Previous Article | Next Article 
Journal of Virology, March 2001, p. 2377-2387, Vol. 75, No. 5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.5.2377-2387.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Using Recombinant Coxsackievirus B3 To Evaluate the Induction and
Protective Efficacy of CD8+ T Cells during
Picornavirus Infection
Mark K.
Slifka,
Robb
Pagarigan,
Ignacio
Mena,
Ralph
Feuer, and
J. Lindsay
Whitton*
Department of Neuropharmacology, The Scripps Research Institute, La
Jolla, California
Received 15 September 2000/Accepted 29 November 2000
 |
ABSTRACT |
Coxsackievirus B3 (CVB3) is a common human pathogen that has been
associated with serious diseases including myocarditis and pancreatitis. To better understand the effect of cytotoxic T-lymphocyte (CTL) responses in controlling CVB3 infection, we have inserted well-characterized CTL epitopes into the CVB3 genome.
Constructs were made by placing the epitope of interest upstream of the
open reading frame encoding the CVB3 polyprotein, separated by a
poly-glycine linker and an artificial
3Cpro/3CDpro cleavage site. This strategy
results in the foreign protein being translated at the amino- terminus
of the viral polyprotein, from which it is cleaved prior to viral
assembly. In this study, we cloned major histocompatibility complex
class I-restricted CTL epitopes from lymphocytic choriomeningitis virus
(LCMV) into recombinant CVB3 (rCVB3). In vitro, rCVB3 growth kinetics
showed a 1- to 2-h lag period before exponential growth was initiated,
and peak titers were ~1 log unit lower than for wild-type virus.
rCVB3 replicated to high titers in vivo and caused severe pancreatitis
but minimal myocarditis. Despite the high virus titers, rCVB3 infection
of naive mice failed to induce a strong CD8+ T-cell
response to the encoded epitope; this has implications for the proposed
role of "cross-priming" during virus infection and for the utility
of recombinant picornaviruses as vaccine vectors. In contrast, rCVB3
infection of LCMV-immune mice resulted in direct ex vivo cytotoxic
activity against target cells coated with the epitope peptide,
demonstrating that the rCVB3-encoded LCMV-specific epitope was
expressed and presented in vivo. The preexisting CD8+
memory T cells could limit rCVB replication; compared to naive mice,
infection of LCMV-immune mice with rCVB3 resulted in ~50-fold-lower virus titers in the heart and ~6-fold-lower virus titers in the pancreas. Although the inserted CTL epitope was retained by rCVB3 through several passages in tissue culture, it was lost in an organ-specific manner in vivo; a substantial proportion of viruses from
the pancreas retained the insert, compared to only 0 to 1.8% of
myocardial viruses. Together, these results show that expression of
heterologous viral proteins by recombinant CVB3 provides a useful model
for determining the mechanisms underlying the immune response to this
viral pathogen.
 |
INTRODUCTION |
Coxsackieviruses are members of the
family Picornaviridae and lie in the Enterovirus
genus, together with polioviruses, echoviruses, and unclassified
enteroviruses. Coxsackieviruses are classified, according their
pathogenicity in newborn mice, into groups A and B, which comprise 24 and 6 serotypes, respectively. Type B coxsackieviruses (CVB) are
common human pathogens and have been implicated in acute and chronic myocarditis; there is a strong correlation between prior
CVB infection and dilated cardiomyopathy, which can be effectively treated only by heart transplantation (47). In
addition to cardiovascular disease, CVB has been associated with
hepatitis, encephalitis, and pancreatitis, and CVB4 infection has been
suggested as an underlying cause of diabetes mellitus in humans
(11, 25, 48). The outcome of CVB infection is often
similar in mice and humans. For example, in both species there may be
marked myocarditis followed by cardiac scarring and dilation (18,
23, 28, 55, 57), and in the absence of functional B cells, the
virus establishes a long-term chronic infection (16, 20,
37).
Although picornavirus infections are very common, we have only a
rudimentary understanding of the immune responses which control and
clear these agents. Antibodies are important in eradicating enteroviruses, and agammaglobulinemic humans are susceptible to chronic
infections with polioviruses (26), echoviruses (35, 38), and coxsackieviruses (16, 20). However, T
cells also play a role in limiting viral titers (18, 55),
and antibodies appear to contribute little to the protection induced by
a CVB DNA vaccine (19), suggesting that virus-specific
memory T cells might be important in vaccine-induced immunity. To
clarify the part played by vaccine-induced CD8+ memory T
cells in protecting against picornavirus challenge, we wished to
develop a vaccine which would induce virus-specific CD8+ T
cells in the absence of virus-specific antibody. However, CVB-specific CD8+ T-cell epitopes have not yet been mapped, making it
more difficult to design the desired vaccine. As an alternative
approach, we chose to incorporate well-characterized foreign
CD8+ cytotoxic T-lymphocyte (CTL) epitopes into the CVB3
genome and to evaluate the ability of vaccine-induced CTL to protect
against this recombinant picornavirus.
Four strategies have been used to construct recombinant picornaviruses.
First, foreign sequences have been inserted within the open reading
frame (ORF) of poliovirus capsid proteins such as VP1, but
conformational constraints demand that these sequences be very short
(6, 13). Second, dicistronic polioviruses have been
constructed which contain an additional internal ribosome entry site
driving a second ORF for expressing the foreign protein; however, these
viruses were genetically unstable and long inserts resulted in a genome
which could not be packaged (1). Third, it is possible to
replace the sequences encoding poliovirus structural proteins with
foreign genes of interest, generating a defective genome which can be
packaged into infectious virus by cell lines that supply the missing
poliovirus proteins (9); however, such recombinants are
defective and cannot produce infectious progency in vivo. The fourth
strategy exploits the fact that the picornavirus polyprotein is
autolytically cleaved by two viral proteases, 2Apro and
3Cpro/3CDpro, to generate the individual
proteins that control viral replication and virion assembly. The
cloning strategy places the foreign protein in frame with the viral
polyprotein, followed by an artificial protease cleavage site (4,
34). This site permits the foreign protein to be cleaved from
the rest of the viral proteins during translation, allowing viral
capsid formation to proceed. This strategy permits the isolation of a
replication-competent recombinant virus and allows greater diversity in
the size of the heterologous gene products that can be incorporated
into the viral genome.
Most work with recombinant enteroviruses has focused on poliovirus, but
a recent report confirmed that the above approach could be applied to
an attenuated coxsackievirus (21). In the experiments
described herein, CD8+ CTL epitopes from lymphocytic
choriomeningitis virus (LCMV) were cloned into a cardiovirulent strain
of CVB3 and viable recombinant coxsackievirus progeny (rCVB) were
produced. We used the recombinant viruses to ask the following
questions. (i) How does rCVB3 compare to cardiovirulent CVB in plaque
morphology, growth kinetics, RNA production, and in vivo virulence?
(ii) Is a rCVB3 which carries a highly -immunogenic CTL epitope
able to induce strong CTL responses to that epitope? (iii) Do
epitope-specific memory CTL protect against coxsackievirus
challenge? Finally, we evaluate the stability of the recombinant
viruses in vivo and provide data consistent with organ-specific
selection; recombinant CVB present in the hearts of infected mice are
devoid of LCMV epitopes, while viruses isolated from the pancreas
often retain the foreign sequences.
 |
MATERIALS AND METHODS |
Mice and virus.
C57BL/6 mice were purchased from the Jackson
Laboratory (Bar Harbor, Maine) or obtained from the breeding colony at
the Scripps Research Institute. Wild-type CVB3 (wtCVB3) was produced
from the plasmid pH3, which contains a full-length cDNA encoding the myocarditic strain Nancy (H3 variant); this plasmid (GenBank accession number U57056 [28]) was the kind gift of Kirk Knowlton (University of
California, San Diego, Calif.).
Recombinant coxsackievirus cDNA construction.
The complete
CVB3 genome in plasmid pH3 does not contain a unique restriction site
into which foreign inserts could be cloned. Therefore, oligonucleotides
containing a unique SfiI site and an artificial protease
cleavage site were cloned into a SacI site located
immediately downstream of the CVB3 polyprotein initiation codon in
plasmid pH3. Since pH3 contains three SacI sites, a partial SacI digest was performed to generate a linear plasmid, and
the termini were blunted using Klenow fragment. Complementary
oligonucleotides containing a unique SfiI site and an
artificial 3Cpro/3CDpro cleavage site were
annealed, phosphorylated, and ligated into the vector, and a plasmid
carrying the oligonucleotide insert in the desired SacI site
was identified and designated pMKS1. The oligonucleotide was designated
to maintain the ORF between the upstream ATG and the remainder of the
viral polyprotein. The unique SfiI site in this plasmid was
used as the recipient cloning site for preparing subsequent plasmids.
pMKS2 (containing the Db-restricted LCMV
GP33-41 epitope) and pMKS3 (containing the
Ld-restricted LCMV NP118-126 epitope) were
prepared by cutting pMKS1 with SfiI and inserting the
appropriate oligonucleotide sequences, again maintaining the ORF.
Each insert was completely sequenced prior to transfection into
HeLa cells to generate recombinant virus stocks.
Transfection of cDNA clones to obtain infectious virus.
Virus was prepared by transfecting the infectious cDNA into HeLa cells,
using Lipofectamine Plus reagent as specified by the manufacturer's
directions (Gibco, Rockville, Md.). At 3 to 5 h later, complete
Dulbecco minimal essential medium (DMEM) containing 10% fetal bovine
serum (FBS) and L-glutamate was added, and the medium was
changed after 24 h. The HeLa cell monolayers showed cytopathic
effects by 3 days posttransfection, and at this time point, the cells
and supernatants were collected, frozen-thawed three times, and
subjected to titer determination on HeLa cells. Viruses were plaque
purified twice, and working stocks were expanded on HeLa cells using a
multiplicity of infection (MOI) of 10 PFU/cell. The recombinant viruses
were named to reflect their plasmid of origin. Thus, rCVB3.1 was
derived from pMKS1, while pMKS2 and pMKS3 gave rise to rCVB3.2
and rCVB3.3, respectively.
One-step growth curve.
HeLa cell monolayers in six-well
plates were infected with either wtCVB3, rCVB3.1, rCVB3.2, or rCVB3.3
at an MOI of 10. After 60 min at 37°C, unbound virus was removed by
washing the cells twice with prewarmed saline (0.9% NaCl), and 3 ml of
prewarmed DMEM containing 10% FBS was added. Cells and supernatants
were collected at the indicated time points by scraping the monolayers with a rubber policeman. The samples were frozen-thawed three times
prior to serial dilution and plaque assay on HeLa cell monolayers.
FISH-fluorescence-activated cell sorter (FACS) analyses of
intracellular RNA.
RNA probes for fluorescent in situ
hybridization (FISH) were transcribed in vitro from a linearized
plasmid carrying the CVB3 genome. Biotin-16-UTP (Boehringer
Mannheim) was included in the transcription reaction mixture, and the
probe was purified through a ChromaSpin 30 column (Clontech, Palo Alto,
Calif.). Thereafter, the published protocol was followed
(7), with some modifications. Cells were incubated with
CVB3 (MOI = 10) or mock infected. At the designated time points, the
cells were washed once with saline, trypsinized, transferred to 15-ml
conical tubes, and washed once with complete DMEM and once with HH
buffer (1 × Hanks' balanced salt solution, 20 mM HEPES [pH
7.2]). The cells were then resuspended in 400 µl of HH by gentle
pipetting, transferred to 1.5 ml microcentrifuge tubes, and fixed by
the addition of 45 µl of 10% neutral buffered formalin. After a
5-min incubation at room temperature, the cells were centrifuged at
300 × g for 5 min, washed once with HH, and resuspended in 300 µl of HH. Then 0.7 ml of absolute ethanol was added, and the cells (at a concentration of 3 × 106
cells per ml) were stored at
20°C until analyzed. For analysis, 5 × 105 cells in 160 µl were mixed with 3 µl of
10% diethylpyrocarbonate in ethanol and held for 15 min at room
temperature, to inactivate endogenous RNase activity. The cells were
then centrifuged at 300 × g for 5 min, resuspended in
HH buffer with 0.5% Tween 20 (buffer HH-T), and held for 5 min at room
temperature. Then 1 volume of 20× SSC (1×SSC is 0.15 M NaCl plus
0.015 M sodium citrate) and 2 volumes of formamide were added to this
solution. Cells were pelleted by centrifugation and resuspended in 10 µl of prewarmed hybridization buffer (5× SSC, 50% formamide, 0.1%
sodium dodecyl sulfate [SDS], 500 µg of tRNA per ml) containing
~1 ng of the biotinylated RNA probe. The cells were incubated
overnight at 45°C with rotation, pelleted, washed with 100 µl of
prewarmed hybridization buffer (without probe) for 45 min at 45°C
with rotation, centrifuged, and resuspended in prewarmed 0.1×
SSC-0.1% SDS for 30 min at 45°C. After centrifugation, the cells
were resuspended in 50 µl of streptavidin-phycoerythrin (PharMingen,
San Diego, Calif.) (5 µg/ml) in HH-T, incubated for 30 min at 45°C,
pelleted, and resuspended in 400 µl of HH-T containing 0.1× SSC and
0.1% SDS. After 2 min at 45°C, the cells were pelleted, resuspended in 200 µl of HH-T, and analyzed on a FACScan flow cytometer. Data were analyzed with CellQuest software (Becton- Dickinson, Franklin Lakes, N.J.).
Intracellular cytokine staining (ICCS).
High-pressure liquid
chromatography-purified (>95% pure) major histocompatibility complex
(MHC) class I peptides GP33-41 (KAVYNFATM) and
NP396-404 (FQPQNGQFI) were purchased from Peptidogenic
(Livermore, Calif.). Spleen cells (2 × 106 per well)
from virus-infected mice were stimulated with 10
7 M
peptide in the presence of 2 µg/ of brefeldin A (Sigma, St. Louis,
Mo.) per ml for 6 h at 37°C under 5% CO2 in RPMI
1640 containing 10% FBS, 20 mM HEPES, L-glutamine, and
antibiotics. The cells were stained overnight at 4°C with
Cychrome-labeled anti-CD8 antibody (PharMingen). The cells were washed,
fixed, and permeabilized using Cytofix/Cytoperm (PharMingen). Samples
were stained with fluorescein isothiocyanate labeled anti-gamma
interferon (IFN-
) antibody, washed and resuspended in
phosphate-buffered saline containing 2% formaldehyde, and analyzed on
a FACScan flow cytometer with CellQuest software (Becton Dickinson).
Direct ex vivo cytotoxicity assay.
LCMV-immune (>8 weeks
after intraperitoneal [i.p.] infection with 2 × 105
PFU of LCMV Armstrong) or naive C57BL/6 mice were infected with rCVB3.2
or rCVB3.3; 7 days later they were sacrificed and their splenocytes
were assayed for CTL activity directly ex vivo (in the absence of in
vitro restimulation). The CTL assays were performed as previously
described (52) using targets labeled with 51Cr
in the presence or absence of 10
7 M LCMV
GP33-41 peptide.
Evaluating the protective effects of rCVB-specific memory T
cells.
LCMV-immune mice were prepared as described above and were
infected (along with naive mice) with 2 × 106 PFU of
rCVB3.2 or rCVB3.3. At 2 or 4 days later, the mice were sacrificed and
tissues were collected on the indicated days. The heart and pancreas
were weighed and frozen at
80°C in DMEM containing 10% FBS.
Samples were later thawed, homogenized, serially diluted in 10-fold
increments, and subjected to titer determination on HeLa cell monolayers.
Determining the stability of rCVB in tissue culture and in
vivo.
For tissue culture studies, each passage of virus was done
as follows. HeLa cells were infected with rCVB3 (MOI = 10), and 7 h later virus was harvested and subjected to titer determination on
HeLa cells prior to the next passage. Following passages 4 and 5, RNA
was prepared using Trizol reagent (Gibco BRL, Rockville, MD.). For in
vivo studies, naive C57BL/6 mice were infected with 2 × 106 PFU of rCVB3 and 4 days later were sacrificed, and
their tissues were harvested. RNA was prepared from the heart and
pancreas using Trizol reagent. The resulting RNAs were used as
templates for reverse transcription-PCR (RT-PCR) using two CVB-specific
primers. The first primer, used for reverse transcription, was
5'CGTGTAGTGAATAATGGAATTGCCGCT3'; the second primer was
5'GTTGGATTTATACCACTTAGCTTGAGAGAGG3'. The resulting PCR
fragments were analyzed by agarose gel electrophoresis. In addition,
the PCR fragments produced using the in vivo-derived RNA templates were
cloned by the T-A method (Invitrogen, San Diego, Calif.), and bacterial
colonies were replicated onto nitrocellulose membranes. Following
colony lysis and nucleic acid denaturation, the colonies were analyzed
by in situ hybridization, using 5'-32P-labeled
single-stranded oligonucleotide probes specific for the GP33
epitope (probe 5'GGAAGGCTGTCTACAATTTTGCCACCTGTGGGGGAGGAG 3')
and for the nearby CVB sequence (probe
5'CGTGTAGTGAATAATGGAATTGCCGCT3'). After being washed,
positive colonies were identified by autoradiography.
 |
RESULTS |
Incorporation of foreign genes into the rCVB3 genome.
We and
others (21) have developed a system which allows foreign
sequences to be expressed from recombinant CVB3. This system was first
conceived for recombinant poliovirus (4, 34). The sequence
of interest is placed at the N terminus of the viral polyprotein,
separated from it by a picornavirus protease cleavage site which
ensures that the recombinant molecule is released from the polyprotein
during the course of virus replication (4, 33, 34). We
used the 3Cpro/3CDpro cleavage site (consensus
AXXQG, where X is any amino acid). The plasmid pH3, which encodes
wtCVB3, had no suitable unique restriction site, and so, to facilitate
construction of recombinant viruses, a unique SfiI cloning
site (followed by a polyglycine linker and an artificial proteolytic
cleavage sequence ALFQG) was inserted into pH3 immediately downstream
from the ATG start codon of the viral polyprotein, generating plasmid
pMKS1, which encodes the "parental" recombinant CVB, rCVB3.1. Next,
minigenes containing well-characterized LCMV-specific CD8+
T-cell epitopes were inserted in frame into the unique
SfiI site of this plasmid, generating infectious clones from
which recombinant viruses could be prepared. rCVB3.2 contains the
Db-restricted LCMV GP33-41 epitope,
and rCVB3.3 contains the Ld-restricted LCMV
NP118-126 epitope (51, 53). Amino acid sequences at the N termini of the above-mentioned viruses are shown in
Fig. 1. In all cases, the sequences of
the regions at and around the cloning sites were confirmed by DNA
sequencing prior to transfection into HeLa cells to produce live
recombinant virus.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
rCVB cloning strategy and amino acid sequences at the N
termini of wild-type and recombinant coxsackieviruses. pH3 encodes the
full-length CVB3 polyprotein (black arrow). As detailed in Materials
and Methods, this plasmid was partially digested with SacI
and an oligonucleotide (thin box) encoding a unique SfiI
restriction site followed by the coding sequence for a polyglycine
linker and a typical 3Cpro/3CDpro cleavage site
was inserted into the (circled) SacI site immediately downstream of the
CVB3 polyprotein start codon. The resulting plasmid (pMKS1) was used to
generate rCVB3.1; it acted also as the parental cloning vector for
construction of new rCVB3 viruses, by cutting with SfiI and
inserting antigen expression cassettes including the LCMV
GP33-41 Db epitope (resulting in pMKS2 and
rCVB3.2) or the LCMV NP118-126 Ld epitope
(resulting in pMKS3 and rCVB3.3). The amino acid sequences at the N
termini of wtCVB and of the three recombinant viruses are shown. The
artificial cleavage site is denoted by an arrowhead, and the LCMV
epitopes are highlighted in bold type.
|
|
In vitro growth kinetics of rCVB3.
All rCVB3 constructs
yielded viable, replication-competent viruses after cDNA transfection
of HeLa cell monolayers. After partial cytopathic effect was observed
(24 to 48 h post transfection), the cells and supernatant were
collected and subjected to three rounds of freezing-thawing prior to
plaque assay on HeLa cell monolayers. Virus stocks were plaque purified
twice before being expanded on HeLa cells (MOI 10). The rCVB3 viruses
formed plaques within 48 h, but the plaques were smaller
than in wtCVB3 (Fig. 2A). An in vitro
one-step growth curve was generated to compare the growth
rates of the rCVB3 strains to that of wtCVB3 (Fig. 2B). Exponential
growth of rCVB3 viruses was delayed by about 1 to 2 h compared to
that of wtCVB3, but once viral replication was initiated, the
growth rates of wtCVB3 and recombinant CVB3 were similar. However, the
maximum titer of rCVB3 was ~108 PFU/ml, about 1 log unit
lower than the wild-type titer.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Plaque morphology and growth kinetics of wild-type and
recombinant coxsackieviruses. (A) Plaque assays of wtCVB (strain H3)
(28) and rCVB3.1, rCVB3.2, and rCVB3.3 were performed in
parallel on HeLa cell monolayers. The numbers indicate the average
plaque diameter of 40 to 60 individual plaques ± the standard
deviation. (B) A one-step growth curve was generated to compare the in
vitro growth kinetics of rCVB3 and wtCVB. HeLa cell monolayers were
infected at an MOI of 10, and the amount of infectious virus was
determined at each time point by a plaque assay. p.i., postinfection.
|
|
Delayed initiation of replication by rCVB3.
The 1 to 2 h
delay in production of infectious particles might have been
attributable to early (attachment/entry/uncoating), intermediate
(genomic RNA replication/proteolytic processing), or late
(maturation/packaging/egress) events. We used the technique of
FISH-FACS (7) to evaluate the kinetics of viral RNA
production in infected cells. This method employs a biotinylated
CVB-specific RNA probe which is incubated with infected cells under in
situ hybridization conditions, and after being washed, the cells are incubated with fluorescently labeled streptavidin (see Materials and
Methods). After further washes, the cells are analyzed on a flow
cytometer. In Fig. 3, the y
axis shows the number of recorded events and the x axis
shows their fluorescence intensity (log10 scale). In cells
infected with wtCVB, a slight increase in fluorescence (average
~2-fold) was detectable at 3 h postinfection; by 4 h, most cells
showed a ~100-fold increase; and by 5 to 6 h, almost all of the
cells showed strong fluorescence. In contrast, cells infected with
rCVB3 showed a delay in fluorescence acquisition; this was most evident
at the 4-h time point, when the majority of cells fluoresced but did so
at much lower intensity than cells infected with wtCVB. These data are
consistent with a defect in an early event, which delays the onset of
viral RNA synthesis by ~1 h. At 5 h, many rCVB-infected cells
have a level of fluorescence similar to that observed in wtCVB-infected
cells, indicating that once cells are infected by rCVB, their viral RNA
content appears similar to that observed during wtCVB
infection; this agrees with the observed similarities in exponential
growth rates (Fig. 2). Therefore, there is no obvious defect in
replication of the recombinant RNA genome.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
FISH-FACS analysis of RNA synthesis by wtCVB and rCVB.
HeLa cells were incubated with wtCVB (left column) or with rCVB
encoding GFP (right column) (both at an MOI of 10) or were mock
infected (UNINF). At the indicated times, the cells were harvested,
processed as described in Materials and Methods, and incubated under in
situ hybridization conditions with a biotinylated RNA probe specific
for the genomic strand of CVB3. After being washed to remove unbound
probe, the cells were incubated with streptavidin-phycoerythrin,
washed, and analyzed on a flow cytometer. The y axes show
the number of recorded events, and the x axes indicate their
fluorescence (arbitrary units, log10 scale).
|
|
In vivo replication and pathogenesis of rCVB3.
Infection of
mice with wtCVB results in widespread viral replication; the highest
titers usually are found in the heart and pancreas (~108
and ~1010 PFU/g, respectively), with accompanying
myocarditis (18, 22, 56) and pancreatitis (36, 45,
46). Therefore, we infected BALB/c and C57BL/6 mice with various
doses of rCVB3 and evaluated the viral titers in these organs. As shown
in Fig. 4, both rCVB3.2 and rCVB3.3 grew
to high titers in the pancreas of BALB/c and C57BL/6 mice; the
pancreatic titers were very similar to those seen during wtCVB
infection. The rCVB strains grew somewhat less well in the heart but
still yielded 106 PFU/g. As might be expected, given the
high viral titers, histological analyses of the heart and pancreas
revealed inflammatory infiltrates. At 9 days postinfection, rCVB3.2
caused minimal myocarditis (Fig. 5A); the
reduced cardiovirulence of the recombinant virus is clearly demonstrated by comparison with the more severe myocarditis caused by
wtCVB (Fig. 5B). However, rCVB3 showed little if any attenuation of
virulence in the pancreas, causing a severe pancreatitis which was
detectable as early as 2 days postinfection (not shown) and resulted in
marked infiltration and acinar cell destruction by 9 days postinfection
(Fig. 5C). The pancreatic pathology caused by rCVB was similar to that
previously described following wtCVB3 infection (36); only
pancreatic acinar cells were infected, and no destruction of islet
cells was observed. However, despite high virus titers and severe
pancreatitis, mortality was much reduced following rCVB infection;
wtCVB3 has a 50% lethal dose of ~100 PFU for C57BL/6 mice
(18), but doses of up to 107 PFU of rCVB3.1,
rCVB3.2, or rCVB3.3 per mouse were nonlethal. In summary, the
recombinant CVB3 strains used in these studies replicated to high
titers in vivo and were less cardiovirulent than the parental virus but
remained able to cause severe but nonfatal pancreatitis.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 4.
In vivo growth kinetics of rCVB3. BALB/c or C57BL/6 mice
were infected with the indicated virus doses. Four days later, the
heart and pancreas were harvested and the virus titers were determined.
Means and standard deviations are shown.
|
|

View larger version (119K):
[in this window]
[in a new window]
|
FIG. 5.
rCVB3.2 causes mild myocarditis and severe pancreatitis.
C57BL/6 mice were infected i.p. with 106 PFU of rCVB3.2,
and 9 days later the heart and pancreas were examined histologically;
the heart was stained with hematoxylin and eosin, and the pancreas was
stained with trichrome. (A) Mild myocarditis was noted in the
rCVB3.2-infected heart. (B) The more marked myocarditis occurring 9 days after infection of C57BL/6 mice with wtCVB is shown. Myocardial
infiltrates are indicated by arrows. (C) rCVB3.2 infection resulted in
massive destruction of the exocrine tissue of the pancreas, leaving
only occasional acinar cells and the islets of Langerhans intact. (D)
Normal pancreas. Islets of Langerhans are labeled and arrowed.
Magnification, ×80. The samples are representative of at least four
animals, and similar results were obtained with rCVB3.1 and rCVB3.3
(data not shown).
|
|
The LCMV GP33 epitope is expressed in vivo by rCVB3.2.
Next, we investigated whether the encoded foreign T-cell epitope
was expressed in vivo by rCVB. Naive and LCMV-immune C57BL/6 (H-2b) mice were infected with either rCVB3.2
(carrying the Db-restricted GP33
epitope) or rCVB3.3 (as a negative control, carrying the
Ld-restricted NP118 epitope). Seven days
later, CTL activity was measured directly ex vivo against
peptide-coated H-2b target cells, using a
standard 51Cr release assay. CTL activity was below the
level of detection in naive mice following infection with rCVB3.2 (Fig.
6), indicating that rCVB3.2 does not
induce a strong enough CD8+ T-cell response to be detected
directly ex vivo. The failure to induce primary CTL activity directly
ex vivo is consistent with previous observations using recombinant
poliovirus, in which detection of CTL activity required a 5-day
secondary in vitro restimulation (30, 49). To determine if
rCVB infection could stimulate memory T cells, LCMV-immune C57BL/6
(H-2b) mice were infected with rCVB3.2
(containing the Db-restricted LCMV CTL epitope).
LCMV-immune C57BL/6 mice contain a high proportion of
GP33-specific memory T cells, which, on secondary exposure
to antigen, increase in number and acquire lytic activity. As a control
to ensure that the development of lytic activity was specific for the
encoded Db epitope, a group of these LCMV-immune
H-2b mice were challenged with rCVB3.3
(containing the Ld-restricted LCMV CTL epitope). Strong
GP33-specific lytic activity was detectable 7 days after infection of
LCMV-immune H-2b mice infected with rCVB3.2
(Fig. 6). In contrast, infection of these mice with rCVB3.3 did not
result in an appreciable level of CTL activity, indicating that the CTL
response observed after rCVB3.2 infection required the expression of
the Db-restricted LCMV epitope and was not due to
nonspecific "bystander" activation. Together, these results
demonstrate that rCVB3 can express heterologous CD8+ T-cell
epitopes in vivo and can stimulate a cytolytic response in
antigen-specific CD8+ memory T cells.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
rCVB3.2 expresses an LCMV T-cell epitope in vivo. To
determine if the artificial LCMV-specific Db-restricted CTL
epitope encoded by rCVB3.2 was expressed in vivo, we challenged
naive and LCMV-immune C57BL/6 mice with rCVB3.2 and compared the ex
vivo epitope-specific CTL response to that in C57BL/6 mice infected
with rCVB3.3 expressing an Ld-restricted CTL epitope.
At 7 days postinfection, naive mice that were challenged with rCVB3.2
did not exhibit direct ex vivo CTL activity but rCVB3.2 infection of
LCMV-immune mice resulted in readily detectable peptide-specific
cytotoxicity. This result was not due to bystander activation, since
infection of LCMV-immune mice with rCVB3.3 (in this case, encoding an
irrelevant T-cell epitope) did not elicit peptide-specific
cytolytic activity. The data show the average and standard deviation
for two mice per group. Spontaneous lysis of target cells was <20%.
E:T ratio, effector-to-target-cell ratio.
|
|
Poor primary CD8+ T-cell response to rCVB3.
We
show above (Fig. 6) that an rCVB carrying a strong foreign epitope
failed to induce primary CTL responses detectable directly ex vivo,
although the virus could stimulate preexisting CD8+ memory
T cells. However, in vitro cytotoxicity assays are less sensitive than
ICCS, so we next used this assay to determine whether rCVB3 could
induce primary CD8+ T-cell responses detectable directly ex
vivo. Naive C57BL/6 mice were infected with 2 × 106
PFU of rCVB3.2 or rCVB3.3 and 7 days later were sacrificed, and their
epitope-specific CD8+ T-cell responses were evaluated
directly ex vivo by ICCS. No epitope-specific IFN-
-producing
CD8+ T cells were detected (data not shown). Therefore, to
expand any epitope-specific T cells which had been induced by rCVB,
rCVB-immunized mice were infected with LCMV and 4 days later were
analyzed by ICCS. The results are shown in Fig.
7. LCMV-immune mice, upon reinfection
with LCMV, mount strong responses to both the GP33 and
NP396 epitopes. In contrast, mice infected with
rCVB3.2, which expresses the GP33 epitope, failed to
mount detectable responses even after 4 days of in vivo restimulation
by LCMV.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
rCVB do not induce strong CD8+ T-cell
responses. Twelve C57BL/6 mice were infected as indicated (1°
infections; four mice per group) with either LCMV (2 × 105 PFU i.p.), rCVB3.2, or rCVB3.3 (2 × 106 PFU i.p.), and 4 weeks later, all mice were challenged
with LCMV (2 × 105 PFU i.p.). Four days later, the mice
were sacrificed and their spleens were harvested. CD8+
T-cell responses to the Db-restricted LCMV epitopes
GP33 and NP396 were evaluated by ICCS. Representative results are shown
from a single mouse in each of the three groups. The oval indicates
CD8+ IFN- + cells.
|
|
rCVB3.2 replication is reduced in mice which have virus-specific
CD8+ memory T cells.
If antigen-specific
CD8+ memory T cells play a role in limiting rCVB3
replication, one would expect to see a reduction in rCVB3 titers in
LCMV-immune mice challenged with an rCVB3 strain which expressed the
correct MHC-restricted CTL epitope; in contrast, one would predict
little to no difference in virus titers if the rCVB3 strain of virus
expressed an irrelevant CTL epitope. To test this hypothesis,
we challenged naive and LCMV-immune C57BL/6 mice with rCVB3.2 or
rCVB3.3 and measured the virus titers in the heart and the pancreas at
2 and 4 days postinfection (Fig. 8).
rCVB3.2 infection of naive mice (black bars) led to high titers in the
heart and pancreas, consistent with the data reported in Fig. 4. In
LCMV-immune H-2b mice, which have
CD8+ memory cells specific for the LCMV GP epitope,
myocardial rCVB3.2 titers were reduced by 4-fold at 2 days
postinfection and by 50-fold at 4 days postinfection. rCVB3.2 titers in
the pancreas were also consistently reduced in these mice, by five to
sixfold compared to those in nonimmune animals. In contrast, rCVB3.3
titers were not altered by the prior immune status of the mouse,
indicating that the observed inhibition of rCVB3.2 was epitope
specific. These results demonstrate that a preexisting
epitope-specific CD8+ memory T-cell response can reduce
the viral load of rCVB3 infection in both heart and pancreatic tissue.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 8.
Virus-specific CD8+ memory T cells
contribute to the control of picornavirus infection. Naive and
LCMV-immune C57BL/6 mice were challenged with 2 × 106
PFU of rCVB3.2 (left column) or rCVB3.3 (right column), and the amount
of infectious virus in the heart (top row) and pancreas (bottom row) 2 and 4 days later was determined by a plaque assay. As expected, rCVB3.3
grew equally well in naive and LCMV-immune mice. In contrast, rCVB3.2
titers were consistently lower in the heart and pancreas of LCMV-immune
mice than is those of naive controls, indicating that the preexisting
virus-specific memory CD8+ T cells recognized
rCVB3.2-infected cells in vivo and reduced the viral burden in both
heart and pancreas. The data show the average for four mice per group
and the standard deviation.
|
|
In vivo stability of recombinant coxsackieviruses.
Some
studies with recombinant polioviruses, performed using the same cloning
strategy used here, suggested that the viruses were extremely unstable,
even in tissue culture, and rapidly discarded the inserted sequences
(42). In this light, the failure of rCVB3.2 to induce a
strong CD8+ T-cell response might be explained by loss of
the inserted epitope during viral replication in vivo. Indeed, one
might argue that the loss of a CTL epitope would be accelerated in
vivo by immune selection in favor of revertant CVB. Therefore we
estimated the stability of the inserted epitope in tissue culture
and in vivo in the heart and pancreas. Viral RNAs were amplified by
RT-PCR, and the reaction products were evaluated in two ways: by
agarose gel electrophoresis and by cloning and colony hybridization. As shown in Fig. 9A, the viral RNA was
stable in tissue culture through passage 4, but by the next passage a
significant proportion of PCR products had lost either the GP33
epitope (rCVB3.2
rCVB3.1) or the entire insert including the
SfiI cloning site (resulting in the wild-type band). By day
4 post infection, essentially all of the viral RNA present in the
hearts of two mice appeared to be wild type; in contrast, the viral RNA
in the pancreata comprised a mixture of the three populations. As a
second means of quantitating the in vivo stability of the inserted
epitope in rCVB3.2, the PCR fragments encompassing the
SfiI site were cloned, and transformed bacteria were
analyzed by colony hybridization with probes specific for (i) the GP33
epitope and (ii) the CVB sequence; this allowed the calculation of
the percentage of cloned fragments which had retained the inserted
epitope. As shown in Fig. 9B, at 4 days postinfection in two mice,
a very low proportion (0 to 1.8%) of viral RNA from the heart had
retained the GP33 sequence. In contrast, a much higher proportion (9 to
55%) of pancreatic CVB RNA was GP33+. Thus, at 4 days
postinfection, a substantial proportion of rCVB3 expresses the LCMV
GP33 epitope.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 9.
Tissue-specific loss of the LCMV epitope during
rCVB3 infection. Two naive C57BL/6 mice were infected with 2 × 106 PFU of rCVB3.2; 4 days later, their hearts or pancreata
were harvested and RNA was prepared. Alternatively, RNA was prepared
from tissue culture cells after four or five viral passages (P4 and P5,
respectively). The RNA was used as a template for RT-PCR with primers
flanking the SfiI cloning site (see Materials and Methods).
(A) PCR products were subjected to agarose gel electrophoresis, and
bands were stained with ethidium bromide. Arrows indicate the expected
band sizes for products from rCVB3.2 (containing the GP33 epitope),
rCVB3.1 (lacking the epitope but containing the SfiI
cloning site), and wtCVB (lacking both the epitope and the
SfiI site). (B) PCR products were cloned by the T-A method.
The resulting bacterial plates were duplicated, and the bacterial
colonies were analyzed by hybridization with radiolabeled probes
specific for CVB or for the GP33 sequence. Following autoradiography,
positive colonies were counted; the data from two independent
experiments are shown. ND, not done.
|
|
 |
DISCUSSION |
The availability of infectious cDNA clones of CVB3 not only
permits the production of genetically pure virus stocks but also allows
the development of a genetic system to prepare rCVB. Here we have
exploited this by incorporating LCMV-specific CD8+ CTL
epitopes into the amino terminus of the CVB3 polyprotein to
evaluate the efficiency with which picornaviruses induce
CD8+ T cells and to determine the role of CD8+
memory T cells in controlling rCVB3 infection. Others have recently reported the successful expression of an adenovirus antibody
epitope in rCVB made from an attenuated CVB3 (21);
here we focus on T-cell responses. The recombinant strains of virus
used in this study had smaller plaques than wtCVB3, and an in vitro
one-step growth curve lagged 1 to 2 h behind that for the parental
wtCVB3 strain (Fig. 2). Several things could explain this lag and the ~1-log-unit reduction in output of infectious virus. For example, there may be less efficient cell binding, entry, and uncoating or
diminished replication of recombinant genomic RNA. The FISH-FACS data
(Fig. 3) point to a defect in an early event in the rCVB3 life cycle
and indicate that once rCVB3 succeeds in infecting a cell, it can
produce genomic RNA in quantities similar to those synthesized by
wild-type virus; consistent with this conclusion, once rCVB3
replication is initiated, the production of infectious particles
proceeds at a rate very similar to that of wtCVB (Fig. 2). It is
possible that the method of cloning has contributed to a defect in the
virion, which in turn has led to a delay in virus entry.
Picornaviruses, including poliovirus (10, 41, 44) and CVB
(41), have a myristate moiety covalently attached to the
glycine residue which immediately follows the initiation codon of the
native polyprotein (see the sequence of wtCVB in Fig. 1). Mutation of
the glycine or, in some circumstances, of other nearby residues
prevents or reduces myristoylation and is often lethal
(31). In the absence of myristoylation, RNA transcription appears unaffected (31), but there are multiple defects in
the viral life cycle, including disruption of polyprotein processing and virus assembly, and mutant particles show reduced infectivity (5, 29, 32, 39, 40). Recombinant polioviruses made using
this cloning strategy showed a delay in myristoylation, although it did
eventually proceed by a novel pathway; the viruses showed reduced
infectivity (33). Thus, our findings with rCVB are
consistent with substandard myristoylation, which may somewhat reduce
viral infectivity and delay the onset of replication.
The rCVB described here replicated well in vivo; viral titers in the
pancreas were comparable to those seen during wtCVB infection, and the
rCVB caused severe pancreatitis. Nevertheless, the viruses were
markedly attenuated, as indicated by a much higher 50% lethal dose and
minimal myocarditis. Several studies have shown that changes in the
untranslated 5' region of CVB3 attenuate the virus and decrease its
cardiovirulence (50); we therefore consider it possible
that our insertion of foreign sequences into the amino terminus of the
polyprotein might have altered the secondary structure of the viral RNA
in the 5' untranslated region, thus decreasing viral cardiovirulence
and lethality. We are currently constructing new recombinant strains of
CVB3 in which the cloning site lies inside farther the polyprotein ORF,
and therefore farther from the 5' untranslated region, to determine if
we can isolate cardiovirulent rCVB3.
Several reports have shown that CVB3-induced myocarditis is the result
of triggering of a cross-reactive autoimmune response against cardiac
tissue (12, 14, 24, 54). The results of our study do not
support such a mechanism. The rCVB3 used in this study replicated well
in vivo; replication in the pancreas was similar for rCVB3 and wtCVB3
(Fig. 4) and differed from that of the parental (cardiovirulent) strain
of virus only by the addition of heterologous viral sequences in the
amino terminus of the polyprotein (Fig. 1). Therefore, since these
recombinant constructs still encode and express all of the native viral
proteins, they should be able to induce autoreactivity against heart
tissue. The absence of severe myocarditis during rCVB infection
suggests that no such autoimmunity has been induced. Instead, the mild
myocarditis is consistent with the reduced viral titers in the heart of
rCVB-infected mice (Fig. 4). We (15, 18) and others
(22, 27), have demonstrated that CD8+ T cells
are involved with the induction of myocarditis, and we speculate that
myocarditis is caused by a combination of host and viral factors in
which the virus must replicate to high titers in the heart and induce
both substantial damage and the accumulation of a large number of
virus-specific lymphocytes.
The failure of rCVB3.2 to induce a detectable GP33-specific response
following infection of naive mice seems to reflect a general inability
of CVB to induce CD8+ T-cell responses. Activated T cells
can be identified by incubating splenocytes with anti-CD3 antibody; the
activated cells produce IFN-
(43). Using this method,
>50% of CD8+ T cells from LCMV-infected mice (day 7 postinfection) produce IFN-
after anti-CD3 stimulation; in contrast,
7 days after rCVB3 infection, <4% respond to anti-CD3 stimulation, a
response similar to that seen after stimulation of naive
CD8+ T cells (data not shown). Although others have
presented unequivocal proof that recombinant polioviruses can induce
CD8+ T cells, these responses were not identified directly
ex vivo and instead required 5 days of secondary in vitro restimulation to expand them to detectable levels (30, 49). This need
for restimulation contrasts with other approaches to vaccination; for
example, following a single immunization with plasmid DNA, antigen-specific CD8+ responses can be readily detected
directly ex vivo and can constitute 0.4 to ~3% of the total
CD8+ T-cell population (2, 3, 17), and
antigen-specific responses can be detected directly ex vivo following
vaccination with recombinant vaccinia viruses (17). Taken
together, these findings suggest that picornavirus-based vaccines may
be limited in their ability to induce CD8+ T-cell responses.
Our data raise questions about the biological importance of
"cross-priming" (also termed cross-presentation), a process in which exogenous antigens are taken up by antigen-presenting cells APCs,
and processed into the MHC class I pathway. Elegant studies using
poliovirus receptor transgenic mice (49) led the authors to conclude that recombinant polioviruses induced CTL by this means,
and it has been suggested that this route of antigen delivery is the
dominant means by which intracellular organisms induce CTL
(8). If this is the case, one might expect that rCVB3.2 would induce good CTL responses, since (i) the recombinant virus encodes a strong CD8+ T-cell epitope, (ii) it
replicates to high titer in vivo, and (iii) a significant proportion of
the viruses retain the epitope at 4 days postinfection, a time
point beyond which virus titers rapidly decline. However, although
rCVB3.2 expresses the GP33 epitope in vivo (Fig. 6), it is unable
to induce detectable responses to the GP33 epitope, which, when
expressed by LCMV, induces a massive response (Fig. 7). Therefore, it
appears that cross-priming is not an efficient way by which to present
all proteins made during virus infection.
An important goal of this study was to determine the efficacy of
preexisting picornavirus-specific CD8+ T cells in combating
subsequent viral challenge. By immunizing mice with LCMV prior to rCVB3
infection, we were able to determine whether vaccination with a single
CD8+ T-cell epitope could play a role in viral
clearance. As shown in Fig. 8, LCMV-specific memory cells had no effect
on rCVB3.3 (which does not encode an H-2b
epitope) but substantially reduced the titers of rCVB3.2. These effects were seen as early as 2 days postinfection and became more
apparent by 4 days postinfection, when rCVB3.2 titers in the heart were
almost 50-fold lower in LCMV-immune animals. The difference in virus
titers in the pancreas (~six fold lower by 2 days postinfection) was
less pronounced than that observed in the heart and may be related to
the massive destruction of acinar cells that is observed during CVB3
infection; since CVB3 caused severe destruction of the exocrine
pancreas (Fig. 5), it is possible that the number of available acinar
cells was a limiting factor for viral replication in this organ.
Alternatively, CVB-specific CD8+ T cells may play a more
important antiviral role in the heart than in the pancreas (see below).
Our demonstration that picornavirus-specific CD8+ T cells
reduce the virus load 6-fold to 50-fold is consistent with our previous
study using mice depleted of CD8+ T cells, in which virus
titers were increased ~20-fold (18).
One might expect that the reduced infectivity of rCVB would provide a
selective pressure favoring revertant viruses which had jettisoned the
inserted sequences. However, in tissue culture, some 99% of viruses
retained the insert after four passages and ~76% retained it after
five (Fig. 9). This contrasts with a recent analysis of recombinant
polioviruses made using this cloning strategy, which were found to be
extremely unstable (42). These authors suggested
that longer inserts might be less stable; thus, the stability of the
inserts in the rCVB described here might be attributed to their
brevity. However, we have prepared as rCVB expressing green fluorescent
protein (GFP), and this virus maintains GFP expression through several
passages in tissue culture and to at least day 4 in vivo (I. Mena, R. Feuer, and J. L. Whitton, unpublished data). Remarkably, when we
analyzed the in vivo stability, we uncovered an organ-specific effect;
almost all virus isolated from the heart had lost the insert by 4 days
postinfection, while a significant proportion of pancreatic virus had
retained the insert. Perhaps the reduced infectivity of rCVB3, seen in
tissue culture (Fig. 2B), has a more marked inhibitory effect on
infection of myocardial cells than of acinar cells; if so, the
selective pressure favoring revertant virus would be stronger in the
heart than in the pancreas. Alternatively, it is tempting to suggest that the selective pressure exerted on the virus by
GP33-specific CD8+ T cells is stronger in the
heart than in the pancreas. We have previously identified a difference
in the roles played by CVB-specific CD8+ T cells in these
organs; perforin-mediated CD8+ T-cell activity contributes
to destruction of myocardial cells (15) but not to acinar
cell death (36). Experiments are under way to distinguish
among these and other possible explanations for the organ-specific
selection of viral variants.
This study demonstrates the feasibility of engineering rCVB3 strains
for elucidating the immunological mechanisms of viral clearance and
disease. We have shown that rCVB3 can be generated that express
heterologous CTL epitopes in vivo and that CD8+ T cells
play a role in controlling rCVB3 infection in target organs such as the
heart and pancreas. In addition to characterizing the role of
CD8+ T cells, similar rCVB3 constructs could be made that
express well-characterized CD4+ T-cell epitopes alone
or in combination with CD8+ epitopes. Thus, the genetic
system described here provides a useful tool for studying many
questions regarding CVB3 infection, pathogenesis, and immunity.
 |
ACKNOWLEDGMENTS |
We are grateful to Annette Lord for excellent secretarial support.
This work was supported by NIH grant AI-32134.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Neuropharmacology, CVN-9, The Scripps Research Institute, 10550 N. Torrey Pines Rd., La Jolla, CA 92037. Phone: (858) 784-7090. Fax: (858) 784-7380. E-mail: lwhitton{at}scripps.edu.
Manuscript 12836-NP from the Scripps Research Institute.
Present address: Institut Pasteur, 75724 Paris Cedex 15, France.
 |
REFERENCES |
| 1.
|
Alexander, L.,
H. H. Lu, and E. Wimmer.
1994.
Polioviruses containing picornavirus type 1 and/or type 2 internal ribosomal entry site elements: genetic hybrids and the expression of a foreign gene.
Proc. Natl. Acad. Sci. USA
91:1406-1410[Abstract/Free Full Text].
|
| 2.
|
Allen, T. M.,
T. U. Vogel,
D. H. Fuller,
B. R. Mothe,
S. Steffen,
J. E. Boyson,
T. Shipley,
J. Fuller,
T. Hanke,
A. Sette,
J. D. Altman,
B. Moss,
A. J. McMichael, and D. I. Watkins.
2000.
Induction of AIDS virus-specific CTL activity in fresh, unstimulated peripheral blood lymphocytes from rhesus macaques vaccinated with a DNA prime/modified vaccinia virus Ankara boost regimen.
J. Immunol.
164:4968-4978[Abstract/Free Full Text].
|
| 3.
|
An, L. L.,
F. Rodriguez,
S. Harkins,
J. Zhang, and J. L. Whitton.
2000.
Quantitative and qualitative analyses of the immune responses induced by a multivalent minigene DNA vaccine.
Vaccine
18:2132-2141[CrossRef][Medline].
|
| 4.
|
Andino, R.,
D. Silvera,
S. D. Suggett,
P. L. Achacoso,
C. J. Miller,
D. Baltimore, and M. B. Feinberg.
1994.
Engineering poliovirus as a vaccine vector for the expression of diverse antigens.
Science
265:1448-1451[Abstract/Free Full Text].
|
| 5.
|
Ansardi, D. C.,
D. C. Porter, and C. D. Morrow.
1992.
Myristylation of poliovirus capsid precursor P1 is required for assembly of subviral particles.
J. Virol.
66:4556-4563[Abstract/Free Full Text].
|
| 6.
|
Burke, K. L.,
G. Dunn,
M. Ferguson,
P. D. Minor, and J. W. Almond.
1988.
Antigen chimaeras of poliovirus as potential new vaccines.
Nature
332:81-82[CrossRef][Medline].
|
| 7.
|
Cao, J.,
R. A. Vescio,
C. H. Hong,
A. Kim,
A. K. Lichtenstein, and J. R. Berenson.
1995.
Identification of malignant cells in multiple myeloma bone marrow with immunoglobulin VH gene probes by fluorescent in situ hybridization and flow cytometry.
J. Clin. Investig.
95:964-972.
|
| 8.
|
Carbone, F. R.,
C. Kurts,
S. R. Bennett,
J. F. Miller, and W. R. Heath.
1998.
Cross-presentation: a general mechanism for CTL immunity and tolerance.
Immunol. Today
19:368-373[CrossRef][Medline].
|
| 9.
|
Choi, W. S.,
R. Pal-Ghosh, and C. D. Morrow.
1991.
Expression of human immunodeficiency virus type 1 (HIV-1) gag, pol, and env proteins from chimeric HIV-1-poliovirus minireplicons.
J. Virol.
65:2875-2883[Abstract/Free Full Text].
|
| 10.
|
Chow, M.,
J. F. Newman,
D. Filman,
J. M. Hogle,
D. J. Rowlands, and F. Brown.
1987.
Myristylation of picornavirus capsid protein VP4 and its structural significance.
Nature
327:482-486[CrossRef][Medline].
|
| 11.
|
Clements, G. B.,
D. N. Galbraith, and K. W. Taylor.
1995.
Coxsackie B virus infection and onset of childhood diabetes.
Lancet
346:221-223[CrossRef][Medline].
|
| 12.
|
Cunningham, M. W.,
S. M. Antone,
J. M. Gulizia,
B. M. McManus,
V. A. Fischetti, and C. J. Gauntt.
1992.
Cytotoxic and viral neutralizing antibodies crossreact with streptococcal M protein, enteroviruses, and human cardiac myosin.
Proc. Natl. Acad. Sci. USA
89:1320-1324[Abstract/Free Full Text].
|
| 13.
|
Evans, D. J.,
J. McKeating,
J. M. Meredith,
K. L. Burke,
K. Katrak,
A. John,
M. Ferguson,
P. D. Minor,
R. A. Weiss, and J. W. Almond.
1989.
An engineered poliovirus chimaera elicits broadly reactive HIV-1 neutralizing antibodies.
Nature
339:385-388[CrossRef][Medline].
|
| 14.
|
Gauntt, C. J.,
H. M. Arizpe,
A. L. Higdon,
H. J. Wood,
D. F. Bowers,
M. M. Rozek, and R. Crawley.
1995.
Molecular mimicry, anti-coxsackievirus B3 neutralizing monoclonal antibodies, and myocarditis.
J. Immunol.
154:2983-2995[Abstract].
|
| 15.
|
Gebhard, J. R.,
C. M. Perry,
S. Harkins,
T. Lane,
I. Mena,
V. C. Asensio,
I. L. Campbell, and J. L. Whitton.
1998.
Coxsackievirus B3-induced myocarditis: perforin exacerbates disease, but plays no detectable role in virus clearance.
Am. J. Pathol.
153:417-428[Abstract/Free Full Text].
|
| 16.
|
Geller, T. J., and D. Condie.
1995.
A case of protracted coxsackie virus meningoencephalitis in a marginally immunodeficient child treated successfully with intravenous immunoglobulin.
J. Neurol. Sci.
129:131-133.
|
| 17.
|
Hassett, D. E.,
M. K. Slifka,
J. Zhang, and J. L. Whitton.
2000.
Direct ex vivo kinetic and phenotypic analyses of CD8+ T-cell responses induced by DNA immunization.
J. Virol.
74:8286-8291[Abstract/Free Full Text].
|
| 18.
|
Henke, A.,
S. A. Huber,
A. Stelzner, and J. L. Whitton.
1995.
The role of CD8+ T lymphocytes in coxsackievirus B3-induced myocarditis.
J. Virol.
69:6720-6728[Abstract].
|
| 19.
|
Henke, A.,
E. Wagner,
J. L. Whitton,
R. Zell, and A. Stelzner.
1998.
Protection of mice against lethal coxsackievirus B3 infection by using DNA immunization.
J. Virol.
72:8327-8331[Abstract/Free Full Text].
|
| 20.
|
Hertel, N. T.,
F. K. Pedersen, and C. Heilmann.
1989.
Coxsackie B3 virus encephalitis in a patient with agammaglobulinaemia.
Eur. J. Pediatr.
148:642-643[CrossRef][Medline].
|
| 21.
|
Hofling, K.,
S. Tracy,
N. Chapman,
K. S. Kim, and L. J. Smith.
2000.
Expression of an antigenic adenovirus epitope in a group B coxsackievirus.
J. Virol.
74:4570-4578[Abstract/Free Full Text].
|
| 22.
|
Huber, S. A., and L. P. Job.
1983.
Cellular immune mechanisms in Coxsackievirus group B, type 3 induced myocarditis in Balb/C mice.
Adv. Exp. Med. Biol.
161:491-508[Medline].
|
| 23.
|
Huber, S. A.,
J. Kupperman, and M. K. Newell.
1999.
Hormonal regulation of CD4+ T-cell responses in coxsackievirus B3-induced myocarditis in mice.
J. Virol.
73:4689-4695[Abstract/Free Full Text].
|
| 24.
|
Huber, S. A., and P. A. Lodge.
1984.
Coxsackievirus B-3 myocarditis in Balb/c mice. Evidence for autoimmunity to myocyte antigens.
Am. J. Pathol.
116:21-29[Abstract].
|
| 25.
|
Kang, Y.,
N. K. Chatterjee,
M. J. Nodwell, and J. W. Yoon.
1994.
Complete nucleotide sequence of a strain of coxsackie B4 virus of human origin that induces diabetes in mice and its comparison with nondiabetogenic coxsackie B4 JBV strain.
J. Med. Virol
44:353-361[Medline].
|
| 26.
|
Kew, O. M.,
R. W. Sutter,
B. K. Nottay,
M. J. McDonough,
D. R. Prevots,
L. Quick, and M. A. Pallansch.
1998.
Prolonged replication of a type 1 vaccine-derived poliovirus in an immunodeficient patient.
J Clin. Microbiol.
36:2893-2899[Abstract/Free Full Text].
|
| 27.
|
Klingel, K., and R. Kandolf.
1993.
The role of enterovirus replication in the development of acute and chronic heart muscle disease in different immunocompetent mouse strains.
Scand. J. Infect. Dis. Suppl.
88:79-85[Medline].
|
| 28.
|
Knowlton, K. U.,
E. S. Jeon,
N. Berkley,
R. Wessely, and S. A. Huber.
1996.
A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3.
J. Virol.
70:7811-7818[Abstract].
|
| 29.
|
Krausslich, H. G.,
C. Holscher,
Q. Reuer,
J. Harber, and E. Wimmer.
1990.
Myristoylation of the poliovirus polyprotein is required for proteolytic processing of the capsid and for viral infectivity.
J. Virol.
64:2433-2436[Abstract/Free Full Text].
|
| 30.
|
Mandl, S.,
L. J. Sigal,
K. L. Rock, and R. Andino.
1998.
Poliovirus vaccine vectors elicit antigen-specific cytotoxic T cells and protect mice against lethal challenge with malignant melanoma cells expressing a model antigen.
Proc. Natl. Acad. Sci. USA
95:8216-8221[Abstract/Free Full Text].
|
| 31.
|
Marc, D.,
G. Drugeon,
A. L. Haenni,
M. Girard, and S. van der Werf.
1989.
Role of myristoylation of poliovirus capsid protein VP4 as determined by site-directed mutagenesis of its N-terminal sequence.
EMBO J.
8:2661-2668[Medline].
|
| 32.
|
Marc, D.,
G. Masson,
M. Girard, and S. van der Werf.
1990.
Lack of myristoylation of poliovirus capsid polypeptide VPO prevents the formation of virions or results in the assembly of noninfectious virus particles.
J. Virol.
64:4099-4107[Abstract/Free Full Text].
|
| 33.
|
Mattion, N. M.,
P. A. Reilly,
E. Camposano,
S. L. Wu,
S. J. DiMichele,
S. T. Ishizaka,
S. E. Fantini,
J. C. Crowley, and C. Weeks-Levy.
1995.
Characterization of recombinant polioviruses expressing regions of rotavirus VP4, hepatitis B surface antigen, and herpes simplex virus type 2 glycoprotein D.
J. Virol.
69:5132-5137[Abstract].
|
| 34.
|
Mattion, N. M.,
P. A. Reilly,
S. J. DiMichele,
J. C. Crowley, and C. Weeks-Levy.
1994.
Attenuated poliovirus strain as a live vector: expression of regions of rotavirus outer capsid protein VP7 by using recombinant Sabin 3 viruses.
J. Virol.
68:3925-3933[Abstract/Free Full Text].
|
| 35.
|
McKinney, R. E. J.,
S. L. Katz, and C. M. Wilfert.
1987.
Chronic enteroviral meningoencephalitis in agammaglobulinemic patients.
Rev. Infect. Dis.
9:334-356[Medline].
|
| 36.
|
Mena, I.,
C. Fischer,
J. R. Gebhard,
C. M. Perry,
S. Harkins, and J. L. Whitton.
2000.
Coxsackievirus infection of the pancreas: evaluation of receptor expression, pathogenesis, and immunopathology.
Virology
271:276-288[CrossRef][Medline].
|
| 37.
|
Mena, I.,
C. M. Perry,
S. Harkins,
F. Rodriguez,
J. R. Gebhard, and J. L. Whitton.
1999.
The role of B lymphocytes in coxsackievirus B3 infection.
Am. J. Pathol.
155:1205-1215[Abstract/Free Full Text].
|
| 38.
|
Misbah, S. A.,
G. P. Spickett,
P. C. Ryba,
J. M. Hockaday,
J. S. Kroll,
C. Sherwood,
J. B. Kurtz,
E. R. Moxon, and H. M. Chapel.
1992.
Chronic enteroviral meningoencephalitis in agammaglobulinemia: case report and literature review.
J. Clin. Immunol.
12:266-270[CrossRef][Medline].
|
| 39.
|
Moscufo, N., and M. Chow.
1992.
Myristate-protein interactions in poliovirus: interactions of VP4 threonine 28 contribute to the structural conformation of assembly intermediates and the stability of assembled virions.
J. Virol.
66:6849-6857[Abstract/Free Full Text].
|
| 40.
|
Moscufo, N.,
J. Simons, and M. Chow.
1991.
Myristoylation is important at multiple stages in poliovirus assembly.
J. Virol.
65:2372-2380[Abstract/Free Full Text].
|
| 41.
|
Muckelbauer, J. K.,
M. Kremer,
I. Minor,
G. Diana,
F. J. Dutko,
J. Groarke,
D. C. Pevear, and M. G. Rossmann.
1995.
The structure of coxsackievirus B3 at 3.5 A resolution.
Structure
3:653-667.
|
| 42.
|
Mueller, S., and E. Wimmer.
1998.
Expression of foreign proteins by poliovirus polyprotein fusion: analysis of genetic stability reveals rapid deletions and formation of cardioviruslike open reading frames.
J. Virol.
72:20-31[Abstract/Free Full Text].
|
| 43.
|
Nguyen, K. B., and C. A. Biron.
1999.
Synergism for cytokine-mediated disease during concurrent endotoxin and viral challenges: roles for NK and T cell IFN-gamma production.
J. Immunol.
162:5238-5246[Abstract/Free Full Text].
|
| 44.
|
Paul, A. V.,
A. Schultz,
S. E. Pincus,
S. Oroszlan, and E. Wimmer.
1987.
Capsid protein VP4 of poliovirus is N-myristoylated.
Proc. Natl. Acad. Sci. USA
84:7827-7831[Abstract/Free Full Text].
|
| 45.
|
Ramsingh, A.,
J. Slack,
J. Silkworth, and A. Hixson.
1989.
Severity of disease induced by a pancreatropic Coxsackie B4 virus correlates with the H-2Kq locus of the major histocompatibility complex.
Virus Res.
14:347-358[CrossRef][Medline].
|
| 46.
|
Ramsingh, A. I.
1997.
Coxsackieviruses and pancreatitis.
Front. Biosci.
2:e53-e62[Medline]
|
| 47.
|
Riecansky, I.,
Z. Schreinerova,
A. Egnerova,
A. Petrovicova, and O. Bzduchova.
1989.
Incidence of Coxsackie virus infection in patients with dilated cardiomyopathy.
Cor Vasa
31:225-230[Medline].
|
| 48.
|
Roivainen, M.,
M. Knip,
H. Hyoty,
P. Kulmala,
M. Hiltunen,
P. Vahasalo,
T. Hovi, and H. K. Akerblom.
1998.
Several different enterovirus serotypes can be associated with prediabetic autoimmune episodes and onset of overt IDDM. Childhood Diabetes in Finland (DiMe) Study Group.
J. Med. Virol
56:74-78[CrossRef][Medline].
|
| 49.
|
Sigal, L. J.,
S. Crotty,
R. Andino, and K. L. Rock.
1999.
Cytotoxic T-cell immunity to virus-infected non-haematopoietic cells requires presentation of exogenous antigen.
Nature
398:77-80[CrossRef][Medline].
|
| 50.
|
Tracy, S.,
N. M. Chapman,
J. Romero, and A. I. Ramsingh.
1996.
Genetics of coxsackievirus B cardiovirulence and inflammatory heart muscle disease.
Trends Microbiol.
4:175-179[CrossRef][Medline].
|
| 51.
|
Whitton, J. L.,
J. R. Gebhard,
H. Lewicki,
A. Tishon, and M. B. A. Oldstone.
1988.
Molecular definition of a major cytotoxic T-lymphocyte epitope in the glycoprotein of lymphocytic choriomeningitis virus.
J. Virol.
62:687-695[Abstract/Free Full Text].
|
| 52.
|
Whitton, J. L., and A. Tishon.
1990.
Use of CTL clones in vitro to map CTL epitopes, p. 104-115.
In
M. B. A. Oldstone (ed.), Animal virus pathogenesis: a practical approach. Oxford University Press, Oxford, United Kingdom.
|
| 53.
|
Whitton, J. L.,
A. Tishon,
H. Lewicki,
J. R. Gebhard,
T. Cook,
M. S. Salvato,
E. Joly, and M. B. A. Oldstone.
1989.
Molecular analyses of a five-amino-acid cytotoxic T-lymphocyte (CTL) epitope: an immunodominant region which induces nonreciprocal CTL cross-reactivity.
J. Virol.
63:4303-4310[Abstract/Free Full Text].
|
| 54.
|
Wolfgram, L. J.,
K. W. Beisel, and N. R. Rose.
1985.
Heart-specific autoantibodies following murine coxsackievirus B3 myocarditis.
J. Exp. Med.
161:1112-1121[Abstract/Free Full Text].
|
| 55.
|
Woodruff, J. F.
1979.
Lack of correlation between neutralizing antibody production and suppression of coxsackievirus B-3 replication in target organs: evidence for involvement of mononuclear inflammatory cells in host defense.
J. Immunol.
123:31-36[Abstract/Free Full Text].
|
| 56.
|
Woodruff, J. F.
1980.
Viral myocarditis. A review.
Am. J. Pathol.
101:425-484[Medline].
|
| 57.
|
Woodruff, J. F., and J. J. Woodruff.
1974.
Involvement of T lymphocytes in the pathogenesis of coxsackie virus B3 heart disease.
J. Immunol.
113:1726-1734[Abstract/Free Full Text].
|
Journal of Virology, March 2001, p. 2377-2387, Vol. 75, No. 5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.5.2377-2387.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Marchant, D., Sall, A., Si, X., Abraham, T., Wu, W., Luo, Z., Petersen, T., Hegele, R. G., McManus, B. M.
(2009). ERK MAP kinase-activated Arf6 trafficking directs coxsackievirus type B3 into an unproductive compartment during virus host-cell entry. J. Gen. Virol.
90: 854-862
[Abstract]
[Full Text]
-
Weinzierl, A. O., Rudolf, D., Maurer, D., Wernet, D., Rammensee, H.-G., Stevanovic, S., Klingel, K.
(2008). Identification of HLA-A*01- and HLA-A*02-restricted CD8+ T-cell epitopes shared among group B enteroviruses. J. Gen. Virol.
89: 2090-2097
[Abstract]
[Full Text]
-
Kemball, C. C., Harkins, S., Whitton, J. L.
(2008). Enumeration and Functional Evaluation of Virus-Specific CD4+ and CD8+ T Cells in Lymphoid and Peripheral Sites of Coxsackievirus B3 Infection. J. Virol.
82: 4331-4342
[Abstract]
[Full Text]
-
Crocker, S. J., Frausto, R. F., Whitmire, J. K., Benning, N., Milner, R., Whitton, J. L.
(2007). Amelioration of Coxsackievirus B3-Mediated Myocarditis by Inhibition of Tissue Inhibitors of Matrix Metalloproteinase-1. Am. J. Pathol.
171: 1762-1773
[Abstract]
[Full Text]
-
Cornell, C. T., Kiosses, W. B., Harkins, S., Whitton, J. L.
(2007). Coxsackievirus B3 Proteins Directionally Complement Each Other To Downregulate Surface Major Histocompatibility Complex Class I. J. Virol.
81: 6785-6797
[Abstract]
[Full Text]
-
Cornell, C. T., Kiosses, W. B., Harkins, S., Whitton, J. L.
(2006). Inhibition of protein trafficking by coxsackievirus b3: multiple viral proteins target a single organelle.. J. Virol.
80: 6637-6647
[Abstract]
[Full Text]
-
Fujinami, R. S., von Herrath, M. G., Christen, U., Whitton, J. L.
(2006). Molecular Mimicry, Bystander Activation, or Viral Persistence: Infections and Autoimmune Disease. Clin. Microbiol. Rev.
19: 80-94
[Abstract]
[Full Text]
-
Harkins, S., Cornell, C. T., Whitton, J. L.
(2005). Analysis of Translational Initiation in Coxsackievirus B3 Suggests an Alternative Explanation for the High Frequency of R+4 in the Eukaryotic Consensus Motif. J. Virol.
79: 987-996
[Abstract]
[Full Text]
-
Chua, M. M., MacNamara, K. C., San Mateo, L., Shen, H., Weiss, S. R.
(2004). Effects of an Epitope-Specific CD8+ T-Cell Response on Murine Coronavirus Central Nervous System Disease: Protection from Virus Replication and Antigen Spread and Selection of Epitope Escape Mutants. J. Virol.
78: 1150-1159
[Abstract]
[Full Text]
-
Feuer, R., Mena, I., Pagarigan, R. R., Harkins, S., Hassett, D. E., Whitton, J. L.
(2003). Coxsackievirus B3 and the Neonatal CNS: The Roles of Stem Cells, Developing Neurons, and Apoptosis in Infection, Viral Dissemination, and Disease. Am. J. Pathol.
163: 1379-1393
[Abstract]
[Full Text]
-
Kim, T. S., Perlman, S.
(2003). Protection Against CTL Escape and Clinical Disease in a Murine Model of Virus Persistence. J. Immunol.
171: 2006-2013
[Abstract]
[Full Text]
-
Feuer, R., Mena, I., Pagarigan, R., Slifka, M. K., Whitton, J. L.
(2002). Cell Cycle Status Affects Coxsackievirus Replication, Persistence, and Reactivation In Vitro. J. Virol.
76: 4430-4440
[Abstract]
[Full Text]
-
Lee, S.-G., Kim, D.-Y., Hyun, B.-H., Bae, Y.-S.
(2002). Novel Design Architecture for Genetic Stability of Recombinant Poliovirus: the Manipulation of G/C Contents and Their Distribution Patterns Increases the Genetic Stability of Inserts in a Poliovirus-Based RPS-Vax Vector System. J. Virol.
76: 1649-1662
[Abstract]
[Full Text]