, COS-1 cells were
first transfected with the UL47 expression vector pMD13 and then
analyzed by Western blotting with the VP13/14-specific antibody R220
(Fig. 1). Comparison of the
pMD13-expressing cells with both HSV-1-infected cells and purified
virions revealed that the major product of the transiently transfected
UL47 gene was of the same molecular weight as the faster-migrating VP14
(Fig. 1A). However, upon longer exposure, small quantities of the
slower-migrating VP13 were also detectable in the UL47-transfected
cells, albeit at much lower levels than in infected cells (data not
shown). This suggests that some additional feature of virus infection is required in order to express high levels of VP13. It is also noteworthy that in our hands the VP13/14 doublet exhibits an apparent size of 72 to 74 kDa, somewhat smaller than the previously published size of 81 to 82 kDa (31). Interestingly, transfection and
expression of the plasmid pMD12, carrying the UL47 gene with a 5'
terminal SV5 epitope tag, results in a protein of the correct size for SV5-tagged VP14 (Fig. 1B, SV5-13/14), suggesting that VP14 is not the
result of an internal initiation event but is probably differentially
modified in comparison to VP13.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of the UL47 gene by transient transfection.
(A) COS-1 cells were transfected with either pUC19 (mock) or plasmid
pMD13 carrying the UL47 gene (transfected). Total cell lysates from
these transfections and from infected Vero cells (infected), together
with purified extracellular virus particles (virion), were analyzed by
Western blotting with the anti-VP13/14 antibody R220. (B) Total cell
lysates from COS-1 cells transfected with either plasmid pMD12
(SV5-13/14) or plasmid pMD10 (GFP-13/14), together with purified
extracellular virus particles (virion), were analyzed by Western
blotting with the anti-VP13/14 antibody R220.
|
|
GFP-13/14 is directed to the nuclei of transfected cells.
We
next addressed the question of VP13/14 cellular localization by
constructing plasmid pMD10, which carries the gene encoding GFP fused
in frame to the 5' terminus of the UL47 gene. Western blotting of COS-1
cells expressing this fusion protein demonstrated that the resulting
product was approximately the correct molecular weight of 110 kDa (Fig.
1B, GFP-13/14). To examine the cellular localization patterns of
GFP-13/14, we then transfected COS-1 cells with either the GFP-13/14
expression vector or the unfused GFP expression vector pEGFPC1 and
examined the cells live (Fig. 2). As
expected, COS-1 cells transfected with the plasmid encoding GFP alone
displayed a pattern of diffuse fluorescence throughout both the
cytoplasm and the nucleus (Fig. 2A). By contrast, in cells expressing
GFP-13/14, GFP fluorescence was localized entirely within the cell
nuclei (Fig. 2B to E), where it exhibited a range of patterns. In some
nuclei the protein appeared diffuse and either was excluded from the
nucleoli (Fig. 2B) or accumulated in the nucleoli (Fig. 2C). In other
nuclei GFP-13/14 was concentrated in either multiple speckled domains
(Fig. 2D) or much larger punctate domains ranging in size from 0.3 to
0.6 µm (Fig. 2E). Interestingly, these larger punctate domains could
also be seen as phase-dense spherical structures when the cells were
examined by light microscopy, and in some cells large "doughnut"
structures were evident. We believe that the heterogeneity displayed by
GFP-13/14 is a reflection of the relative expression levels in
individual cells, with the diffuse patterns representing low-level
expression and the punctate patterns representing high-level
expression.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 2.
Subcellular localization of GFP-13/14 expressed by
transient transfection. COS-1 cells were transfected with plasmids
expressing either unfused GFP (A) or GFP-13/14 (B to E). The cells were
examined live by confocal microscopy 40 h after transfection.
(Bottom right) Phase-contrast image of the same field as in panel E.
|
|
VP13/14 contains a nuclear localization signal within its N
terminus.
The classical monopartite and bipartite NLSs are basic,
lysine-rich regions (19, 38). However, an inspection of
the amino acid sequence of VP13/14 revealed that although there was no
such region in VP13/14, there were three groups of four consecutive arginine residues toward the N terminus of the protein at amino acid
positions 9 to 12, 63 to 66, and 72 to 75, which we have termed NLS1,
NLS2, and NLS3, respectively (Fig. 3A,
Wt). Moreover, in contrast to the classical NLSs described above, the
nuclear import signals for human immunodeficiency virus type 1 (HIV-1) Rev, HIV-1 Tat, and human T-cell lymphotropic virus type 1 (HTLV-1) Rex
have previously been shown to consist of arginine-rich domains (21, 22, 27, 48, 49). In an attempt to determine if any or
all of the VP13/14 arginine clusters are involved in the nuclear
localization of the protein, three gross deletions were made within the
GFP-13/14 fusion protein toward the N terminus of VP13/14, resulting in
plasmids which expressed proteins lacking the first 187 residues, the
first 127 residues, or the first 36 residues, fused to GFP (Fig. 3A).
These constructs were transfected into COS-1 cells, and the subcellular
distribution of the GFP fusion proteins was examined 40 h after
transfection by direct fluorescence of live cells (Fig. 3B).
Strikingly, removal of the first 187 residues from VP13/14 abrogated
the nuclear accumulation of the GFP fusion protein (Fig. 3B, compare Wt
and
1-187). Moreover, the fusion protein lacking only the first 127 residues of VP13/14 was also unable to accumulate within the nucleus
(Fig. 3B,
1-127). By contrast, however, deletion of the first 36 N-terminal amino acids from VP13/14, which removes the NLS1 sequence,
did not affect the nuclear targeting of GFP-13/14, (Fig. 3B,
1-36),
suggesting that the residues R9 through R12 are
not required for nuclear localization.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
The N terminus of VP13/14 is required for nuclear
localization. (A) Schematic diagram of the GFP-13/14 fusion protein
(Wt) and the deletion mutants lacking the first 187 ( 1-187), 127 ( 1-127), or 36 ( 1-36) residues of the VP13/14 open reading
frame. The potential NLS and NES sequences are shown as solid and
shaded boxes, respectively. (B) The four constructs diagrammed in panel
A were transfected into COS-1 cells and examined live by confocal
microscopy 40 h after transfection.
|
|
Point mutations in VP13/14 identify a sequence within residues 63 to 75 as necessary for nuclear localization.
Although the above
results suggest that the region between amino acids 37 and 127 of
VP13/14 containing NLS1 and NLS2 is responsible for nuclear
localization of the protein, we could not rule out the possibility that
the entire protein conformation was disrupted by these gross deletions.
In order to determine more specifically the amino acids involved, we
carried out site-directed mutagenesis within this region, resulting in
three constructs in which the arginine residues of NLS2, NLS3, or both
NLS2 and NLS3 were mutated to glycine residues (Fig.
4A). Following transfection of COS-1 cells, the subcellular distribution of GFP-13/14 and the GFP-13/14 mutants was examined 40 h posttransfection by direct fluorescence of live cells (Fig. 4B). While mutation of NLS2 reduced the efficiency of nuclear targeting compared to that of the Wt, the fusion protein was
still predominantly nuclear, with a small amount present in the
cytoplasm (Fig. 4B, compare Wt and
NLS2). Furthermore, mutation of
NLS3 had no effect on the nuclear accumulation of GFP-13/14 (Fig. 4B,
compare Wt and
NLS3). However, mutation of both arginine motifs
resulted in a fusion protein that was not targeted to the nucleus but
instead accumulated within the cytoplasm (Fig. 4B,
NLS2+3). The
majority of cells expressing this protein displayed a pattern of
fluorescence in which the mutated fusion protein was excluded from the
nucleus, but there was also a small population of cells that displayed
a weak nuclear speckled pattern on top of the cytoplasmic material
(Fig. 4B,
NLS2+3). This may be due to an expressing cell having
progressed through cell division and hence having allowed the mutated
GFP-13/14 access to nuclear material following nuclear membrane
breakdown. Thus, while either NLS2 or NLS3 can be mutated without
severely altering the nuclear localization of GFP-13/14, mutation of
both sequences abolishes this targeting. This suggests that nuclear
localization of GFP-13/14 requires at least one of these arginine
motifs.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 4.
Point mutation of both NLS2 and NLS3 abrogates nuclear
localization of VP13/14. (A) Schematic diagram of the GFP-13/14 fusion
protein (Wt) and the mutants in which arginine residues have been
mutated to glycine residues for NLS2 alone ( NLS2), NLS3 alone
( NLS3), or both NLS2 and NLS3 ( NLS2+3). The clusters of arginine
residues are shown as solid boxes. (B) The four constructs diagrammed
in panel A were transfected into COS-1 cells and examined live by
confocal microscopy 40 h after transfection.
|
|
A 14-amino-acid sequence from VP13/14 is sufficient to direct GFP
to the cell nucleus.
To define the minimal sequence of VP13/14
that is required for nuclear targeting, a series of plasmids encoding
GFP fused to a range of short N-terminal peptides of VP13/14 was
constructed (Fig. 5A). These plasmids
were transfected into COS-1 cells, and the subcellular
distribution of GFP fusion proteins was examined 40 h
posttransfection by direct fluorescence of live cells (Fig. 5B). Fusion
of GFP to residues 1 to 92 (NLS1+2+3+) or 1 to 76 (NLS1+2+3), which
both include all three NLS sequences, resulted in the efficient
relocalization of GFP from its characteristic pattern throughout the
cell (Fig. 5B, unfused GFP) to the nucleus (Fig. 5B, NLS1+2+3+ and
NLS1+2+3), confirming that residues 1 to 76 of VP13/14 contain a
discrete nuclear targeting signal. Furthermore, as expected from our
previous results, GFP fused to residues 1 to 22 (NLS1) was not capable
of nuclear localization, confirming that the NLS1 sequence is not
sufficient for nuclear targeting by itself (compare Fig. 5B, NLS1, with
Fig. 4B,
NLS2+3). Likewise, fusion of the NLS2 sequence (residues 63 to 72) to GFP was not sufficient to direct GFP to the nucleus (Fig. 5B,
NLS2). By contrast, GFP fused to either residues 1 to 68 (NLS1+2)
or residues 63 to 76 (NLS2+3) was localized predominantly to the nucleus (Fig. 5B, NLS1+2 and NLS2+3), although in both cases there was
still some protein in the cytoplasm. Surprisingly, however, mutation of
NLS2 within the region spanning residues 1 to 76, such that only NLS1
and NLS3 are present, resulted in a protein that was unable to localize
to the nucleus (Fig. 5B, NLS1+3). This is in contrast to the same
mutation present in the context of the full-length protein, which was
predominantly localized in the nucleus (see Fig. 4B,
NLS2), and may
imply that this region of the protein is presented differently when
expressed in the full-length protein. Alternatively, there may be
additional redundant NLS sequences downstream in VP13/14 that can
function in the absence of NLS2. Taken together, the above results
indicate that a region as small as 14 residues originating from the N
terminus of VP13/14, containing NLS2 and NLS3, is sufficient to
function as a nuclear targeting signal and direct a heterologous
protein to the nucleus. Furthermore, NLS2 appears to be essential for
nuclear targeting in the context of the N-terminal 76 residues of
VP13/14 but also requires an additional arginine motif, either NLS1 or
NLS3, to cause relocalization of GFP to the nucleus. Interestingly, the GFP fusion proteins were localized to the nucleoli of expressing cells
only when NLS3 was present together with NLS2 (Fig. 5B, compare NLS1+2
with NLS1+2+3+, NLS1+2+3, and NLS2+3), suggesting that NLS3 may be
required for nucleolar targeting of the protein. Finally, none of these
small fusion proteins localized to the characteristic punctate domains
exhibited by full-length GFP-13/14, implying that the sequences
involved in this intranuclear targeting are present on another region
of the protein.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 5.
A 14-amino-acid peptide from VP13/14 functions as an
NLS. (A) Schematic diagram of the GFP fusion constructs used to
identify the VP13/14 NLS. The names of the constructs are shown on the
left, and the VP13/14 residues fused to GFP are given on the right. The
NLS clusters of arginines are shown as solid boxes. (B) The constructs
diagrammed in panel A were transfected into COS-1 cells and examined
live by confocal microscopy 40 h after transfection.
|
|
VP13/14 is capable of nuclear shuttling in an interspecies
heterokaryon assay.
The similarity of the VP13/14 nuclear
targeting signal to that of the HIV-1 Rev protein, a known nuclear
shuttling protein (46), prompted us to examine the VP13/14
sequence for potential nuclear export signals (NESs). We found several
leucine-rich regions toward the C terminus of VP13/14 (Fig. 3A, Wt)
which were similar to the NES of Rev (34), and we
therefore examined the activity of GFP-13/14 for potential nuclear
export. This was carried out using a heterokaryon assay, whereby COS-1
cells expressing the protein of interest were fused to an equivalent
number of NIH 3T3 cells to form interspecies heterokaryons, in the
presence of the protein synthesis inhibitor cycloheximide. At the end
of the assay the cells were stained with DAPI to differentiate mouse and monkey nuclei; then they were examined for the presence of our test
protein in the mouse nuclei (Fig. 6), and
cell counts were carried out (Table 1).
To determine that the assay was working correctly, COS-1 cells were
first transfected with either an expression vector for the cellular
protein hnRNPA1, which is known to shuttle efficiently
(45), or an expression vector for the cellular protein hnRNPC1, which does not shuttle (37); both of these were
Myc tagged. Fusion of the Myc-hnRNPA1 expressing cells to the mouse cells resulted in a large number of mouse cell nuclei containing the
Myc-hnRNPA1 protein (Fig. 6A and Table 1). By contrast, the vast
majority of mouse cell nuclei fused to Myc-hnRNPC1 expressing cells
contained no Myc-tagged hnRNPC1 protein, confirming that our assay was
functioning correctly (Fig. 6B and Table 1). When the same experiment
was carried out with SV5-tagged VP13/14, we were able to detect the
virus protein in a high percentage of mouse cell nuclei, albeit at a
low level in comparison to that with the positive control, hnRNPA1
(Fig. 6C and Table 1). Moreover, fusion of mouse cells to
GFP-13/14-expressing cells also resulted in the presence of GFP-13/14
in the nonexpressing mouse nuclei, as detected by either
immunofluorescence with an anti-GFP antibody (Fig. 6D,
-GFP) or
direct GFP fluorescence (Fig. 6D, GFP fl., and Table 1). These
results suggest that the HSV-1 tegument protein VP13/14 is capable of
nuclear shuttling, and while the level of protein detectable in the
mouse nuclei of the heterokaryons was somewhat low in comparison to
that with the positive control, the number of nuclei in which the
protein was detected was consistently high (Table 1).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
VP13/14 is capable of nuclear shuttling. Heterokaryon
assays were carried out between mouse NIH 3T3 cells and monkey COS-1
cells expressing either Myc-hnRNPA1 (A), Myc-hnRNPC1 (B), SV5-13/14
(C), or GFP-13/14 (D). In each case the cells were fixed and stained
with either anti-Myc (A and B), anti-SV5 tag (C), or anti-GFP (D)
antibodies. In the case of GFP-13/14, the cells were also examined for
intrinsic GFP fluorescence (D, GFP fl.). Mouse cells (arrowed in all
examples) were identified by their speckled nuclei when stained with
DAPI.
|
|
 |
DISCUSSION |
The group of proteins which make up the tegument of the
herpesvirus particle have been poorly studied with regard to both their
individual functions during virus replication and the roles they may
play in virus entry and/or egress. Here we have investigated the
cellular localization of the tegument protein VP13/14 by means of
transient expression of a GFP-13/14 fusion protein and have shown that
this protein localizes efficiently to the nucleus. Moreover, in a paper
accompanying this report, we have shown that VP13/14 is also targeted
to the nucleus throughout the major part of the virus infectious cycle,
confirming that this subcellular localization is reproduced during
infection (11). The intrinsic targeting of VP13/14 may be
indicative of a function for this protein within the nucleus, as has
been suggested by the range of indirect evidence supporting a role for
the protein in IE gene expression (30, 53, 54).
Furthermore, our results are in agreement with the findings of previous
immunofluorescence studies of infected cells which have also shown
VP13/14 localized in the nucleus at early stages of infection
(35).
It is noteworthy that VP13/14 is the first tegument protein shown to
possess an NLS within its structure. By contrast, we have previously
shown that the tegument protein VP22 localizes predominantly to the
cytoplasm during both virus infection and transient expression
(14, 15), although it does enter the nucleus under certain
conditions (15). In addition, the tegument protein VP16,
which is known to transactivate the virus IE genes within the nucleus,
exhibits no particular targeting to the nucleus when expressed
transiently (13, 25). Nonetheless, VP16 does localize
efficiently to the nucleus during the early stages of its expression in
virus infection (26, 35), a feature which has been
attributed to its interaction with the host cell protein HCF (25,
26). Our demonstration that VP13/14 is targeted to the nucleus,
together with the evidence that VP13/14 may modulate the
transactivation function of VP16 (30, 54), raises the possibility that VP13/14 may in some way be involved in VP16 import into the nucleus. For example, Morrison and coworkers have suggested that as the virus enters the cell both VP16 and VP13/14 dissociate from
the tegument by means of phosphorylation by a virus-encoded kinase
(36). Thus, input VP13/14 could help to direct input VP16
to the nucleus, where it would be free to transactivate the IE genes.
However, it remains to be determined whether VP13/14 can directly
interact with VP16.
The NLS of VP13/14 is located within the N-terminal 127 residues of the
protein. In this region there are at least three clusters of arginine
residues, none of which can function as a nuclear targeting signal by
itself. However, we have shown that two of these clusters located
within the 14 residues between amino acids 63 and 76 are sufficient to
direct either VP13/14 or a heterologous protein to the nucleus. We also
believe that there may be an element of redundancy between these
arginine clusters, as various combinations of the sequences are able to
function as nuclear targeting signals, at least in the context of
the full-length protein. The arginine-rich nature of the VP13/14
NLS suggests that it is not related to the classical mono- and
bipartite NLS sequences first defined for proteins such as the simian
virus 40 (SV40) large T antigen, most of which are made up of
lysine-rich regions (19, 38), but that it is a member of
the class of NLSs described for proteins such as HIV-1 Rev and Tat and
HTLV-1 Rex (21, 22, 27, 48, 49). Moreover, the VP13/14
NLSs share homology with those from the retrovirus transactivators
(Fig. 7A). While classical NLSs import
into the nucleus via interaction with the cellular importin
/
complex (19, 38), the arginine-rich NLSs have recently been shown to import by direct interaction with importin
, with no
apparent requirement for importin
(42, 52).
Furthermore, Ojala and coworkers have recently suggested that HSV-1
capsid-tegument structures are directed to the nucleus by an importin
binding protein during virus entry into the cell (40).
Thus, as VP13/14 is a major component of the virus tegument and has the
characteristics of an importin
binding protein, it would be a good
candidate for such a role during infection.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
(A) Alignment of the arginine-rich clusters of VP13/14
with the known NLS sequences from HIV-1 and HIV-2 Rev
(21), HIV-1 Tat (22), and HTLV-1 Rex
(49). Arginine and lysine residues are boldfaced. (B)
Alignment of the three leucine-rich regions of VP13/14 with the known
NES sequences from HIV-1 Rev (34), HTLV-1 Rex
(3), HSV-1 ICP27 (32), and the Epstein-Barr
virus (EBV) Sm protein (5). Leucine residues are
boldfaced.
|
|
An additional feature of the arginine-rich regions of retroviral NLSs
is their ability to bind directly to RNA (9, 10, 28, 47).
Furthermore, Rev and Rex shuttle between the nucleus and the cytoplasm
(24, 46), thereby transporting their bound RNA out of the
nucleus (18). Export of the retroviral proteins from the
nucleus is controlled by their leucine-rich NESs (8, 17,
34), which have been shown to bind the cellular protein exportin
1 (CRM-1) to facilitate transport through the nuclear pore complex
(51). In our studies on VP13/14 we have not only identified several leucine-rich regions in the C-terminal half of the
protein but have shown from our preliminary heterokaryon assays that
VP13/14 is also capable of nuclear shuttling. While it will be
necessary to define the export signal more closely by means of
mutational analysis, the VP13/14 leucine-rich regions share some
homology with other known NESs (Fig. 7B) and may therefore be
functional. Thus, VP13/14 joins a growing number of proteins, both
viral and cellular, whose steady-state localization is nuclear but
which have been shown by various assays to shuttle rapidly between the
nucleus and cytoplasm (3-5, 32, 43, 45, 46). As the vast
majority of these proteins appear to be involved in the transport of
RNA from the nucleus, it would be of interest to determine if VP13/14
also has a role as an RNA binding protein and is involved in
virus-specific RNA transport.
One of the most striking features of VP13/14 localization is its
targeting to multiple punctate domains within the nuclei of expressing
cells. This pattern is displayed only by the full-length protein and
not by any of the GFP-NLS constructs, suggesting that the signal for
targeting to these domains is present outside the arginine-rich region.
Moreover, the relationship between the punctate domains and nuclear
shuttling is not yet known. It is also noteworthy that in our
accompanying paper we show that VP13/14 localizes to similar domains
during virus infection, albeit fewer than are usually seen in a
transiently expressing cell (11). This punctate pattern is
similar to that observed during transient expression of the HSV IE gene
IE110 (7, 41), where it has been shown that a subset of
the IE110 nuclear domains represent the cellular ND10s (16,
29). However, immunostaining of our VP13/14-expressing cells
with an antibody against PML, a component of ND10s (12), has revealed that none of the VP13/14 punctate domains correspond to
ND10s (data not shown). It therefore remains to be determined if the
VP13/14 domains are in any way related to the rest of the non-ND10
IE110 domains, either in transient expression or during virus infection.
From our results presented here it is clear that many aspects of
VP13/14 behavior remain to be addressed. However, the fact that this
protein is not essential to virus growth in tissue culture (1,
54) suggests that its role may be that of an accessory protein
that enables the virus to replicate efficiently by the enhancement of
certain steps in the virus life cycle without being absolutely required.
 |
ACKNOWLEDGMENTS |
We thank David Meredith for the anti-VP13/14 antibody, Rick
Randall for the anti-SV5 epitope tag antibody, and Gideon Dreyfuss for
the hnRNPA1- and hnRNPC1-encoding plasmids.
This work was funded by Marie Curie Cancer Care.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Virus Assembly
Group, Marie Curie Research Institute, The Chart, Oxted, Surrey RH8 0TL, United Kingdom. Phone: 441883 722306. Fax: 441883 714375. E-mail:
g.elliott{at}mcri.ac.uk.
 |
REFERENCES |
| 1.
|
Barker, D. E., and B. Roizman.
1990.
Identification of three genes nonessential for growth in cell culture near the right terminus of the unique sequences of long component of herpes simplex virus 1.
Virology
177:684-691[CrossRef][Medline].
|
| 2.
|
Blaho, J. A.,
C. Mitchell, and B. Roizman.
1994.
An amino acid sequence shared by the herpes simplex virus 1 alpha regulatory proteins 0, 4, 22 and 27 predicts the nucleotidylation of the UL21, UL31, UL47 and UL49 gene products.
J. Biol. Chem.
269:17401-17410[Abstract/Free Full Text].
|
| 3.
|
Bogerd, H. P.,
R. A. Fridell,
R. E. Benson,
J. Hua, and B. R. Cullen.
1996.
Protein sequence requirements for function of the human T-cell leukemia virus type 1 Rex nuclear export signal delineated by a novel in vivo randomization-selection assay.
Mol. Cell. Biol.
16:4207-4214[Abstract].
|
| 4.
|
Borer, R. A.,
C. F. Lehner,
H. M. Eppenberger, and E. A. Nigg.
1989.
Major nucleolar proteins shuttle between nucleus and cytoplasm.
Cell
56:379-390[CrossRef][Medline].
|
| 5.
|
Boyle, S. M.,
V. Ruvolo,
A. K. Gupta, and S. Swaminathan.
1999.
Association with the cellular export receptor CRM 1 mediates function and intracellular localization of Epstein-Barr virus SM protein, a regulator of gene expression.
J. Virol.
73:6872-6881[Abstract/Free Full Text].
|
| 6.
|
Campbell, M. E.,
J. W. Palfreyman, and C. M. Preston.
1984.
Identification of herpes simplex virus DNA sequences which encode a trans-acting polypeptide responsible for stimulation of immediate early transcription.
J. Mol. Biol.
180:1-19[CrossRef][Medline].
|
| 7.
|
Ciufo, D. M.,
M. A. Mullen, and G. S. Hayward.
1994.
Identification of a dimerization domain in the C-terminal segment of the IE110 transactivator protein from herpes simplex virus.
J. Virol.
68:3267-3282[Abstract/Free Full Text].
|
| 8.
|
Cullen, B. R.
1998.
Retroviruses as model systems for the study of nuclear RNA export pathways.
Virology
249:203-210[CrossRef][Medline].
|
| 9.
|
Daly, T. J.,
K. S. Cook,
G. S. Gray,
T. E. Maione, and J. R. Rusche.
1989.
Specific binding of HIV-1 recombinant Rev protein to the Rev-responsive element in vitro.
Nature
342:816-819[CrossRef][Medline].
|
| 10.
|
Dingwall,
C. I. Ernberg,
M. J. Gait,
S. M. Green,
S. Heaphy,
J. Karn,
A. D. Lowe,
M. Singh,
M. A. Skinner, and R. Valerio.
1989.
Human immunodeficiency virus 1 Tat protein binds trans-activation-responsive region (TAR) RNA in vitro.
Proc. Natl. Acad. Sci. USA
86:6925-6929[Abstract/Free Full Text].
|
| 11.
|
Donnelly, M., and G. Elliott.
2001.
Fluorescent tagging of the herpes simplex virus tegument protein VP13/14 in virus infection.
J. Virol.
75:2575-2583[Abstract/Free Full Text].
|
| 12.
|
Dyck, J. A.,
G. G. Maul,
W. J. Miller,
J. D. Chen,
A. Kakizuka, and R. M. Evans.
1994.
A novel macromolecular structure is a target of the promyelocyte-retinoic acid receptor oncoprotein.
Cell
76:333-343[CrossRef][Medline].
|
| 13.
|
Elliott, G.,
G. Mouzakitis, and P. O'Hare.
1995.
VP16 interacts via its activation domain with VP22, a tegument protein of herpes simplex virus, and is relocated to a novel macromolecular assembly in coexpressing cells.
J. Virol.
69:7932-7941[Abstract].
|
| 14.
|
Elliott, G., and P. O'Hare.
1999.
Live-cell analysis of a green fluorescent protein-tagged herpes simplex virus infection.
J. Virol.
73:4110-4119[Abstract/Free Full Text].
|
| 15.
|
Elliott, G., and P. O'Hare.
2000.
Cytoplasm-to-nucleus translocation of a herpesvirus tegument protein during cell division.
J Virol.
74:2131-2141[Abstract/Free Full Text].
|
| 16.
|
Everett, R. D., and G. G. Maul.
1994.
HSV-1 IE protein Vmw110 causes redistribution of PML.
EMBO J.
13:5062-5069[Medline].
|
| 17.
|
Fischer, U.,
J. Huber,
W. C. Boelens,
I. W. Mattaj, and R. Luhrmann.
1995.
The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs.
Cell
82:475-483[CrossRef][Medline].
|
| 18.
|
Fischer, U.,
S. Meyer,
M. Teufel,
C. Heckel,
R. Luhrmann, and G. Rautmann.
1994.
Evidence that HIV-1 Rev directly promotes the nuclear export of unspliced RNA.
EMBO J.
13:4105-4112[Medline].
|
| 19.
|
Gorlich, D., and I. W. Mattaj.
1996.
Nucleocytoplasmic transport.
Science
271:1513-1518[Abstract].
|
| 20.
|
Greaves, R., and P. O'Hare.
1989.
Separation of requirements for protein-DNA complex assembly from those for functional activity in the herpes simplex virus regulatory protein Vmw65.
J. Virol.
63:1641-1650[Abstract/Free Full Text].
|
| 21.
|
Hammerschmid, M.,
D. Palmeri,
M. Ruhl,
H. Jaksche,
I. Weichselbraun,
E. Bohnlein,
M. H. Malim, and J. Hauber.
1994.
Scanning mutagenesis of the arginine-rich region of the human immunodeficiency virus type 1 Rev trans-activator.
J. Virol.
68:7329-7335[Abstract/Free Full Text].
|
| 22.
|
Hauber, J.,
M. H. Malim, and B. R. Cullen.
1989.
Mutational analysis of the conserved basic domain of human immunodeficiency virus Tat protein.
J. Virol.
63:1181-1187[Abstract/Free Full Text].
|
| 23.
|
Heine, J. W.,
R. W. Honess,
E. Cassai, and B. Roizman.
1974.
Proteins specified by herpes simplex virus. XII. The virion polypeptides of type 1 strains.
J. Virol.
14:640-651[Abstract/Free Full Text].
|
| 24.
|
Kubota, S.,
M. Hatanaka, and R. J. Pomerantz.
1996.
Nucleo-cytoplasmic redistribution of the HTLV-I Rex protein: alterations by coexpression of the HTLV-I p21x protein.
Virology
220:502-507[CrossRef][Medline].
|
| 25.
|
LaBoissiere, S.,
T. Hughes, and P. O'Hare.
1999.
HCF-dependent nuclear import of VP16.
EMBO J.
18:480-489[CrossRef][Medline].
|
| 26.
|
LaBoissiere, S., and P. O'Hare.
2000.
Analysis of HCF, the cellular cofactor of VP16, in herpes simplex virus-infected cells.
J. Virol.
74:99-109[Abstract/Free Full Text].
|
| 27.
|
Malim, M. H.,
S. Bohnlein,
J. Hauber, and B. R. Cullen.
1989.
Functional dissection of the HIV-1 Rev trans-activator derivation of a trans-dominant repressor of Rev function.
Cell
58:205-214[CrossRef][Medline].
|
| 28.
|
Malim, M. H.,
L. S. Tiley,
D. F. McCarn,
J. R. Rusche,
J. Hauber, and B. R. Cullen.
1990.
HIV-1 structural gene expression requires binding of the Rev trans-activator to its RNA target sequence.
Cell
60:675-683[CrossRef][Medline].
|
| 29.
|
Maul, G. G., and R. D. Everett.
1994.
The nuclear location of PML, a cellular member of the C3HC4 zinc-binding domain protein family, is rearranged during herpes simplex virus infection by the C3HC4 viral protein ICP0.
J. Gen. Virol.
75:1223-1233[Abstract/Free Full Text].
|
| 30.
|
McKnight, J. L. C.,
P. E. Pellet,
F. J. Jenkins, and B. Roizman.
1987.
Characterization and nucleotide sequence of two herpes simplex virus 1 genes whose products modulate -trans-inducing-factor-dependent activation of genes.
J. Gen. Virol.
61:1531-1574.
|
| 31.
|
McLean, G.,
F. Rixon,
N. Langeland,
L. Haarr, and H. Marsden.
1990.
Identification and characterization of the virion protein products of herpes simplex virus type 1 gene UL47.
J. Gen. Virol.
71:2953-2960[Abstract/Free Full Text].
|
| 32.
|
Mears, W. E., and S. A. Rice.
1998.
The herpes simplex virus immediate-early protein ICP27 shuttles between nucleus and cytoplasm.
Virology
242:128-137[CrossRef][Medline].
|
| 33.
|
Meredith, D. M.,
J. A. Lindsay,
I. W. Halliburton, and G. R. Whittaker.
1991.
Post-translational modification of the tegument proteins (VP13 and VP14) of herpes simplex virus type 1 by glycosylation and phosphorylation.
J. Gen. Virol.
72:2771-2775[Abstract/Free Full Text].
|
| 34.
|
Meyer, B. E.,
J. L. Meinkoth, and M. H. Malim.
1996.
Nuclear transport of human immunodeficiency virus type 1, visna virus, and equine infectious anemia virus Rev proteins: identification of a family of transferable nuclear export signals.
J. Virol.
70:2350-2359[Abstract].
|
| 35.
|
Morrison, E. E.,
A. J. Stevenson,
Y.-F. Wang, and D. M. Meredith.
1998.
Differences in the intracellular localisation and fate of herpes simplex virus tegument proteins early in the infection of Vero cells.
J. Gen. Virol.
79:2515-2528.
|
| 36.
|
Morrison, E. E.,
Y. Wang, and D. Meredith.
1998.
Phosphorylation of structural components promotes dissociation of the herpes simplex virus type 1 tegument.
J. Virol.
72:7108-7114[Abstract/Free Full Text].
|
| 37.
|
Nakielny, S., and G. Dreyfuss.
1996.
The hnRNP C proteins contain a nuclear retention sequence that can override nuclear export signals.
J. Cell Biol.
134:1365-1373[Abstract/Free Full Text].
|
| 38.
|
Nigg, E. A.
1997.
Nucleocytoplasmic transport: mechanisms and regulation.
Nature
386:779-787[CrossRef][Medline].
|
| 39.
|
O'Hare, P.,
C. R. Goding, and A. Haigh.
1988.
Direct combinatorial interaction between a herpes simplex virus regulatory protein and a cellular octamer-binding factor mediates specific induction of virus immediate-early gene expression.
EMBO J.
7:4231-4238[Medline].
|
| 40.
|
Ojala, P. M.,
B. Sodeik,
M. W. Ebersold,
U. Kutay, and A. Helenius.
2000.
Herpes simplex virus type 1 entry into host cells: reconstitution of capsid binding and uncoating at the nuclear pore complex in vitro.
Mol. Cell. Biol.
20:4922-4931[Abstract/Free Full Text].
|
| 41.
|
O'Rourke, D.,
G. Elliott,
M. Papworth,
R. Everett, and P. O'Hare.
1998.
Examination of determinants for intranuclear localization and transactivation within the RING finger of herpes simplex virus type 1 IE110k protein.
J. Gen. Virol.
79:537-548[Abstract].
|
| 42.
|
Palmeri, D., and M. H. Malim.
1999.
Importin beta can mediate the nuclear import of an arginine-rich nuclear localization signal in the absence of importin alpha.
Mol. Cell. Biol.
19:1218-1225[Abstract/Free Full Text].
|
| 43.
|
Phelan, A., and J. B. Clements.
1997.
Herpes simplex virus type 1 immediate early protein IE63 shuttles between nuclear compartments and the cytoplasm.
J. Gen. Virol.
78:3327-3331[Abstract].
|
| 44.
|
Pinard, M. F.,
R. Simard, and V. Bibor-Hardy.
1987.
DNA-binding proteins of herpes simplex virus type 1-infected BHK cell nuclear matrices.
J. Gen. Virol.
68:727-735[Abstract/Free Full Text].
|
| 45.
|
Pinol-Roma, S., and G. Dreyfuss.
1992.
Shuttling of pre-mRNA binding proteins between nucleus and cytoplasm.
Nature
355:730-732[CrossRef][Medline].
|
| 46.
|
Richard, N.,
S. Iacampo, and A. Cochrane.
1994.
HIV-1 Rev is capable of shuttling between the nucleus and cytoplasm.
Virology
204:123-131[CrossRef][Medline].
|
| 47.
|
Roy, S.,
U. Delling,
C. H. Chen,
C. A. Rosen, and N. Sonenberg.
1990.
A bulge structure in HIV-1 TAR RNA is required for Tat binding and Tat-mediated trans-activation.
Genes Dev.
4:1365-1373[Abstract/Free Full Text].
|
| 48.
|
Siomi, H.,
H. Shida,
M. Maki, and M. Hatanaka.
1990.
Effects of a highly basic region of human immunodeficiency virus Tat protein on nucleolar localization.
J. Virol.
64:1803-1807[Abstract/Free Full Text].
|
| 49.
|
Siomi, H.,
H. Shida,
S. H. Nam,
T. Nosaka,
M. Maki, and M. Hatanaka.
1988.
Sequence requirements for nucleolar localization of human T cell leukemia virus type I pX protein, which regulates viral RNA processing.
Cell
55:197-209[CrossRef][Medline].
|
| 50.
|
Spear, P. G., and B. Roizman.
1972.
Proteins specified by herpes simplex virus. V. Purification and structural proteins of the herpesvirion.
J. Virol.
9:143-159[Abstract/Free Full Text].
|
| 51.
|
Stutz, F., and M. Rosbash.
1998.
Nuclear RNA export.
Genes Dev.
12:3303-3319[Free Full Text].
|
| 52.
|
Truant, R., and B. R. Cullen.
1999.
The arginine-rich domains present in human immunodeficiency virus type 1 Tat and Rev function as direct importin beta-dependent nuclear localization signals.
Mol. Cell. Biol.
19:1210-1217[Abstract/Free Full Text].
|
| 53.
|
Zhang, Y., and J. L. McKnight.
1993.
Herpes simplex virus type 1 UL46 and UL47 deletion mutants lack VP11 and VP12 or VP13 and VP14, respectively, and exhibit altered viral thymidine kinase expression.
J. Virol.
67:1482-1492[Abstract/Free Full Text].
|
| 54.
|
Zhang, Y.,
D. A. Sirko, and J. L. McKnight.
1991.
Role of herpes simplex virus type 1 UL46 and UL47 in alpha TIF-mediated transcriptional induction: characterization of three viral deletion mutants.
J. Virol.
65:829-841[Abstract/Free Full Text].
|
Journal of Virology, March 2001, p. 2566-2574, Vol. 75, No. 6
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.6.2566-2574.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Labiuk, S. L., Babiuk, L. A., van Drunen Littel-van den Hurk, S.
(2009). Major tegument protein VP8 of bovine herpesvirus 1 is phosphorylated by viral US3 and cellular CK2 protein kinases. J. Gen. Virol.
90: 2829-2839
[Abstract]
[Full Text]
-
Williams, P., Verhagen, J., Elliott, G.
(2008). Characterization of a CRM1-Dependent Nuclear Export Signal in the C Terminus of Herpes Simplex Virus Type 1 Tegument Protein UL47. J. Virol.
82: 10946-10952
[Abstract]
[Full Text]
-
Donnelly, M., Verhagen, J., Elliott, G.
(2007). RNA Binding by the Herpes Simplex Virus Type 1 Nucleocytoplasmic Shuttling Protein UL47 Is Mediated by an N-Terminal Arginine-Rich Domain That Also Functions as Its Nuclear Localization Signal. J. Virol.
81: 2283-2296
[Abstract]
[Full Text]
-
Verhagen, J., Donnelly, M., Elliott, G.
(2006). Characterization of a Novel Transferable CRM-1-Independent Nuclear Export Signal in a Herpesvirus Tegument Protein That Shuttles between the Nucleus and Cytoplasm.. J. Virol.
80: 10021-10035
[Abstract]
[Full Text]
-
Verhagen, J., Hutchinson, I., Elliott, G.
(2006). Nucleocytoplasmic Shuttling of Bovine Herpesvirus 1 UL47 Protein in Infected Cells. J. Virol.
80: 1059-1063
[Abstract]
[Full Text]
-
Vittone, V., Diefenbach, E., Triffett, D., Douglas, M. W., Cunningham, A. L., Diefenbach, R. J.
(2005). Determination of Interactions between Tegument Proteins of Herpes Simplex Virus Type 1. J. Virol.
79: 9566-9571
[Abstract]
[Full Text]
-
Yedowitz, J. C., Kotsakis, A., Schlegel, E. F. M., Blaho, J. A.
(2005). Nuclear Localizations of the Herpes Simplex Virus Type 1 Tegument Proteins VP13/14, vhs, and VP16 Precede VP22-Dependent Microtubule Reorganization and VP22 Nuclear Import. J. Virol.
79: 4730-4743
[Abstract]
[Full Text]
-
del Rio, T., Ch'ng, T. H., Flood, E. A., Gross, S. P., Enquist, L. W.
(2005). Heterogeneity of a Fluorescent Tegument Component in Single Pseudorabies Virus Virions and Enveloped Axonal Assemblies. J. Virol.
79: 3903-3919
[Abstract]
[Full Text]
-
Sokolowski, M., Scott, J. E., Heaney, R. P., Patel, A. H., Clements, J. B.
(2003). Identification of Herpes Simplex Virus RNAs That Interact Specifically with Regulatory Protein ICP27 in Vivo. J. Biol. Chem.
278: 33540-33549
[Abstract]
[Full Text]
-
Mahajan, S. S., Little, M. M., Vazquez, R., Wilson, A. C.
(2002). Interaction of HCF-1 with a Cellular Nuclear Export Factor. J. Biol. Chem.
277: 44292-44299
[Abstract]
[Full Text]
-
Hutchinson, I., Whiteley, A., Browne, H., Elliott, G.
(2002). Sequential Localization of Two Herpes Simplex Virus Tegument Proteins to Punctate Nuclear Dots Adjacent to ICP0 Domains. J. Virol.
76: 10365-10373
[Abstract]
[Full Text]
-
Kopp, M., Klupp, B. G., Granzow, H., Fuchs, W., Mettenleiter, T. C.
(2002). Identification and Characterization of the Pseudorabies Virus Tegument Proteins UL46 and UL47: Role for UL47 in Virion Morphogenesis in the Cytoplasm. J. Virol.
76: 8820-8833
[Abstract]
[Full Text]
-
Sciortino, M. T., Taddeo, B., Poon, A. P. W., Mastino, A., Roizman, B.
(2002). Of the three tegument proteins that package mRNA in herpes simplex virions, one (VP22) transports the mRNA to uninfected cells for expression prior to viral infection. Proc. Natl. Acad. Sci. USA
99: 8318-8323
[Abstract]
[Full Text]
-
Li, B., Yen, T. S. B.
(2002). Characterization of the Nuclear Export Signal of Polypyrimidine Tract-binding Protein. J. Biol. Chem.
277: 10306-10314
[Abstract]
[Full Text]
-
Kinchington, P. R., Fite, K., Seman, A., Turse, S. E.
(2001). Virion Association of IE62, the Varicella-Zoster Virus (VZV) Major Transcriptional Regulatory Protein, Requires Expression of the VZV Open Reading Frame 66 Protein Kinase. J. Virol.
75: 9106-9113
[Abstract]
[Full Text]
-
Donnelly, M., Elliott, G.
(2001). Fluorescent Tagging of Herpes Simplex Virus Tegument Protein VP13/14 in Virus Infection. J. Virol.
75: 2575-2583
[Abstract]
[Full Text]