Previous Article | Next Article 
Journal of Virology, March 2001, p. 2345-2352, Vol. 75, No. 5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.5.2345-2352.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Latently Expressed Human Herpesvirus 8-Encoded
Interferon Regulatory Factor 2 Inhibits Double-Stranded
RNA-Activated Protein Kinase
Ladislav
Burý
ek1,
and
Paula M.
Pitha1,2,*
Oncology Center1 and
Department of Molecular Biology and
Genetics,2 The Johns Hopkins University School
of Medicine, Baltimore, Maryland 21231
Received 28 April 2000/Accepted 29 November 2000
 |
ABSTRACT |
Human herpesvirus 8 (HHV-8; Kaposi's sarcoma herpesvirus) encodes
four open reading frames with homology to cellular proteins of
interferon regulatory factor (IRF) family. Three of them, viral IRF-1
(vIRF-1), vIRF-2, and vIRF-3, have been cloned and found, when
overexpressed, to down-regulate the transcriptional activity of
interferon type I gene promoters in infected cells by interfering with
the transactivating activity of cellular IRFs. In this study, we have
further characterized vIRF-2 and shown that it is a nuclear protein
which is constitutively expressed in HHV-8-positive pleural effusion
lymphoma cell lines. Nuclear localization of vIRF-2 was confirmed by in
situ detection of ectopically expressed enhanced green fluorescent
protein/vIRF-2 fusion protein. We found that the expression of vIRF-2
in HEK293 cells inhibited the antiviral effect of interferon and
rescued translation of vesicular stomatitis virus mRNA from
interferon-induced translational block. To provide insight into the
mechanism of this effect we have demonstrated that vIRF-2 physically
interacts with PKR consequently inhibiting autophosphorylation of
double-stranded RNA-activated protein kinase (PKR) and blocking
phosphorylation of PKR substrates histone 2A and eukaryotic translation
initiation factor 2
. These results suggest that the latently
expressed vIRF-2 has a role in viral mimicry which targets the activity
of interferon-induced PKR kinase. By inhibiting the kinase activity of
PKR and consequent down-modulation of protein synthesis, HHV-8 has
evolved a mechanism by which it can overcome the interferon-mediated
antiviral effect. Thus, the anti-interferon functions of vIRF-2 may
contribute to the establishment of a chronic or latent infection.
 |
INTRODUCTION |
Human herpesvirus 8 (HHV-8;
Kaposi's sarcoma herpesvirus) is consistently found in all clinical
forms of Kaposi's sarcoma (2, 6), AIDS-associated body
cavity-based lymphoma or pleural effusion lymphoma (5),
and multicentric Castleman's disease (15, 42). HHV-8
belongs to family Rhadinovirinae; its closest relative is a
recently discovered rhesus monkey rhadinovirus that contains high
number of homologous open reading frames (ORFs) with similar genomic
arrangements (1). The HHV-8 genome has been found to
contain a unique set of nonstructural genes which may be part of viral
mimicry and essential for viral replication in vivo and for
pathogenicity (36). HHV-8 encodes four homologues of
cellular interferon (IFN) regulatory factors (IRFs); of these, ORF
K9-encoded viral IRF-1 (vIRF-1) (3, 16, 27, 47) and ORF
k11.1-encoded vIRF-2 (4), have been cloned and
characterized, and the cloning of vIRF-3 (ORF k10.5 and 10.6) has been
described recently (29). The expression of vIRF-1 is very
low in BCBL-1 cells but can be induced by tetradecanoyl phorbol acetate
(TPA) treatment (31). Several groups (16, 29, 33,
47) have shown that vIRF-1 can function as a repressor of
promoters containing an IFN-sensitive response element. This inhibition
is at least partially due to the binding of vIRF-1 to the cellular IRFs
as well as competitive binding to the transcriptional coactivator CBP/p300 (3). NIH 3T3 cells overexpressing vIRF-1 gained
the ability to grow in soft agar and to form tumors in nude mice
(18, 27). We have previously cloned and characterized a
second HHV-8-encoded vIRF, vIRF-2, that encodes a short protein of 163 amino acids. It is constitutively transcribed, and vIRF-2 transcripts
can be detected in HHV-8-positive B-lymphoma cell lines. We have shown that vIRF-2 is a DNA binding protein with a specificity distinct from
that of the cellular IRF, since it binds to an oligonucleotide corresponding to the NF-
B site (4). In a transient
transfection assay, vIRF-2 inhibits the virus-mediated induction of IFN
type I gene transcription as well as RelA-stimulated activity of the human immunodeficiency virus long terminal repeat. vIRF-2 specifically binds to several transcription factors such as IRF-1, IRF-2, ICSBP (interferon concensus sequence binding protein), and RelA/p65, as well
as to the transcription coactivator CBP/p300.
IFNs, as major mediators of innate antiviral defense mechanisms,
stimulate the expression of a wide range of cellular genes. Some of
these genes encode proteins that can modulate viral replication, with
consequent generation of an antiviral state in IFN-treated cells. Among
these, the IFN-induced, double-stranded RNA (dsRNA)-activated serine-threonine protein kinase (PKR) is a key mediator of the antiviral and antiproliferative effects of IFN (10, 17, 32, 40). PKR is present in an inactive form in cytosol, and its expression can be further enhanced by treatment with IFN. PKR is
activated by number of agents; however, the activation by dsRNA has
been studied most extensively (45). Many viruses produce highly structured viral transcripts which can also activate PKR by a
mechanism similar to that used by dsRNA (43). The binding of dsRNA to PKR was shown to induce conformational changes and expose
the catalytic site for autophosphorylation (13).
Furthermore, the dimerization of PKR was shown to be an important part
of the autophosphorylation process, suggesting that autophosphorylation is intermolecular (22, 32). Activated PKR was reported to target a number of proteins, but the
subunit of eukaryotic
initiation factor 2 (eIF-2
) (37) is the only
physiological substrate characterized in detail. The phosphorylation of
this factor results in inhibition of protein synthesis, consequently
contributing to the antiviral, antiapoptotic, and tumor-suppressing
functions of PKR (45, 46). However, in addition to the
role in protein synthesis, PKR can regulate gene expression at the
transcriptional level. It was demonstrated that PKR regulates NF-
B
signaling by phosphorylation of the inhibitory subunit I
B
(23), and PKR-mediated phosphorylation of histones
(13) and of a 90-kDa protein with unknown function (35) was also demonstrated.
A number of studies have shown that overexpression of wild-type PKR
results in the inhibition of cellular growth in mammalian and insect
cells as well as in yeast (9, 21, 30, 44). Although the
mechanism of growth suppression in eukaryotic cells remains to be
clarified, the repression of translation through inhibition of the
eIF-2
pathway is assumed to play a role in the toxic phenotype.
The aim of this study was to analyze the expression of vIRF-2 on the
protein level and to determine the function of vIRF-2 in virus-host
interactions. We have shown that vIRF-2 is expressed constitutively in
HHV-8-positive pleural effusion lymphoma lines, and the majority of
vIRF-2 protein can be detected in the nucleus. We further show that
ectopically overexpressed vIRF-2 counteracts the IFN-induced block of
viral protein synthesis. The anti-IFN activity is a result of direct
interaction between vIRF-2 and PKR, with consequent inhibition of PKR
activity. Thus, by interfering with PKR function, vIRF-2 can facilitate
virus invasion by down-regulation of the early inflammatory response;
as a constitutively expressed protein, it may also contribute to
establishment and maintenance of viral persistence.
 |
MATERIALS AND METHODS |
Cell culture and transfections.
HEK293 and HeLa cells were
grown in Dulbecco's modified Eagle medium with 10% fetal bovine serum
BCBL-1, HBL-6, and JSC-1 cells were grown in RPMI medium supplemented
with 10% fetal bovine serum. Subconfluent HeLa cells (4.5 × 106 cells/90-mm-diameter plate) were transfected with 30 µg of empty or vIRF-2-expressing plasmid, using the Superfect
(Qiagen) reagent. Where indicated, cells were mock infected or infected
with vesicular stomatitis virus (VSV) at a multiplicity of infection
(MOI) of 10 in serum-free medium for 45 min and then incubated in
complete medium for 5 h. Alternatively, cells were transfected
using the Superfect (Qiagen) reagent with poly(I-C) (10 µg/ml; Sigma)
for 2 h.
Plasmids.
The cloning and construction of plasmids
pcDNA3.1/vIRF-2, pGEXT4/vIRF-2, and pGEXT4/IRF-3 were described
previously (3, 39). FLAG-tagged vIRF-2 fusion protein was
expressed from the same plasmid with a FLAG epitope coding region
inserted at the 5' end of the vIRF-2 cDNA. This modification was done
by PCR using Pfu polymerase (Stratagene) with primers
5'-CTTAAGCTTGCCGCCATGGATTACAAGGATGACGACGATAAGGGATCCATGCCTCGC TACACGGAGTCGG and 3'-GGGAATTCTACATCAACCATCCTACCTCTGG.
To construct the green fluorescent protein (GFP)/vIRF-2 fusion protein,
the vIRF-2 coding sequence was amplified by PCR using primers
5'-GAAGAATTCTGCTCGCTACACGGAGTCGG and
3'-TGGGGATCCTACATCAACCATCCTACCTCTGG and subcloned into
pEGFP-C vector (Invitrogen). All constructs were tested for possible
mutations by direct DNA sequencing.
RT-PCR analysis.
Total RNA was isolated by the Trizol
reagent (Life Technologies) and treated with RNase-free DNase I
(Boehringer Mannheim) for 20 min at 37°C. Four micrograms of total
RNA was used for cDNA synthesis using SuperScript II reverse
transcriptase (RT; Life Technologies) and oligo(dT)20
primer. Two microliters of cDNA-containing reaction mixture was used as
the template in 30 cycles of PCR amplification using sequence-specific
primers as follows: 5- GAAGAATTCATGGCTCGCTACACGGAGTCGG and
3'-TGGGGATCCTACATCAACCATCCTACCTCTGG for the vIRF-2
transcript, 5'-AGCGGATCCCACAGTTTGTTTTTTGAAGAGC and
3'-GCTGAATTCCTAGTCTCTGTGGTAAAATGGG for the K11 transcript, and 5'-GAAGAATTCATGGCTCGCTACACGGAGTCGG and
3'-GCTGAATTCCTAGTCTCTGTGGTAAAATGGG for the vIRF-2 and K11.1
region. PCR products (10 µl) were resolved by 1.5% Tris-borate-EDTA
agarose electrophoresis.
Preparation of recombinant vIRF-2 protein and antibodies.
Preparation of glutathione S-transferase (GST) and
His6 recombinant fusion proteins was described previously
(3). The cleared lysates from
isopropyl-
-D-thiogalactopyranoside (Sigma)-stimulated bacteria were mixed with glutathione-agarose beads (200 µl of a 1:1
slurry in phosphate-buffered saline) (Pharmacia) at 4°C for 2 h,
and the beads were washed three times with ice-cold sonication buffer
(3). Bound proteins were eluted with elution buffer containing 50 mM Tris (pH 8.5), 150 mM NaCl, and 20 mM reduced glutathione. The purity and quantity of fusion proteins were examined by Tricine-sodium dodecyl sulfate (SDS)-10% polyacrylamide gel electrophoresis (PAGE) followed by Coomassie blue staining.
The SDS-PAGE-purified His
6/vIRF-2 protein was used to
generate a polyclonal antibody in New Zealand White rabbits according
to the standard 7-week immunization protocol. The vIRF-2 antiserum
was
further purified on a Ni
2+/chelate affinity column
containing His
6/vIRF-2 protein, and the
antigen-specific
antibodies were eluted with high-pH solution
(0.1 M triethylamine [pH
11.5]). Using purified antibody, we were
able to detect as little as
50 pg of vIRF-2/GST protein by serial
dilution analysis, with virtually
no cross-reactions to any other
recombinant or endogenous proteins.
FLAG-tagged proteins were
detected by mouse monoclonal antibody M2
(Stratagene).
GST pull-down assay.
The 35S-labeled proteins
were synthesized in vitro using the coupled TNT T7
transcription/translation system (Promega) according to the
manufacturer's instructions. Each reaction mixture contained 1 µg of
nonlinearized expression plasmid and was incubated (90 min, 30°C) in
the presence of 4 µl of Translabel (DuPont) amino acid mixture. GST
fusion proteins (0.5 µg) bound to glutathione-agarose beads were
incubated with 10-µl reaction mixture aliquots of
35S-labeled proteins in 250 µl of binding buffer (10 mM
Tris [pH 7.6], 100 mM NaCl, 0.1 mM EDTA [pH 8.0], 1 mM
dithiothreitol, 5 mM MgCl2, 0.05% NP-40, 8% glycerol,
mammalian protease inhibitor cocktail [Sigma]) at 4°C for 90 min.
After three washes (10 min at room temperature) with binding buffer,
the proteins bound to the beads were solubilized in sample buffer and
resolved by Tricine-SDS-PAGE (8% gel). The gel was dried and exposed
to film. Where indicated, HeLa whole-cell lysates were used instead of
rabbit reticulocyte lysates for detection of GST protein interactions.
Bound proteins were electrophoresed, transferred onto polyvinylidene
difluoride membranes (Bio-Rad), and immunoblotted with anti-PKR
antiserum (kindly provided by G. N. Barber). Detection was done
with an enhanced chemiluminescence kit (Pharmacia/Amersham).
In vitro kinase reaction.
Human wild-type PKR was
immunoprecipitated from 107 HeLa cells as follows.
High-salt (500 mM NaCl) cell extracts (600 µl) were incubated with 3 µl of either rabbit polyclonal or mouse monoclonal antibody against
PKR (25) overnight in the presence of protease and
phosphatase inhibitors (inhibitor cocktail; Sigma). Beads with bound
PKR were washed twice with high-salt lysis buffer and twice with kinase
buffer (10 mM Tris [pH 7.6], 50 mM KCl, 2 mM magnesium acetate, 20%
glycerol, 7 mM
-mercaptoethanol, 1 mM MnCl2, 1 µM ATP,
5 µCi of [
-32P]ATP, protease and phosphatase
inhibitors). Where indicated, immunocomplexes were preincubated for 10 min on ice with poly (I-C) (100 µg/ml; Sigma), 2 µg of histone 2A
or 400 ng of purified eIF-2
(kindly provided by J. Jefferson) and
the indicated amount of soluble GST fusion protein. ATF2/GST protein
was purchased from New England Biolabs. Reaction mixtures were
incubated 25 min at 30°C, and reactions were stopped by boiling in
sample buffer. Labeled proteins were resolved by Tricine-SDS-PAGE (8%
gel), dried, and exposed to film.
Metabolic labeling of VSV-infected cells.
HEK293 cells
transfected with either empty or vIRF-2-expressing pcDNA3.1 vector were
mock infected or infected with VSV (MOI of 10) 24 h after
transfection as described above. Cells were pulse-labeled 5 h
after infection with Pro-mix L-35S cell
labeling mix (50 µCi/ml; Amersham/Pharmacia) in Met- and Cys-depleted
medium for 1 h. Cells were than washed with phosphate-buffered saline and lysed in cell lysis buffer. Labeled proteins were resolved by Tricine-SDS-PAGE (8% gel), dried, and then exposed to film or a
PhosphorImager screen for quantification.
 |
RESULTS |
Distinct transcription regulation of vIRF-2 and K11 ORFs in BCBL-1
cells.
We have previously shown by Northern blotting and RT-PCR
analysis that the vIRF-2 ORF (designated K11.1) is constitutively expressed in HHV-8-positive BCBL-1 cells (4). To analyze
vIRF-2 expression in more detail and examine the possibility that
vIRF-2 (K11.1) is transcribed together with the proximal K11 ORF (Fig. 1A) as one transcript, we amplified
vIRF-2 transcripts in BCBL-1 cells by RT-PCR using primers specific for
vIRF-2 and K11, and set of primers that correspond to 5' vIRF-2 and 3'
K11 regions. These primers should amplify the putative common K11 and
K11.1 transcript. As seen in Fig. 1B, RT-PCR amplification of
poly(dT)-primed cDNA with primers specific either for vIRF-2 or K11
amplified only a single fragment which correspond in size to the K11
ORF and vIRF-2 and has the same size as fragments amplified from the genomic DNA. However, no specific product could be amplified with the
combined vIRF-2 and K11 primers, while these two primers were able to
amplify a 2.2-kb fragment from genomic DNA of BCBL-1 cells. Furthermore, while a K11-specific product was detected by RT-PCR only
in samples from TPA-stimulated cells, the vIRF-2-specific fragment was
amplified from both TPA-stimulated and unstimulated cells. These data
suggest that both vIRF-2 and K11 ORFs are expressed in BCBL-1 cells as
distinct full-length polyadenylated transcripts, and in neither induced
nor uninduced cells could we detect a 2.2-kb transcript that would
indicate that the transcription proceeds from vIRF-2 to K11.
Furthermore, these data indicate that vIRF-2 and K11 ORFs are expressed
during different phases of the viral replication cycle.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of vIRF-2 and K11 ORFs in BCBL-1 cells. (A)
Scheme of the 89- to 95-kbp region of the HHV-8 genome showing the
cluster of vIRF-2 (K11.1), K11, and vIRF-3 (K10.5 and K10.6) homologues
of cellular IRFs. (B) RT-PCR analysis from control and TPA (50 ng/ml)-induced BCBL-1 cells for 24 h. Constitutive expression of
vIRF-2 (V2) is in contrast with inducible expression of K11. No
specific product could be detected using a combination of 5' vIRF-2 and
3' K11 primers (V2 + K11), detecting, a theoretical common
transcript. Control PCR products amplified from the BCBL-1 genomic
library are shown. RT-PCR amplification of GPDH mRNA is
shown as a control.
|
|
vIRF-2 protein is constitutively expressed and localized in nucleis
of HHV-8-positive pleural effusion lymphoma cell lines.
To detect
the expression of vIRF-2 in HHV-8-positive B-cell lymphoma lines, we
generated a rabbit polyclonal antiserum against recombinant full-length
His6/vIRF-2 fusion protein. The antiserum was purified by
immunoaffinity chromatography as described in Materials and Methods and
reference 27. Figure 2A
shows the specificity of the purified vIRF-2 antiserum as analyzed by
Western blot hybridization. While the antiserum easily detected 5 ng of vIRF-2/GST protein, no cross-reaction was observed with as much as 500 ng of vIRF-1/GST protein. The antiserum also detected vIRF-2 protein
expressed ectopically in transiently transfected HEK293 cells (Fig.
2B). We also detected in cell lysates from HHV-8-positive BCBL-1 cells
immunoblotted with vIRF-2 antiserum a specific protein with an apparent
molecular mass of 20 kDa (Fig. 2C). No signal was detected in lysates
of HHV-8-negative Louckes cells. The mobility of vIRF-2 as determined
on SDS-PAGE was about 20 kDa, which corresponds well to the predicted
molecular mass of 18.5 kDa. The slight difference in mobility could be
due to posttranslational modification of vIRF-2 or to its high overall
basic nature (pI 9.8). Fractionation of BCBL-1 cells showed that the
majority of vIRF-2 localized in the nuclear fraction; the cytoplasmic
fraction showed only low levels of the protein. These data indicate
that vIRF-2 is a predominantly nuclear protein. In agreement with
analyzes of vIRF-2 mRNA, the relative levels of vIRF-2 protein detected
in unstimulated and TPA-stimulated BCBL-1 cells were the same. Thus,
vIRF-2, like HHV-8-encoded latency-associated nuclear antigen (LANA)
and v-cyclin, is a constitutively expressed nuclear protein
(38).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 2.
Detection of vIRF-2 protein in cell lysates from
HHV-8-positive lymphomas. (A) Specificity of the
His6/vIRF-2-immunopurified antibody is demonstrated by
detection of 5 and 500 ng of vIRF-2/GST fusion protein (lanes 1 and 3).
No cross-reaction with the same amount of vIRF-1/GST protein was
observed (lanes 2 and 4). (B) Detection of ectopically expressed vIRF-2
in NIH 3T3 cells. Cells were transfected with 4 µg of empty or
vIRF-2-expressing pcDNA vector. Whole-cell lysates (20 µg) were
prepared 48 h later and immunoblotted with vIRF-2 antibody. (C)
Detection of vIRF-2 in nuclear and cytoplasmic fractions from BCBL-1
cells. BCBL-1 and control HHV-8-negative Louckes cells were treated
with TPA (50 ng/ml) for 24 h. Cytoplasmic and nuclear fractions
(20 µg) were prepared from control or TPA-stimulated cells by
differential centrifugation and immunoblotted with vIRF-2 antibody. The
only immunoreactive protein, with an apparent mobility of 20 kDa, is
marked. (D) Immunoblot analysis of nuclear extracts (20 µg) from
different cell lines using immunopurified anti-vIRF-2 antibody. The
region around 20 kDa is shown.
|
|
To further test the specificity of the vIRF-2 antibody, we analyzed
nuclear fractions of several cell lines for the presence
of the 20-kDa
immunoreactive protein. The 20-kDa protein was also
detected in two
other HHV-8-positive pleural effusion lymphoma
cell lines, HBL-6 and
JSC-1 (Fig.
2D), while no signal was detected
in HEK293, Jurkat,
Namalwa, and NIH 3T3 cells (data not
shown).
To confirm the nuclear localization of vIRF-2, HeLa cells were
transiently transfected with a plasmid expressing the enhanced
GFP
(EGFP)/vIRF-2 fusion protein. Figure
3A
shows the image captured
by a GFP-specific filter, Fig.
3B shows a
computer-generated overlay
combining images captured by GFP and Hoechst
stain-specific filters.
EGFP/vIRF-2 protein shows evident co
localization with Hoechst
nuclear staining, as indicated by the bright
blue color. In cells
transfected with empty EGFP vector the
GFP-specific signal was
distributed throughout the cells without any
pattern (data not
shown). We were also interested in determining
whether subcellular
localization of vIRF-2 is modulated by an
extracellular signal.
However, neither TPA nor virus infection had any
effect on nuclear
localization of vIRF-2 (data not shown). These data
suggest that
vIRF-2 is transported into nucleus independently of virus
infection
or extracellular signals leading to activation of protein
kinase
C.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Nuclear localization of EGFP/vIRF-2 fusion protein. HeLa
cells were transfected with 4 µg of EGFP/vIRF-2 expression vector.
Cells were fixed 36 h later and counterstained with DNA stain
(Hoechst). (A) Visualization of EGFP/vIRF-2 using a GFP-specific
filter. (B) Computer-generated overlay of sequentially captured images
from the same field, using GPF- and Hoechst-specific filters. Dark blue
shows nuclei; bright blue indicates colocalization of nuclear and EGFP
signals.
|
|
vIRF-2 inhibits the antiviral effect of IFN-
: rescue of VSV mRNA
translation from IFN-induced block.
We have demonstrated
previously that vIRF-2 protein is potent inhibitor of IFN-
and
IFN-
promoters in transient transfection assays. The inhibitory
mechanism involves (i) binding of vIRF-2 to transcription factors IRF-1
and RelA and to transcription coactivator CBP/p300 and (ii) inhibition
of their transactivating potentials (4). To evaluate
whether vIRF-2 can directly inhibit the antiviral effect of IFN, we
tested the effect of vIRF-2 on the IFN-mediated inhibition of VSV
protein synthesis. We selected VSV because of its high sensitivity to
the antiviral effect of IFN. It also has a short replication cycle,
allowing us to use cells transiently transfected with vIRF-2
(14). As shown in Fig. 4A,
HEK293 cells transfected with empty vector were responsive to the
antiviral effect of IFN, and synthesis of VSV early proteins was
significantly reduced by IFN-
2 at concentrations higher
than 360 U/ml. However, in cells transfected with a vIRF-2-expressing
vector, viral protein synthesis was not significantly inhibited even
when a high concentration (1,000 U/ml) of IFN-
2 was used
(Fig. 4A). Quantitation of relative levels of VSV matrix protein
detected in IFN-treated cells in the presence and absence of vIRF-2 is
shown in Fig. 4B. The relative levels of VSV matrix protein were not
affected by IFN treatment, even at a high IFN-
2
concentration (1,000 U/ml) in vIRF-2-expressing cells. The small
increase in amount of labeled matrix protein at an IFN concentration of
120 U/ml is on the edge of statistical significance, and it could be
due to a variance in cell samples. In contrast, the relative levels of
matrix protein were proportionaly decreased in parental cells treated
with increasing concentrations of IFN-
2. The level of
ectopically expressed FLAG-tagged vIRF-2 protein in transfected cells
is shown in Fig. 4C. These data provide evidence that vIRF-2 can
mediate viral resistance to IFN and rescue the IFN-induced block of
viral mRNA translation.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of vIRF-2 rescues IFN-induced block of viral
protein synthesis. (A) Autoradiography analysis of metabolically
labeled cells transfected with empty (pcDNA3.1) or
FLAG/vIRF-2-expressing (vIRF-2F/pcDNA3.1) vector. Cells were mock
infected ( ) or infected with VSV (+) and 5 h later pulse-labeled
with 35S-labeled amino acid mixture as described in
Materials and Methods. Positions of early VSV proteins are marked on
the right. (B) Relative levels of 29-kDa VSV matrix protein (M) in
pcDNA- or vIRF-2F/pcDNA-transfected cells and its dependency on
increased concentrations of IFN. Amounts of viral proteins in cells
pretreated with increased concentrations of IFN were quantified from
autoradiograms by using a PhosphorImager densitometer and data analysis
software. Error bars represent standard errors from three independent
experiments. (C) Immunoblot detection of FLAG-tagged vIRF-2 in
representative samples of pcDNA- or vIRF-2F/pcDNA-transfected cells by
using anti-FLAG antibody.
|
|
vIRF-2 physically interacts with PKR in vitro.
It has been
shown that the IFN-mediated inhibition of VSV replication occurs at the
level of viral protein synthesis and that PKR plays a major role in
this inhibition (14, 26, 41). We therefore examined the
possibility that the vIRF-2-mediated inhibition of IFN action observed
in previous experiments could be related to modulation of PKR activity.
As PKR is a well-known key regulator of protein synthesis that is very
often targeted by viral factors, we examined whether vIRF-2 directly
interacts with PKR. vIRF-2/GST-containing beads incubated with in
vitro-translated radiolabeled PKR retained a significant amount (50%
of the input) of the input PKR (Fig. 5A,
lane 3), while no PKR was associated with GST-containing beads (lane
2). This high level of binding suggests that the interaction between
vIRF-2 and PKR is very strong. The interaction was specific for vIRF-2,
since PKR did not associate with the same amount of vIRF-1/GST fusion
protein (lane 4). Also, in vitro-translated IRF-3 and luciferase showed
no binding to vIRF-2/GST (Fig. 5B, lanes 3 and 4).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 5.
vIRF-2 binds to PKR in vitro. (A) In vitro-translated,
35S-labeled PKR was incubated with GST-tagged vIRF-2 or
vIRF-1 coupled to glutathione-agarose beads as described in Materials
and Methods. Lane 1 represents 10% of the input volume of in
vitro-translated PKR (p68) used for the binding reactions. (B) Absence
of binding of in vitro-translated, 35S-labeled luciferase
(Lucif) or IRF-3 to GST/vIRF-2 beads. (C) Whole-cell lysates from IFN
(500 U/ml, 16 h)-treated or untreated HeLa cells were incubated with
GST-tagged vIRF-2 or vIRF-1 coupled to glutathione-agarose beads. Bound
proteins were separated by SDS-PAGE and subjected to immunoblot
analysis with anti-PKR antiserum. Lanes 1 and 2 show the presence of
p68 in 10% of the input volume of cell lysates used for the binding
reactions.
|
|
To test the ability of vIRF-2 to bind endogenously expressed PKR,
whole-cell lysates from control cells and cells pretreated
with IFN-

for 16 h were incubated with vIRF-2/GST-containing
beads (Fig.
5B). In agreement with previous data, a high amount
of PKR was bound to
vIRF-2/GST-containing beads (Fig.
5B, lane
3), and binding was about
threefold higher with the cell lysates
from IFN-treated than untreated
cells (lane 4). No binding of
PKR to beads containing GST only or
vIRF-1/GST fusion proteins
was detected (lanes 5 to
8).
vIRF-2 inhibits PKR autophosphorylation and phosphorylation of
histone 2A.
Next, we tested whether the vIRF-2-PKR interaction
has any effect on the intrinsic kinase activity of PKR. To this end, we immunoprecipitated PKR from HeLa cells infected with VSV or stimulated by dsRNA and measured its activity by immunocomplex kinase assay in
vitro. The autophosphorylation level of PKR in unstimulated cells in
the absence of histone 2A is shown in Fig.
6A, lane 1. A control ATF2/GST fusion
protein (2 µg) did not modulate the autophosphorylation of PKR
activity (lane 2), but addition of vIRF-2/GST protein significantly
inhibited PKR phosphorylation (lane 3). As shown in Fig. 6B, PKR was
autophosphorylated in both control and VSV-infected cells and
specifically phosphorylated the purified histone 2A protein (lanes 1 and 2). However, when vIRF-2/GST was included in kinase reaction, we
observed a vIRF-2/GST concentration-dependent decrease in PKR
autophosphorylation as well as in phosphorylation of histone 2A (lanes
3 to 6). Thus, 250 ng of purified vIRF-2/GST protein effectively
inhibited autophosphorylation of PKR and completely inhibited the
phosphorylation of histone 2A (lanes 3-4), while 1 µg of vIRF-2/GST
protein completely inhibited both PKR autophosphorylation and substrate
phosphorylation (lanes 5 to 6).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
vIRF-2 inhibits PKR autophosphorylation and
phosphorylation of histone 2A (H2A) and eIF-2 in vitro. (A) Protein
kinase assay of PKR (p68) immunoprecipitated by rabbit polyclonal
antibody from control HeLa cells in the absence of H2A substrate (lane
1) and in the presence of H2A and ATF2/GST (2 µg) or vIRF-2/GST (400 ng). (B) Phosphorylation of H2A by PKR immunoprecipitated from
mock-infected ( ) or VSV-infected (+) cells. Increased amounts of
purified vIRF-2/GST protein were added to each reaction as indicated.
(C) Phosphorylation of eIF-2 by PKR immunoprecipitated by monoclonal
antibody from control and poly(I-C) (pIC)-stimulated HeLa cells.
Reactions were performed at the absence or presence of 500 ng of of
each recombinant protein indicated at the top. The levels of
phosphorylated PKR and eIF-2 were quantitated and are plotted below
in the corresponding panel. Representative samples of at least three
independent experiments are shown.
|
|
We also examined the effect of vIRF-2 on the ability of PKR to
phosphorylate a PKR-specific substrate, eIF-2

. HeLa cells
or
dsRNA-transfected (for 2 h) HeLa cells were lysed in high-salt
buffer, and PKR was immunoprecipitated with a monoclonal antibody.
Phosphorylation of eIF-2

substrate was analyzed in the presence
and
absence of vIRF-2 (Fig.
6C). Phosphorylation of eIF-2

by
PKR in
unstimulated cells was significantly enhanced in cells
stimulated with
dsRNA (Fig.
6, lanes 1 and 2), while autophosphorylation
of PKR was
only marginally increased after poly (I-C) stimulation
(lanes 1 and 2).
When phosphorylation was done in the presence
of GST/vIRF-2 protein,
both PKR autophosphorylation and eIF-2
phosphorylation were greatly
inhibited in poly(I-C)-treated and
untreated cells (lane 4). In
contrast, addition of the same amounts
of IRF-3/GST or ATF2/GST had no
effect (lanes 5 to 8). The same
degree of inhibition by vIRF-2/GST was
observed with H2A as a
substrate (data not
shown).
It was shown that PKR has to homodimerize in order to be
autophosphorylated and catalytically active (
24). Whether
vIRF-2
prevents the homodimerization and consequently the
autophosphorylation
of PKR, or whether it binds to the catalytic domain
and functions
as pseudosubstrate, remains to be
determined.
 |
DISCUSSION |
We have shown in this study that vIRF-2 is a latency-associated
nuclear antigen of about 20 kDa which can be detected in all HHV-8-positive B-cell lymphoma lines. In contrast, only low levels of
vIRF-1 expression can be detected in unstimulated BCBL-1 cells, and its
expression can be further stimulated by by TPA treatment (29,
31). Since vIRF-2 expression was observed in all pleural effusion lymphomas tested, the potential use of vIRF-2 as a marker of
HHV-8 infection is worth consideration. Two other HHV-8-encoded genes
that are constitutively expressed in BCBL-1 cells are those encoding
v-cyclin and LANA (11, 20, 28, 34). These genes were
identified as class I latent genes that may contribute to HHV-8 induced
malignancy (38). Both of the encoded proteins were shown
to inactivate tumor suppressor proteins. LANA was shown recently to
bind p53, repress its transcription activity, and protect cells against
cell death (12), and v-cyclin was found to bind
retinoblastoma protein (7). We have observed in this study
that vIRF-2 interacts with PKR and inhibits its antiviral activity.
Since PKR plays a critical role in the IFN-mediated antiviral and
anticellular responses, these data indicate that by encoding vIRF-2,
HHV-8 creates a mechanism by which it can directly target the key
effector of the antiviral response PKR.
We have shown previously that vIRF-1, vIRF-2, and vIRF-3 can inhibit
virus-mediated activation of IFN-
and IFN-
promoters by
inhibiting the transactivating activities of cellular IRFs, namely,
IRF-1, IRF-3, and IRF-7 (3, 29; unpublished results), thus
functioning as dominant negative mutants of the cellular IRFs. All of
these vIRFs also inhibited the IFN-mediated stimulation of promoters of
IFN-induced genes (ISG). This inhibition occurs presumably by
interference with the assembly or function of the transcription complex
ISGF3 that contains IRF-9 plus activated STAT-1 and STAT-2 and binds to
the IFN-sensitive response elements present in the promoters of ISGs
(3, 4, 16, 47). The ability to bind PKR and modulate its
activity may be a unique property of vIRF-2, since no interaction
between vIRF-1 and PKR was detected and it is not known whether vIRF-3
can bind PKR. Several other DNA viruses have developed distinct
mechanisms to circumvent PKR action (reviewed in reference
19). Adenovirus and Epstein-Barr virus encode small RNAs
that bind to and inhibit PKR function; reovirus and vaccinia virus
encode proteins that sequester dsRNA. Herpes simplex virus type 1, vaccinia virus, and hepatitis C virus (HCV) also encode proteins that
bind to PKR and prevent its activation. It was shown that HCV-encoded nonstructural protein NS5A binds directly to the catalytic domain of
PKR and that cells overexpressing NS5A are resistant to apoptosis. It
was suggested that the NS5A-mediated disruption of apoptosis might
confer the oncogenic potential to HCV (14). Therefore, a
disruption of PKR activity may inhibit not only its antiviral effect
but also its physiological functions and contribute to virus-induced
pathogenicity. Thus, the effect of vIRF-2 on PKR in combination with
the effects of LANA and v-cyclin may play a role in the maintenance of
malignancy during persistent viral infection.
However, vIRF-2 does not seem to share the pro-oncogenic potential of
vIRF-1 (18, 27). Overexpression of vIRF-1 in NIH 3T3 cells
conferred growth in soft agar, and these cells when transplanted formed
tumors in nude mice. Tumor formation was associated both with
vIRF-1-mediated enhancement of c-myc expression and inhibition of apoptosis (3, 18). In contrast, NIH 3T3
cells expressing vIRF-2 formed neither colonies in soft agar nor tumors in immunocompromised mice (L. Burý
ek and P. M. Pitha,
unpublished results). These results indicate that vIRF-2 alone is not
able to induce the transformed phenotype.
The inhibition or delay of apoptosis of host cells may be an important
requirement for persistent HHV-8 infection, since the virus employs
several alternative mechanisms to prevent death of infected cells. It
encodes a cellular homologue of Bcl-2 (8), an inhibitor of
apoptosis, and employs vIRF-1 to inhibit IRF-1-mediated apoptosis
(4, 47). Both of these genes are expressed during lytic
infection, and their expression may allow the virus to complete a full
replication cycle and delay host cell death. In addition, two latently
expressed genes, encoding LANA and vIRF-2, target functions of
proapoptotic proteins p53 and PKR, respectively, which may be important
for maintenance of a chronic infection. It is therefore likely that the
inhibition of apoptosis in combination with the effects of other
HHV-8-encoded oncogenes is also important for the oncogenicity of
Kaposi's sarcoma.
 |
ACKNOWLEDGMENTS |
We are grateful to J. Jefferson and S. R. Kimball
(Pennsylvania State University College of Medicine, Hershey) for
purified eIF-2
and to A. Hovanessian (Institute Pasteur, Paris,
France) for the monoclonal antibody against PKR. We thank G. N. Barber for the rabbit polyclonal antibody against PKR, M. G. Katze
for the PKR expression plasmid, J. Nicholas for the
phage library, HBL-6 cells, and BCBL-1 cells, and J. Cannon for JSC-1 cells. We also
thank M. Kellum for preparation of VSV.
This study was supported by grants CA76946 (NCI) and AI19737 (NIAID)
from the National Institutes of Health to P.M.P.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Johns
Hopkins University Oncology Center, 1650 Orleans St., Baltimore, MD
21231-1001. Phone: (410) 955-8871. Fax: (410) 955-0840. E-mail:
parowe{at}jhmi.edu.
Present address: Department of Pharmacology of Natural Products and
Clinical Pharmacology, University of Ulm, Ulm, Germany.
 |
REFERENCES |
| 1.
|
Alexander, L.,
L. Denekamp,
A. Knapp,
M. R. Auerbach,
B. Damania, and R. C. Desrosiers.
2000.
The primary sequence of rhesus monkey rhadinovirus isolate 26-95: sequence similarities to Kaposi's sarcoma-associated herpesvirus and rhesus monkey rhadinovirus isolate 17577.
J. Immunol.
74:3388-3398.
|
| 2.
|
Boshoff, C.,
Y. Endo,
P. D. Collins,
Y. Takeuchi,
J. D. Reeves,
V. L. Schweickart,
M. A. Siani,
T. Sasaki,
T. J. Williams,
P. W. Gray,
P. S. Moore,
Y. Chang, and R. A. Weiss.
1997.
Angiogenic and HIV-inhibitory functions of KSHV-encoded chemokines.
Science
278:290-294[Abstract/Free Full Text].
|
| 3.
|
Burý ek, L.,
W. S. Yeow,
B. Lubyova,
M. Kellum,
S. L. Schafer,
Y. Q. Huang, and P. M. Pitha.
1999.
Functional analysis of human herpesvirus 8-encoded viral interferon regulatory factor 1 and its association with cellular interferon regulatory factors and p300.
J. Virol.
73:7334-7342[Abstract/Free Full Text].
|
| 4.
|
Burý ek, L.,
W. S. Yeow, and P. M. Pitha.
1999.
Unique properties of a second human herpesvirus 8-encoded interferon regulatory factor (vIRF-2).
J. Hum. Virol.
2:19-32[Medline].
|
| 5.
|
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191[Abstract/Free Full Text].
|
| 6.
|
Chang, Y.,
E. Cesarman,
M. S. Pessin,
F. Lee,
J. Culpepper,
D. M. Knowles, and P. S. Moore.
1994.
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865-1869[Abstract/Free Full Text].
|
| 7.
|
Chang, Y.,
P. S. Moore,
S. J. Talbot,
C. H. Boshoff,
T. Zarkowska,
K. Godden,
H. Paterson,
R. A. Weiss, and S. Mittnacht.
1996.
Cyclin encoded by KS herpesvirus.
Nature
382:410[CrossRef][Medline].
|
| 8.
|
Cheng, E. H.-Y.,
J. Nicholas,
D. Bellows,
G. S. Hayward,
H.-G. Guo,
M. S. Reitz, and J. M. Hardwick.
1997.
A Bcl-2 homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with Bax or Bak.
Proc. Natl. Acad. Sci. USA
94:690-694[Abstract/Free Full Text].
|
| 9.
|
Chong, K. L.,
L. Feng,
K. Schappert,
E. Meurs,
T. F. Donahue,
J. D. Friesen,
A. G. Hovanessian, and B. R. Williams.
1992.
Human p68 kinase exhibits growth suppression in yeast and homology to the translational regulator GCN2.
EMBO J.
11:1553-1562[Medline].
|
| 10.
|
Clemens, M. J., and A. Elia.
1997.
The double-stranded RNA-dependent protein kinase PKR: structure and function.
J. Interferon Cytokine Res.
17:503-524[Medline].
|
| 11.
|
Davis, M. A.,
M. A. Sturzl,
C. Blasig,
A. Schreier,
H. G. Guo,
M. Reitz,
S. R. Opalenik, and P. J. Browning.
1997.
Expression of human herpesvirus 8-encoded cyclin D in Kaposi's sarcoma spindle cells.
J. Natl. Cancer Inst.
89:1868-1874[Abstract/Free Full Text].
|
| 12.
|
Friborg, J., Jr.,
W. Kong,
M. O. Hottiger, and G. J. Nabel.
1999.
p53 inhibition by the LANA protein of KSHV protects against cell death.
Nature
402:889-894[Medline].
|
| 13.
|
Galabru, J., and A. Hovanessian.
1987.
Autophosphorylation of the protein kinase dependent on double-stranded RNA.
J. Biol. Chem.
262:15538-15544[Abstract/Free Full Text].
|
| 14.
|
Gale, M., Jr.,
B. Kwieciszewski,
M. Dossett,
H. Nakao, and M. G. Katze.
1999.
Antiapoptotic and oncogenic potentials of hepatitis C virus are linked to interferon resistance by viral repression of the PKR protein kinase.
J. Virol.
73:6506-6516[Abstract/Free Full Text].
|
| 15.
|
Ganem, D.
1997.
KSHV and Kaposi's sarcoma: the end of the beginning?
Cell
91:157-160[CrossRef][Medline].
|
| 16.
|
Gao, S. J.,
C. Boshoff,
S. Jayachandra,
R. A. Weiss,
Y. Chang, and P. S. Moore.
1997.
KSHV ORF K9 (vIRF) is an oncogene which inhibits the interferon signaling pathway.
Oncogene
85:1979-1985.
|
| 17.
|
Hovanessian, A. G.
1989.
The double stranded RNA-activated protein kinase induced by interferon: dsRNA-PK.
J. Interferon Res.
9:641-647[Medline].
|
| 18.
|
Jayachandra, S.,
K. G. Low,
A. E. Thlick,
J. Yu,
P. D. Ling,
Y. Chang, and P. S. Moore.
1999.
Three unrelated viral transforming proteins (vIRF, EBNA2, and E1A) induce the MYC oncogene through the interferon-responsive PRF element by using different transcription coadaptors.
Proc. Natl. Acad. Sci. USA
96:11566-11571[Abstract/Free Full Text].
|
| 19.
|
Kalvakolanu, D. V.
1999.
Virus interception of cytokine-regulated pathways.
Trends Microbiol.
7:166-171[CrossRef][Medline].
|
| 20.
|
Kedes, D. H.,
M. Lagunoff,
R. Renne, and D. Ganem.
1997.
Identification of the gene encoding the major latency-associated nuclear antigen of the Kaposi's sarcoma-associated herpesvirus.
J. Clin. Investig.
100:2606-2610[Medline].
|
| 21.
|
Koromilas, A. E.,
S. Roy,
G. N. Barber,
M. G. Katze, and N. Sonenberg.
1992.
Malignant transformation by a mutant of the IFN-inducible dsRNA-dependent protein kinase.
Science
257:1685-1689[Abstract/Free Full Text].
|
| 22.
|
Kostura, M., and M. B. Mathews.
1989.
Purification and activation of the double-stranded RNA-dependent eIF-2 kinase DAI.
Mol. Cell. Biol.
9:1576-1586[Abstract/Free Full Text].
|
| 23.
|
Kumar, A.,
J. Haque,
J. Lacoste,
J. Hiscott, and B. R. Williams.
1994.
Double-stranded RNA-dependent protein kinase activates transcription factor NF-kappa B by phosphorylating I kappa B.
Proc. Natl. Acad. Sci. USA
91:6288-6292[Abstract/Free Full Text].
|
| 24.
|
Langland, J. O., and B. L. Jacobs.
1992.
Cytosolic double-stranded RNA-dependent protein kinase is likely a dimer of partially phosphorylated Mr = 66,000 subunits.
J. Biol. Chem.
267:10729-10736[Abstract/Free Full Text].
|
| 25.
|
Laurent, A. G.,
B. Krust,
J. Galabru,
J. Svab, and A. G. Hovanessian.
1985.
Monoclonal antibodies to an interferon-induced Mr 68,000 protein and their use for the detection of double-stranded RNA-dependent protein kinase in human cells.
Proc. Natl. Acad. Sci. USA
82:4341-4345[Abstract/Free Full Text].
|
| 26.
|
Lee, S. B.,
R. Bablanian, and M. Esteban.
1996.
Regulated expression of the interferon-induced protein kinase p68 (PKR) by vaccinia virus recombinants inhibits the replication of vesicular stomatitis virus but not that of poliovirus.
J. Interferon Cytokine Res.
16:1073-1078[Medline].
|
| 27.
|
Li, M.,
H. Lee,
J. Guo,
F. Neipel,
B. Fleckenstein,
K. Ozato, and J. U. Jung.
1998.
Kaposi's sarcoma-associated herpesvirus viral interferon regulatory factor.
J. Virol.
72:5433-5440[Abstract/Free Full Text].
|
| 28.
|
Li, M.,
H. Lee,
D. W. Yoon,
J. C. Albrecht,
B. Fleckenstein,
F. Neipel, and J. U. Jung.
1997.
Kaposi's sarcoma-associated herpesvirus encodes a functional cyclin.
J. Virol.
71:1984-1991[Abstract].
|
| 29.
|
Lubyova, B., and P. M. Pitha.
2000.
Characterization of a novel human herpesvirus 8-encoded protein, vIRF-3, that shows homology to viral and cellular interferon regulatory factors.
J. Virol.
74:8194-8201[Abstract/Free Full Text].
|
| 30.
|
Meurs, E. F.,
J. Galabru,
G. N. Barber,
M. G. Katze, and A. G. Hovanessian.
1993.
Tumor suppressor function of the interferon-induced double-stranded RNA-activated protein kinase.
Proc. Natl. Acad. Sci. USA
90:232-236[Abstract/Free Full Text].
|
| 31.
|
Moore, P. S.,
C. Boshoff,
R. A. Weiss, and Y. Chang.
1996.
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739-1744[Abstract/Free Full Text].
|
| 32.
|
Patel, R. C.,
P. Stanton,
N. M. McMillan,
B. R. Williams, and G. C. Sen.
1995.
The interferon-inducible double-stranded RNA-activated protein kinase self-associates in vitro and in vivo.
Proc. Natl. Acad. Sci. USA
92:8283-8287[Abstract/Free Full Text].
|
| 33.
|
Pitha, P. M.,
L. Burysek, and S. Schafer.
1997.
Critical role of Kaposi sarcoma virus (HHV8)-encoded IRFs in virus replication and pathogenicity.
J. Interferon Cytokine Res.
17(Suppl. 2):S37.
|
| 34.
|
Rainbow, L.,
G. M. Platt,
G. R. Simpson,
R. Sarid,
S. J. Gao,
H. Stoiber,
C. S. Herrington,
P. S. Moore, and T. F. Schulz.
1997.
The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen.
J. Virol.
71:5915-5921[Abstract].
|
| 35.
|
Rice, A. P.,
M. Kostura, and M. B. Mathews.
1989.
Identification of a 90-kDa polypeptide which associates with adenovirus VA RNAI and is phosphorylated by the double-stranded RNA-dependent protein kinase.
J. Biol. Chem.
264:20632-20637[Abstract/Free Full Text].
|
| 36.
|
Russo, J. J.,
R. A. Bohenzky,
M.-C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 37.
|
Samuel, C. E.
1993.
The eIF-2 alpha protein kinases, regulators of translation in eukaryotes from yeasts to humans.
J. Biol. Chem.
268:7603-7606[Free Full Text].
|
| 38.
|
Sarid, R.,
O. Flore,
R. A. Bohenzky,
Y. Chang, and P. S. Moore.
1998.
Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1).
J. Virol.
72:1005-1012[Abstract/Free Full Text].
|
| 39.
|
Schafer, S. L.,
R. Lin,
P. A. Moore,
J. Hiscott, and P. M. Pitha.
1998.
Regulation of type I interferon gene expression by interferon regulatory factor-3.
J. Biol. Chem.
273:2714-2720[Abstract/Free Full Text].
|
| 40.
|
Sen, G. C., and R. M. Ransohoff.
1993.
Interferon-induced antiviral actions and their regulation.
Adv. Virus Res.
42:57-102[Medline].
|
| 41.
|
Shors, S. T.,
E. Beattie,
E. Paoletti,
J. Tartaglia, and B. L. Jacobs.
1998.
Role of the vaccinia virus E3L and K3L gene products in rescue of VSV and EMCV from the effects of IFN-alpha.
J. Interferon Cytokine Res.
18:721-729[Medline].
|
| 42.
|
Soulier, J.,
L. Grollet,
E. Oksenhendler,
P. Cacoub,
D. Cazals-Hatem,
P. Babinet,
M. F. d'Agay,
J. P. Clauvel,
M. Raphael,
L. Degos, et al.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276-1280[Abstract/Free Full Text].
|
| 43.
|
Tan, S. L., and M. G. Katze.
1999.
The emerging role of the interferon-induced PKR protein kinase as an apoptotic effector: a new face of death?
J. Interferon Cytokine Res.
19:543-554[CrossRef][Medline].
|
| 44.
|
Thomis, D. C., and C. E. Samuel.
1992.
Mechanism of interferon action: autoregulation of RNA-dependent P1/eIF-2 alpha protein kinase (PKR) expression in transfected mammalian cells.
Proc. Natl. Acad. Sci. USA
89:10837-10841[Abstract/Free Full Text].
|
| 45.
|
Williams, B. R.
1999.
PKR; a sentinel kinase for cellular stress.
Oncogene
18:6112-6120[CrossRef][Medline].
|
| 46.
|
Williams, B. R.
1997.
Role of the double-stranded RNA-activated protein kinase (PKR) in cell regulation.
Biochem. Soc. Trans.
25:509-513[Medline].
|
| 47.
|
Zimring, J. C.,
S. Goodbourn, and M. K. Offermann.
1998.
Human herpesvirus 8 encodes an interferon regulatory factor (IRF) homolog that represses IRF-1-mediated transcription.
J. Virol.
72:701-707[Abstract/Free Full Text].
|
Journal of Virology, March 2001, p. 2345-2352, Vol. 75, No. 5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.5.2345-2352.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Areste, C., Mutocheluh, M., Blackbourn, D. J.
(2009). Identification of Caspase-mediated Decay of Interferon Regulatory Factor-3, Exploited by a Kaposi Sarcoma-associated Herpesvirus Immunoregulatory Protein. J. Biol. Chem.
284: 23272-23285
[Abstract]
[Full Text]
-
Gould, F., Harrison, S. M., Hewitt, E. W., Whitehouse, A.
(2009). Kaposi's Sarcoma-Associated Herpesvirus RTA Promotes Degradation of the Hey1 Repressor Protein through the Ubiquitin Proteasome Pathway. J. Virol.
83: 6727-6738
[Abstract]
[Full Text]
-
Lagos, D., Trotter, M. W. B., Vart, R. J., Wang, H.-W., Matthews, N. C., Hansen, A., Flore, O., Gotch, F., Boshoff, C.
(2007). Kaposi sarcoma herpesvirus-encoded vFLIP and vIRF1 regulate antigen presentation in lymphatic endothelial cells. Blood
109: 1550-1558
[Abstract]
[Full Text]
-
Garcia, M. A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M.
(2006). Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol. Mol. Biol. Rev.
70: 1032-1060
[Abstract]
[Full Text]
-
Rezaee, S. A. R., Cunningham, C., Davison, A. J., Blackbourn, D. J.
(2006). Kaposi's sarcoma-associated herpesvirus immune modulation: an overview. J. Gen. Virol.
87: 1781-1804
[Abstract]
[Full Text]
-
Xu, D., Brumm, K., Zhang, L.
(2006). The Latent Membrane Protein 1 of Epstein-Barr Virus (EBV) Primes EBV Latency Cells for Type I Interferon Production. J. Biol. Chem.
281: 9163-9169
[Abstract]
[Full Text]
-
Fuld, S., Cunningham, C., Klucher, K., Davison, A. J., Blackbourn, D. J.
(2006). Inhibition of Interferon Signaling by the Kaposi's Sarcoma-Associated Herpesvirus Full-Length Viral Interferon Regulatory Factor 2 Protein. J. Virol.
80: 3092-3097
[Abstract]
[Full Text]
-
Cassady, K. A.
(2005). Human Cytomegalovirus TRS1 and IRS1 Gene Products Block the Double-Stranded-RNA-Activated Host Protein Shutoff Response Induced by Herpes Simplex Virus Type 1 Infection. J. Virol.
79: 8707-8715
[Abstract]
[Full Text]
-
Lussier, M. P., Cayouette, S., Lepage, P. K., Bernier, C. L., Francoeur, N., St-Hilaire, M., Pinard, M., Boulay, G.
(2005). MxA, a Member of the Dynamin Superfamily, Interacts with the Ankyrin-like Repeat Domain of TRPC. J. Biol. Chem.
280: 19393-19400
[Abstract]
[Full Text]
-
Seo, T., Park, J., Choe, J.
(2005). Kaposi's Sarcoma-Associated Herpesvirus Viral IFN Regulatory Factor 1 Inhibits Transforming Growth Factor-{beta} Signaling. Cancer Res.
65: 1738-1747
[Abstract]
[Full Text]
-
Lu, M., Suen, J., Frias, C., Pfeiffer, R., Tsai, M.-H., Chuang, E., Zeichner, S. L.
(2004). Dissection of the Kaposi's Sarcoma-Associated Herpesvirus Gene Expression Program by Using the Viral DNA Replication Inhibitor Cidofovir. J. Virol.
78: 13637-13652
[Abstract]
[Full Text]
-
Stedman, W., Deng, Z., Lu, F., Lieberman, P. M.
(2004). ORC, MCM, and Histone Hyperacetylation at the Kaposi's Sarcoma-Associated Herpesvirus Latent Replication Origin. J. Virol.
78: 12566-12575
[Abstract]
[Full Text]
-
Chang, P.-J., Miller, G.
(2004). Autoregulation of DNA Binding and Protein Stability of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein. J. Virol.
78: 10657-10673
[Abstract]
[Full Text]
-
Pozharskaya, V. P., Weakland, L. L., Zimring, J. C., Krug, L. T., Unger, E. R., Neisch, A., Joshi, H., Inoue, N., Offermann, M. K.
(2004). Short Duration of Elevated vIRF-1 Expression during Lytic Replication of Human Herpesvirus 8 Limits Its Ability To Block Antiviral Responses Induced by Alpha Interferon in BCBL-1 Cells. J. Virol.
78: 6621-6635
[Abstract]
[Full Text]
-
Krishnan, H. H., Naranatt, P. P., Smith, M. S., Zeng, L., Bloomer, C., Chandran, B.
(2004). Concurrent Expression of Latent and a Limited Number of Lytic Genes with Immune Modulation and Antiapoptotic Function by Kaposi's Sarcoma-Associated Herpesvirus Early during Infection of Primary Endothelial and Fibroblast Cells and Subsequent Decline of Lytic Gene Expression. J. Virol.
78: 3601-3620
[Abstract]
[Full Text]
-
Lubyova, B., Kellum, M. J., Frisancho, A. J., Pitha, P. M.
(2004). Kaposi's Sarcoma-associated Herpesvirus-encoded vIRF-3 Stimulates the Transcriptional Activity of Cellular IRF-3 and IRF-7. J. Biol. Chem.
279: 7643-7654
[Abstract]
[Full Text]
-
Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., Lieberman, P. M.
(2003). Chromatin Remodeling of the Kaposi's Sarcoma-Associated Herpesvirus ORF50 Promoter Correlates with Reactivation from Latency. J. Virol.
77: 11425-11435
[Abstract]
[Full Text]
-
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract]
[Full Text]
-
Esteban, M., Garcia, M. A., Domingo-Gil, E., Arroyo, J., Nombela, C., Rivas, C.
(2003). The latency protein LANA2 from Kaposi's sarcoma-associated herpesvirus inhibits apoptosis induced by dsRNA-activated protein kinase but not RNase L activation. J. Gen. Virol.
84: 1463-1470
[Abstract]
[Full Text]
-
Cunningham, C., Barnard, S., Blackbourn, D. J., Davison, A. J.
(2003). Transcription mapping of human herpesvirus 8 genes encoding viral interferon regulatory factors. J. Gen. Virol.
84: 1471-1483
[Abstract]
[Full Text]
-
Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S. L., Jung, J. U.
(2003). Global Changes in Kaposi's Sarcoma-Associated Virus Gene Expression Patterns following Expression of a Tetracycline-Inducible Rta Transactivator. J. Virol.
77: 4205-4220
[Abstract]
[Full Text]
-
Poppers, J., Mulvey, M., Perez, C., Khoo, D., Mohr, I.
(2002). Identification of a Lytic-Cycle Epstein-Barr Virus Gene Product That Can Regulate PKR Activation. J. Virol.
77: 228-236
[Abstract]
[Full Text]
-
Li, H., Komatsu, T., Dezube, B. J., Kaye, K. M.
(2002). The Kaposi's Sarcoma-Associated Herpesvirus K12 Transcript from a Primary Effusion Lymphoma Contains Complex Repeat Elements, Is Spliced, and Initiates from a Novel Promoter. J. Virol.
76: 11880-11888
[Abstract]
[Full Text]
-
Burysek, L., Syrovets, T., Simmet, T.
(2002). The Serine Protease Plasmin Triggers Expression of MCP-1 and CD40 in Human Primary Monocytes via Activation of p38 MAPK and Janus Kinase (JAK)/STAT Signaling Pathways. J. Biol. Chem.
277: 33509-33517
[Abstract]
[Full Text]
-
Seo, T., Lee, D., Shim, Y. S., Angell, J. E., Chidambaram, N. V., Kalvakolanu, D. V., Choe, J.
(2002). Viral Interferon Regulatory Factor 1 of Kaposi's Sarcoma-Associated Herpesvirus Interacts with a Cell Death Regulator, GRIM19, and Inhibits Interferon/Retinoic Acid-Induced Cell Death. J. Virol.
76: 8797-8807
[Abstract]
[Full Text]