Previous Article | Next Article 
Journal of Virology, March 2001, p. 2288-2300, Vol. 75, No. 5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.5.2288-2300.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Use of Helper-Free Replication-Defective Simian Immunodeficiency
Virus-Based Vectors To Study Macrophage and T Tropism: Evidence for
Distinct Levels of Restriction in Primary Macrophages and a
T-Cell Line
Steve S.
Kim,1
Xue Juan
You,1
Mary-Elizabeth
Harmon,2
Julie
Overbaugh,2 and
Hung
Fan1,*
Department of Molecular Biology and
Biochemistry, University of California at Irvine, Irvine, California
92697,1 and Fred Hutchinson Cancer
Research Center, Seattle, Washington 981092
Received 24 August 2000/Accepted 7 December 2000
 |
ABSTRACT |
Cell tropism of human and simian immunodeficiency viruses (HIV and
SIV, respectively) is governed in part by interactions between the
viral envelope protein and the cellular receptors. However, there is
evidence that envelope-host cell interactions also affect postentry
steps in viral replication. We used a helper-free replication-defective
SIV macaque (SIVmac)-based retroviral vector carrying the
enhanced jellyfish green fluorescent protein inserted into the
nef region (V1EGFP) to examine SIV tropism in a single cycle of infection. Vector stocks containing envelope proteins from
three different SIVmac clones, namely, SIVmac239 (T-lymphocyte tropic
[T-tropic]), SIVmac316 (macrophage tropic [M-tropic]), and
SIVmac1A11 (dualtropic), were tested. SIVmac239 replicates efficiently in many human T-cell lines, but it does not efficiently infect primary rhesus macrophages. Conversely, SIVmac316 efficiently infects primary macrophages, but it does not replicate in Molt4-Clone8 (M4C8) T cells. SIVmac1A11 replicates efficiently in both cell types.
When primary macrophages were infected with V1EGFP pseudotyped by
SIVmac316 or SIVmac1A11 envelopes, the infection was substantially (ca.
200- to 300-fold) more efficient than for the SIVmac239 pseudotype. Thus, in primary macrophages, a major component of M versus T tropism
involves relatively early events in the infection cycle. Quantitative
PCR studies indicated that synthesis and transport of vector DNA into
the nucleus were similar for macrophages infected with the clone 239 and 316 pseudotypes, suggesting that the restriction for SIVmac239
infection is after reverse transcription and nuclear import of viral
DNA. When the same vector pseudotypes were used to infect M4C8 cells,
they all showed approximately equivalent infectivities, even though
replication-competent SIVmac316 does not continue to replicate in these
cells. Therefore, in M4C8 cells, restriction involves a late step in
the infection cycle (after proviral integration and expression). Thus,
depending on the cell type infected, envelope-dependent cell
interactions that govern SIV M and T tropism may involve different
steps in infection.
 |
INTRODUCTION |
Simian immunodeficiency viruses
(SIVs) are important model systems for studying human immunodeficiency
virus (HIV), the etiologic agent of AIDS. The infection of rhesus
macaques with SIV macaque (SIVmac) results in a clinical
immunodeficiency that closely mimics AIDS in humans. As for HIV, the
primary receptor for SIV on cells is the CD4 molecule; this
molecule is present on the surface of T-helper lymphocytes,
macrophages, and dendritic cells. During the course of infection by
HIV, there is a shift in biological properties and cell tropism of the
virus (4, 17, 31). In initially infected people, the
predominant virus replicates well in macrophages and is considered
macrophage tropic (M-tropic); as individuals progress to clinical AIDS,
virus that replicates preferentially in T lymphocytes (T-tropic virus)
appears. For HIV, the determinants of cell tropism have been localized
to the V3 loop of envelope SU (gp120) protein (14, 15, 36, 46, 47). More recently, HIV cell tropism has been associated with differential use of cellular coreceptors. Typically, viruses that use
CCR5 coreceptor in engineered cells are M-tropic, whereas viruses that
use CXCR4 can infect T-cell lines and are T-tropic (replicating poorly
in macrophages) (1, 2, 7, 9, 16, 18, 22, 25). Macrophages
(and dendritic cells) express CCR5 on the cell surface, while activated
T lymphocytes express high levels of CXCR4 (8, 13, 21,
28).
In SIV-infected animals, a similar shift from M tropism to T tropism
has also been observed (5, 20, 33, 40, 45), and
closely related clones of SIV differ in their cell tropism. Clones
SIVmac239 (T-tropic) and SIVmac1A11 (dualtropic) have 98% sequence homology, but only SIVmac1A11 can replicate in
macrophages (5, 30). Likewise, SIVmac316 (M-tropic), which
was isolated from alveolar macrophages from a monkey inoculated with
SIVmac239, replicates more than 100-fold better than SIVmac239 in
primary alveolar macrophage cultures (33). The primary
determinants of M tropism for SIVmac map to specific regions of the
envelope protein (3, 5, 33, 37). However, in the case of
SIVs, cell tropism cannot be attributed to the same coreceptor
preferences observed for HIV. In particular, both M-tropic and T-tropic
SIVs efficiently utilize CCR5, while neither class of viruses
recognizes CXCR4 (23, 24). While other alternate
coreceptors have been identified for SIV (e.g., GPR15 [BOB], STRL-33
[Bonzo], CCR8, ChemR23, and GPR-1 [10, 19, 26, 38,
42]), the cellular distribution of these coreceptors has not
provided an explanation for SIV cell tropism.
In light of the fact that SIV cell tropism does not appear to be
governed by coreceptor preference, the mechanisms by which M-tropic and
T-tropic SIVs infect or are restricted in different cell types have
been of considerable interest. Mori et al. (32) addressed
this by comparing infection of primary alveolar macrophages by the
T-tropic clone SIVmac239 and by SIVmac239/316, an M-tropic recombinant
clone of SIVmac239 containing the envelope from M-tropic SIVmac316.
They found that these two viruses generated quite similar (within
fivefold) levels of viral DNA when infected into the macrophages, suggesting that the major restriction for replication of SIVmac239 in
macrophages was at a step after reverse transcription. Similar conclusions were reached by other investigators (27, 49).
One of the limitations of the previous studies of SIV cell tropism was
the fact that replication-competent viruses were used. This made it
somewhat difficult to distinguish between different steps in the
infection cycle, since infection by SIV in vitro can be somewhat
asynchronous and multiple (undetermined) rounds of infection may take
place during the course of an experiment. We therefore have examined
the issue of SIV cell tropism by using replication-defective,
helper-free SIVmac-based vectors pseudotyped with envelope
proteins from SIVs with different cell tropisms. These experiments
limited infection to a single cycle, because these SIV-based vectors
are replication defective. Moreover, a vector expressing a readily
detected reporter gene made it possible to obtain sensitive and precise
quantification of vector infection and restriction. As described in the
experiments reported here, this approach led to evidence for two
distinct modes of envelope-dependent restriction of SIV replication in
primary macrophages and T-lymphocyte lines.
 |
MATERIALS AND METHODS |
Vector plasmids.
The plasmid pV1EGFP carries a
SIVmac239-based vector expressing the enhanced jellyfish green
fluorescent protein (EGFP) in place of the nef gene. Its
construction has been described elsewhere (26a). The vector carried by
pV1EGFP is replication defective due to two stop codons at the
beginning of gag and deletions in vif and
env. The organization of V1EGFP is shown in Fig.
1.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
SIV vector and packaging plasmids. Schematic diagrams of
the SIVmac239-based vector V1EGFP (A), the packaging plasmid
pUpSVO (B), and the envelope expression plasmids (C) are shown.
(A) V1EGFP is replication defective due to a deletion in
env and two consecutive stop codons at the beginning of
gag. (B) pUpSVO contains a deletion in
env and the packaging sequence ( ) and contains a
heterologous murine leukemia virus 3' long terminal repeat
(LTR). (C) The envelope expression plasmids all contain the
cytomegalovirus immediate-early promoter driving the expression of
env, rev, and nef;
different plasmids contain env sequences from different
SIVmac strains.
|
|
The gag-pol helper plasmid pUpSVO
was also described
previously (26a). This plasmid carries the gag and
pol genes of SIVmac239; the putative packaging sequence
(
) was deleted, and a simian virus 40 (SV40) origin of replication
was added for amplification in T antigen-containing cells. The
env expression plasmid pCDSenv, which expresses SIVmac239
env (as well as tat and rev), was also described previously (44). The sequences downstream of
SphI at position 6450 of pCDSenv were replaced with the
corresponding sequences from SIVmac1A11 (30), kindly
provided by Marta Marthas, to produce p1A11env. p316env was produced by
replacing the 3' sequences downstream of SphI (position
6450) of pCDSenv with the corresponding sequences from SIVmac316
(33), kindly provided by R. C. Desrosiers. Each
envelope expression plasmid was sequenced using an ABI prism automated
sequencer and verified with corresponding sequences in GenBank.
Cell culture.
293T cells (a human embryonic kidney cell line
that expresses the adenovirus early proteins and SV40 large T antigen)
were obtained from the American Type Tissue Culture Collection
(Rockville, Md.). These cells were maintained in Dulbecco's modified
Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U of penicillin/ml, 100 µg of streptomycin/ml, and 300 µg of
L-glutamine/ml. CMMT-CD4 cells (a rhesus macaque mammary
tumor cell line that expresses human CD4 [11]) were
maintained in DMEM supplemented with 10% FBS, 100 U of penicillin/ml,
100 µg of streptomycin/ml, 300 µg of glutamine/ml, and 0.2 mg of
gentamicin (G418, at an active concentration of 700 µg/mg)/ml.
Molt4-Clone8 cells (a human T-cell line; AIDS Research and Reference
Reagent Program) were maintained in RPMI complete (10% FBS, 100 U of
penicillin/ml, 100 µg of streptomycin/ml, and 300 µg of
L-glutamine/ml). Macrophage cultures were established from
rhesus macaque (Macaca mulatta) whole blood. Briefly, 20 ml
of heparinized rhesus macaque whole blood was harvested by
centrifugation at 12,000 × g for 10 min, resuspended
in 9.0 ml of RPMI complete without serum, and then separated by
centrifugation over 8 ml of lymphocyte separation medium
(Cappel, Aurora, Ohio). Cells were washed twice in 50 ml of RPMI
complete without serum by low-speed centrifugation, resuspended in 20.5 ml of macrophage adherence medium (20% FBS-10% human AB serum in
RPMI complete), and then plated onto 12-well plates and maintained in
culture with macrophage growth medium (RPMI complete supplemented with
20% FBS, 200 U of human recombinant granulocyte-macrophage colony-stimulating factor [Genzyme, Cambridge, Mass.]). Cells were
washed rigorously three times to remove nonadherent cells with RPMI
complete without serum at 48 and 72 h. Cells were refed with
macrophage growth medium every 3 days thereafter.
Vector production.
Vector stocks were made by transient
transfections of 293T cells. Briefly, 2 × 105 293T cells were plated 2 days prior to
transfection in 6-cm-diameter dishes. The plates were refed 2 h
prior to transfection with 5 ml of fresh DMEM with 10% FBS.
Transfections were performed by the calcium phosphate method using the
Calphos Maximizer transfection kit (Clontech, Palo Alto, Calif.).
Fifteen micrograms of plasmid DNA (5 µg each of V1EGFPSVO,
pUpSVO
, and an envelope expression plasmid) was used, and
transfection reaction mixtures were incubated at 37°C under 5%
CO2. Plates were refed with a half volume (2.5 ml) of medium at 12 h posttransfection and incubated at 32°C
under 5% CO2. At 24 h after refeeding,
vector supernatants were collected, filter clarified through a
0.45-µm-pore-size filter, and stored frozen at
140°C.
Titration of vector stocks.
A total of 5 × 104 CMMT-CD4 cells were plated in 2 ml of medium
in 12-well plates 24 h prior to infection. Infections were carried
out by aspirating the wells and then adding 295 µl of fresh medium,
15 µg of DEAE-dextran/ml, and 5 µl of diluted vector stock.
After 2 h, 2 ml of fresh medium was added to each well. Four days
later, the cells were microscopically scanned for EGFP expression using
a fluorescent microscope with a fluorescein isothiocyanate filter
designed for optimal EGFP detection (Chroma Technology, Brattleboro,
Vt.). The number of green fluorescent cells reached a plateau at 4 days
postinfection. Titers of each vector stock (green-fluorescence units [GFU] per milliliter) were
calculated by multiplying the total number of EGFP-positive colonies by
200 (to correct for volume of supernatant used) and then multiplying by
the dilution factor. In some cases, vector titrations were carried out
by flow cytometry (see below).
Characterization of vectors.
Reverse transcriptase
inhibition assays were performed by preincubating CMMT-CD4 cells,
Molt4-Clone8 cells, and macrophages with 25 µM
9-(2-phosphonylmethoxypropyl) adenine (PMPA; Gilead Sciences, Hayward,
Calif.) (48) 1 h prior to infection. Fifty microliters of a 1.3 × 106-GFU/ml
concentration of the SIVmac239 (pCDSenv) pseudotype, a 3.2 × 105-GFU/ml concentration of the SIVmac1A11
pseudotype, or a 1.4 × 106-GFU/ml
concentration of the SIVmac316 pseudotype was used for infection
of these cells. Ninety-six hours after initiation of infection, the
cells were screened by fluorescent microscopy or flow cytometry (see
below) for EGFP expression. Vector stocks were tested for
replication-competent recombinants by long-term infection of CEMX174
cells. Briefly, 106 CEMX174 cells in 500 µl of
medium (RPMI 1640 plus 10% FBS) were infected with 500 µl of
serially diluted and undiluted vector stocks in triplicate. Twice
weekly for 4 weeks, a half volume of medium (500 µl) was removed and
the cultures were refed with an equal volume of fresh medium. The
medium removed from the cells was clarified by low-speed centrifugation
and then precipitated with polyethylene glycol. Virion pellets were
resuspended, and the level of reverse transcriptase activity was
assayed using a standard reverse transcriptase assay as previously
described (41).
Vector infections.
In infections of rhesus monocyte-derived
macrophages, 5 × 104 macrophages were refed
with 500 µl of macrophage growth medium and infected with 500 µl of
viral stocks diluted so that infection would be in the linear range
(1.3 × 105 GFU of pCDSenv pseudotype/ml,
3.2 × 103 GFU of p1A11env pseudotype/ml, or
3.4 × 103 GFU of p316env pseudotype/ml) and
incubated at 37°C under 5% CO2 for 48 h.
The macrophages were refed with 2 ml of fresh macrophage growth medium,
and EGFP expression was evaluated 96 h after the initiation of
infection. In infection of Molt4-Clone8 cells,
106 cells in 200 µl of RPMI complete were
plated into six-well plates 2 h prior to the start of
infection. Each envelope pseudotype was added to the cells at
105 GFU in a final volume of 500 µl and then
incubated for 24 h in 37°C under 5% CO2.
Two milliliters of fresh RPMI complete was added 24 h after
initiation of the infections, and 1/20 volume of cells was evaluated
for EGFP expression at 96 h by fluorescent microscopy.
Flow cytometry.
For flow cytometry, cultures of infected
primary macrophages, Molt4-Clone8 cells, or CMMT-CD4 cells were
aspirated and washed one time with phosphate-buffered saline (PBS). The
cells were then removed from the culture dish by trypsinization (0.05%
trypsin-1 mM EDTA-0.5 ml per 10-cm-diameter dish) for 2 to 5 min at
37°C. One milliliter of PBS was then added, and the cell suspension was harvested by low-speed centrifugation. The cell pellet was suspended in 0.5 ml of PBS, and 0.5 ml of 4% paraformaldehyde in PBS
was added. After 30 min at room temperature, cell suspensions were
analyzed by flow cytometry with a Becton-Dickinson FACScalibur in the
analytical mode. EGFP-positive cells were detected in the green
fluorescence channel. Events of 5,000 to 10,000 cells were recorded.
Flow cytometry was also used to measure titers of SIV vectors. In this
case, CMMT-CD4 cells were infected with different dilutions of vector
stocks, and then 10,000 cells from the infected cultures were analyzed
for EGFP-positive cells. The numbers of total EGFP-positive cells in
the cultures were then calculated from the total number of cells in the
cultures and the percentage of EGFP-positive cells. In addition, the
total numbers of EGFP-positive cells were divided by a factor of 2.8, to correct for the average number of cell divisions between the start
of infection and time of assay. This factor was determined by comparing
the numbers of EGFP-positive colonies determined by fluorescence
microscopy on parallel cultures with those analyzed by flow cytometry.
PMPA timed infections.
For infection of macrophages with
timed addition of PMPA, 5 × 104 macrophages
were plated onto 12-well plates and infected with the different vector
pseudotypes as described above. A 100 µM concentration of PMPA was
added to one well at 0, 1, 3, 6, 12, 18, and 24 h. In one well,
infection was performed without the addition of PMPA. At the 36-h time
point, all wells were fed with 2 ml of macrophage growth medium
containing 100 µM PMPA. EGFP-positive macrophages were counted 4 days
postinfection by fluorescent microscopy or flow cytometry, and the
percentage of infected (EGFP-positive) cells relative to the number in
infected macrophages in the absence of PMPA was calculated. For
timed addition of PMPA in Molt4-Clone8 cells, 106
Molt4-Clone8 cells were plated into six-well plates 2 h prior to
the start of infection. Each envelope pseudotype was added to the cells
at 105 GFU in a final volume of 500 µl. A 100 µM concentration of PMPA was added to wells at
1, 0, 3, 9, 15, 24, and 30 h. At the 36-h time point, all wells were refed with 2 ml
of RPMI complete containing 100 µM PMPA. The percentage of
EGFP-positive cells, relative to the number of EGFP-positive cells in
infected Molt4-Clone8 cells in the absence of PMPA, was calculated.
Quantitative real-time PCR for detection of newly synthesized SIV
DNA.
Prior to infections, V1EGFP vector stocks pseudotyped with
either SIVmac239 or SIVmac316 envelopes were digested with RNase-free pancreatic DNase (250 µg/ml in PBS and 10 mM
MgCl2; 30 min at 37°C). Infections were carried
out on 10-cm-diameter tissue culture dishes containing 2 × 106 peripheral blood mononuclear cell
(PBMC)-derived macrophages. One milliliter of diluted vector stock
(5 × 104 GFU/ml on CMMT-CD4 cells) was
adsorbed to the macrophage cultures (multiplicity of infection = 0.025) for 2 h; the virus was then aspirated, and the cells were
washed once with PBS and then refed with 10 ml of macrophage growth
medium. As a control, macrophages were pretreated for 75 min with 200 µg of PMPA/ml, and the infections were carried out in the presence of
PMPA as well. Twenty-four hours after infection, the macrophages were
harvested by trypsinization (0.05% trypsin-1 mM EDTA) and washed once
with PBS. The cells were then suspended in hypotonic buffer (0.01 M
NaCl, 0.01 M MgCl2 [pH 7.4]) for 10 min on ice
and then lysed by the addition of NP-40 to 1% followed by vortex
mixing for 15 s. Nuclei were recovered by centrifugation (12,000 × g for 2 min), and nuclear DNA was extracted with
the Qiagen tissue kit and suspended in 100 µl of TE (0.01 mM Tris
[pH 7.4], 1 mM EDTA) buffer containing 0.2 mg of yeast tRNA per ml.
Quantification of vector DNA from the infected macrophages was
performed by real-time PCR using the TaqMan amplification
system. PCR amplification for the SIV gag region (present in
V1EGFP vector DNA) was carried out. Forward and reverse PCR primers
were SIVgag1120F (AGTACGGCTGAGTGAAGGCAGTA) and SIVgag1192R
(GACCCGCGCCTTTATAGGA), respectively, and the fluorescent gag
probe was SIVgagprobe1147 (6-carboxyfluorescein-CGGCAGGAACCAACCACGACG-NNN'N'-tetramethyl-6-carboxy rhodamine). Nuclear DNA samples corresponding to
equal numbers of cells infected by the different vector pseudotypes
were analyzed in parallel; fluorescence was recorded as a function of
PCR amplification cycle.
Infection with replication-competent SIVmac.
Infection of
T-cell lines with replication-competent SIVmac239, SIVmac316, and
SIVmac1A11 was performed as described previously (41).
 |
RESULTS |
Generation of helper-free SIV vector stocks.
For these
experiments, we used a helper-free vector based on SIVmac239, described
elsewhere (26a). This vector, V1EGFP, expresses EGFP; the
EGFP gene was inserted into the SIV genome in place of the nef gene (Fig. 1). In addition, the vector was
rendered replication defective by two consecutive stop codons at the
beginning of the gag gene and by deletion of coding
sequences from the env gene. To generate vector stocks, a
plasmid containing the V1EGFP vector organization along with an SV40
origin of replication (V1EGFPSVO) was cotransfected into human 293T
cells along with two helper plasmids. One helper plasmid
(pUpSVO
) expressed the SIVmac239 gag, pol, vpx, vpr,
vif, tat, and rev genes from a deleted form of the
provirus; the other plasmid (pCDSenv) expressed the env, nef,
tat, and rev genes under control of the cytomegalovirus
immediate-early promoter. Both of the helper plasmids lacked the SIV
RNA packaging signals (39) so that the mRNAs encoded by
them should not be packaged into virus particles, and they both
contained SV40 origins of replication for efficient expression in 293T
cells. Vector stocks were harvested from the cotransfected 293T cells
at 48 and 72 h posttransfection. It was possible to change the Env
protein on the vectors by changing the env helper plasmid;
for these experiments, we generated versions of this plasmid containing
genes from SIVmac239 (T-tropic), SIVmac1A11 (dualtropic), and SIVmac316
(M-tropic). The resulting vector particles contained all of the SIV
structural proteins, including accessory proteins such as Vpr and Vpx.
Infection of CMMT-CD4 cells by the V1EGFP vectors was carried out
to assess the efficiency of vector expression. CMMT-CD4 cells are
macaque mammary tumor cells that express the human CD4 protein
(11). The cells are infectible by most strains of SIV, and
they show similar efficiencies of infection for M- and T-tropic SIV
strains (11). Infection of the cells
with the different V1EGFP pseudotypes resulted in readily detectable
green fluorescence 4 days postinfection (Fig.
2a). As an alternate detection technique, infected cells were trypsinized and single-cell suspensions were screened by flow cytometry (fluorescence-activated cell sorting [FACS]). Fluorescent cells could be readily detected by the FACS analysis, and there were no differences in the fluorescent intensities of cells infected with the different envelope pseudotypes (Fig. 3). Uninfected CMMT-CD4 cells did not
show detectable fluorescence either by fluorescence microscopy or FACS
analysis (Fig. 2B and 3G). The vector stocks efficiently infected other
cells that are susceptible to SIV infection, including CEMX174 cells,
Molt4-Clone8 cells, rhesus PBMCs, and primary rhesus macrophages. To
further test whether the fluorescent signals were the result of
retroviral infection, infections were carried out in the presence of
the reverse transcriptase inhibitor PMPA (25 µM). Pretreatment of the
cells 1 h prior to infection effectively eliminated green fluorescent cells (Fig. 2D and 3).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 2.
Infection with V1EGFP vector. Cultures of CMMT-CD4 cells
or primary rhesus macrophages were infected with undiluted stocks of
V1EGFP pseudotyped with SIVmac1A11 envelope. The cultures were then
examined by fluorescence microscopy with a green filter. (A) Infected
CMMT-CD4 cells 4 days postinfection. (B) Uninfected CMMT-CD4 cells. (C)
Infected rhesus macrophages 4 days postinfection. (D) CMMT-CD4 cells
infected in the presence of the reverse transcriptase inhibitor PMPA.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Fluorescence intensity of V1EGFP-infected cells.
Cultures of CMMT-CD4 cells (5 × 104)
were infected with V1EGFP pseudotyped with different SIVmac envelopes,
in the presence or absence of PMPA. The cultures were then harvested at
4 days postinfection, fixed, and analyzed for green fluorescence by
flow cytometry. The x axis shows log fluorescence
intensity and the y axis shows cell number; 10,000 cells
were analyzed in each case. (A and B) Cells infected with a SIVmac239
pseudotype (1.6 × 104 GFU); (C and D) cells infected
with a SIVmac1A11 pseudotype (4 × 103 GFU); (E and F)
cells infected with a SIVmac316 pseudotype (8 × 103
GFU); (G and H), uninfected cells. (B, D, F, and H),
cultures infected in the presence of 100 µM PMPA. The vector-infected
cells are evident as the peak with a mean fluorescence of ca. 200 to
300. Note that the fluorescence values for the cultures infected with
the different pseudotypes were approximately the same.
|
|
The titers of the vector stocks were determined by infecting
CMMT-CD4 cells at different dilutions, followed by counting fluorescent cells (by microscopy or by FACS), and the results are shown in Table
1. Vector titers ranged from 3 × 105 to 1.3 × 106.
Because our experiments were designed to study a single round of
infection, it was important for the vector stocks to be free of
replication-competent SIV. In principle, they should have lacked infectious SIV, since the helper plasmids encoding the SIV structural proteins lacked the RNA packaging signals. As described elsewhere (26a), the V1EGFP stocks prepared as described here lacked detectable replication-competent SIV as measured by serial passage on CEMX174 cells followed by assays for reverse transcriptase activity.
Linearity of infection.
It was important to establish the
linear range of infection for the vectors in each of the cell lines or
primary cell types, since our goal was to quantify the efficiency of
infection in these different cells. Moreover, as mentioned in
Discussion, linearity of infection proved essential for obtaining
results that reflected actual efficiencies of infection. Table
2 shows data from infection of primary
macrophages with different concentrations of V1EGFP vectors pseudotyped
with different SIVmac envelopes. In macrophages from animal 30440, linearity was achieved when the vector stocks were diluted at
least 20-fold. Similar results were obtained for vectors
pseudotyped with the SIVmac239 and SIVmac316 envelopes used
to infect primary macrophages or Molt4-Clone8 cells, but the range of
dilutions over which linearity was achieved differed for various
vector-cell combinations. For instance, for macrophages from animal
25980, when V1EGFP vector pseudotyped with the SIVmac239 envelope was
used to infect primary macrophages, linearity occurred even with a
vector stock diluted 1:5. In contrast, vectors pseudotyped with clone
316 or 1A11 envelopes required dilutions of 1:320 to achieve linearity
for this animal. All of the studies described below were carried out
with diluted vector stocks that were in the linear range. In practice,
linearity was achieved when no more than 5% of the cells were
infected.
Infection in primary rhesus macrophages.
Previous experiments
by other investigators have shown differences in the ability of various
SIVmac strains to infect primary alveolar or blood-derived rhesus
macrophages over multiple rounds of infection (5, 27, 30, 32, 33,
35, 49). In particular, SIVmac239 does not replicate
(31) (or replicates poorly [26, 47]) in
primary rhesus macrophages, while SIVmac316 efficiently replicates in
the cells. We wished to reexamine this issue by using the
replication-defective V1EGFP vector pseudotypes, since these vectors
would limit infection to only one round. Moreover, these vectors will
carry out early steps in the infection cycle, including entry, reverse
transcription, integration, and transcription. However, detection of
vector infection does not require late events such as virion protein
expression, virus particle assembly, or virion maturation. Thus, these
vectors would also allow discrimination between early and late blocks
in viral replication; if the block for SIVmac239 replication in
macrophages is at a late step, then V1EGFP pseudotypes with either
SIVmac239 or SIVmac316 envelopes would be expected to infect and
express in primary macrophages with equal efficiency. On the other
hand, if the block is at an early step, then the SIVmac316 pseudotype
would be expected to efficiently infect the macrophages, while the
SIVmac239 pseudotype would not.
We used the V1EGFP vector stocks described in Table 1 to infect
PBMC-derived macrophages from four rhesus macaques under conditions of linear infection, as shown in Table
3. There was a striking difference
between the efficiencies of infection for the different V1EGFP
pseudotypes. In particular, vector pseudotyped with the SIVmac239
envelope was substantially less efficient at infecting the macrophages
than the same vector pseudotyped with either the SIVmac316 or
SIVmac1A11 envelope. On average, vector pseudotyped with the SIVmac316
envelope was 295-fold more infectious on the primary macrophages than
was the same vector pseudotyped with the SIVmac239 envelope. Likewise,
vector pseudotyped with the SIVmac1A11 envelope was on average 167-fold
more infectious than vectors pseudotyped with the SIVmac239 envelope.
Further, comparison of the mean intensity of intracellular GFP signal
from infection of macrophages with the different envelope
pseudotypes did not show significant differences in fluorescence
intensity, suggesting similar levels of EGFP expression in the
cells (Fig. 4). These results indicate
that a substantial portion of the replication block for virus carrying
SIVmac239 envelope in primary macrophages can be explained by a defect
or defects in relatively early steps in the infection cycle.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Fluorescence intensity of V1EGFP-infected macrophages.
Cultures of PBMC-derived macrophages were infected with V1EGFP
pseudotyped with different SIVmac envelopes (4 × 104 GFU on CMMT-CD4 cells per 105 cells).
The cultures were then harvested at 4 days postinfection, fixed, and
analyzed for green fluorescence by flow cytometry. The x
axis shows log fluorescence intensity, and the y axis
shows cell number; 5,000 cells were analyzed in each case. (A) Cells
infected with a SIVmac316 pseudotype; (B) cells infected with a
SIVmac1A11 pseudotype; (C) cells infected with a SIVmac239 pseudotype.
The fluorescence values for the cultures infected with the
different pseudotypes were approximately the same. The geometric mean
intensities (in arbitrary fluorescence units) in the M1 region
were as follows: 601 for the SIVmac239 pseudotype, 1,212 for the
SIVmac1A11 pseudotype, and 1,265 for the SIVmac316 pseudotype.
|
|
Quantification of newly synthesized viral DNA in macrophages.
To further define restriction to replication of T-tropic SIV in
macrophages, we compared the levels of vector DNA in nuclear fractions
of macrophages infected by SIVmac239 and SIVmac316 pseudotypes of
V1EGFP. Vector stocks were first treated with DNase to remove contaminating plasmid DNA and then used to infect primary PBMC-derived macrophages. Twenty-four hours after infection, nuclei were prepared and nuclear DNA was extracted. Nuclear DNA from equal numbers of cells
infected by the two pseudotypes was then assayed for the level of
reverse-transcribed vector DNA by quantitative real-time PCR (Fig.
5A). The results indicated that there was
approximately threefold more vector DNA in the nuclei of macrophages
infected with the M-tropic pseudotype than in those infected with the
T-tropic pseudotype. Similar results were obtained on repeated assays
of four independent macrophage infections. Thus, despite a ca.
300-fold-higher efficiency of macrophage infection for the M-tropic
V1EGFP pseudotype (as measured by fluorescent cells), there was
only a minor difference in nuclear DNA levels. Thus, a major block for
vector infection of virus with SIVmac239 envelope appears to be located
after transport of nuclear DNA into the nucleus and prior to viral DNA
expression.

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 5.
Quantification of vector DNA in infected macrophages.
(A) PBMC-derived rhesus macrophages (105) were infected
with DNase-treated V1EGFP pseudotyped with either SIVmac239 or
SIVmac316 Env protein, at a multiplicity of 0.025 GFU (titered
on CMMT-CD4 cells) per cell. At 24 h after infection, nuclei were
prepared and DNA was extracted. Equal samples of nuclear DNA were
tested for the presence of vector DNA by real-time PCR in a TaqMan
thermal cycler, using the SIV-specific PCR primers and probe described
in Materials and Methods. Quantification
(A260) of the total nuclear DNAs prior to
real-time PCR indicated equivalent efficiencies of
recovery. The relative fluorescence signal for each PCR
cycle is shown for each DNA sample. Duplicate amplifications were
performed for each DNA. As a control, nuclear DNA from uninfected
macrophages was analyzed in parallel. Fluorescence values below
10 2 were not significant. (B) In a second experiment,
rhesus macrophages were infected with SIVmac239 and SIVmac316
pseudotypes of V1EGFP, and nuclear DNA was quantified as described for
panel A. In addition, macrophages were infected with the SIVmac239
pseudotype of V1EGFP in the presence of 200 µM PMPA and
analyzed in parallel. Results from duplicate real-time PCR assays are
shown.
|
|
One potential artifact in the experiments illustrated in Fig. 5 could
have been the uptake of contaminating plasmid DNA in the vector stocks,
even though the stocks were treated with DNase prior to infection and
nuclei were isolated from trypsinized infected macrophages prior to DNA
extraction. This was of greater concern for the SIVmac239 pseudotypes,
since they showed the lower levels of nuclear vector DNA. To address
this concern, macrophages were infected in parallel with V1EGFP
pseudotyped with SIVmac239 in presence of PMPA and analyzed, as shown
in Fig. 5B and Table 4. The results
indicated that while some vector DNA was detected in the nuclei of
PMPA-treated cells, more vector DNA was present in the nuclei of cells
infected without PMPA. As shown in Table 4, when only PMPA-sensitive
DNA was considered, the levels of nuclear vector DNA in macrophages
infected with the clone 316 or 239 pseudotype were still quite similar
(within threefold).
As mentioned, the most likely source for the PMPA-resistant vector DNA
detected in Fig. 5B was uptake of contaminating plasmid DNA by the
macrophages. However, this DNA was not integrated and expressed, since
vector infection in the presence of PMPA eliminated the appearance of
EGFP-positive cells (see above and below).
Kinetics of reverse transcription in macrophages.
While the
results shown in Fig. 5 indicated a major block for SIVmac239 in
macrophages at a step between nuclear import and gene expression, it
was possible that an earlier block was also present. This would be
consistent with the ca. threefold-less nuclear vector DNA in
macrophages infected with the T-tropic V1EGFP pseudotype. To examine an
earlier step in infection, we investigated the rate at which reverse
transcription took place for the different vector pseudotypes. This was
accomplished by adding the reverse transcriptase inhibitor PMPA to the
infected cultures at different times after the initiation of infection.
If PMPA is added after reverse transcription of the vector has taken
place in a given infected cell, then it will not inhibit expression of
EGFP. Figure 6 shows the results of
adding the PMPA to primary macrophages at different times postinfection
with the different V1EGFP pseudotypes. The results indicated that the
kinetics of events up to and including reverse transcription occurred
more rapidly when the vector was pseudotyped with the clone 316 envelope than when it was pseudotyped with the clone 239 envelope. As
measured from the time points at which 50% of the vector infection was
resistant to PMPA treatment, reverse transcription was completed on
average by 11.5 h for the 316 pseudotype while this did not occur
until 17.5 h postinfection for the 239 pseudotype. V1EGFP vector
pseudotyped with the clone 1A11 envelope showed an intermediate time
for completion of reverse transcription. The same rank order for the
vector pseudotypes was observed in repeated experiments, some of which
utilized macrophages from different rhesus macaques.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Timing of reverse transcription in macrophages infected
with vector pseudotypes (monkey 25980). A total of 4 × 105 macrophages in 12-well plates were infected with 500 µl of diluted V1EGFP stocks pseudotyped with different SIVmac
envelopes as described in Materials and Methods. Each well infected
with the SIVmac239 pseudotype received 6.3 × 103 GFU,
each well infected with the SIVmac1A11 pseudotype received 1.6 × 103 GFU, and each well infected with the SIVmac316
pseudotype received 1.7 × 103 GFU. A
100 µM concentration of PMPA was added at the time points indicated.
All cultures were scored for infected cells at 4 days postinfection.
The levels of infection are plotted as percent infection without
PMPA.
|
|
Infection of T lymphocytes.
Since the experiments with the
primary macrophages indicated that a major block for T-tropic SIVmac239
is at an intermediate step in the infection cycle, we wished to test
whether restriction of M-tropic virus in T lymphocytes is also
determined at early steps in infection. One challenge was that there
are relatively few SIVmac isolates that do not replicate in the
standardly used T-lymphocyte lines. Indeed, most M-tropic SIVmac
isolates would be better considered dualtropic since they can replicate
in both primary macrophages and CD4-positive T-lymphocyte lines. To
identify a truly M-tropic SIVmac isolate, we first tested several human T-lymphocyte lines for infection by replication-competent SIVmac316. While this virus replicated in T-lymphocyte lines such as SupT1 (data
not shown), it did not replicate in Molt4-Clone8 cells on multiple
rounds of infection, as shown in Fig. 7.
Thus, on the basis of Molt4-Clone8 cell infections, SIVmac316 can
indeed be considered M-tropic. As expected, SIVmac239 efficiently
replicated in Molt4-Clone8 cells, as did the dual-tropic SIVmac1A11.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 7.
Replication of SIVmac viruses in Molt4-Clone8 cells. A
total of 5 × 105 Molt4-Clone8 cells were infected at
a multiplicity of infection of 0.002 with different SIVmac viruses as
described in Materials and Methods. p27 SIV gag antigen
in culture supernatants was measured at different times and is plotted
versus days postinfection.
|
|
Molt4-Clone8 cells were infected with equal concentrations of the
V1EGFP pseudotypes, and the results are shown in Table
5. The results indicate that all three
pseudotypes infected the Molt4-Clone8 cells with similar efficiencies.
Thus, in contrast to the situation in primary macrophages where the
SIVmac239 pseudotype was restricted at a relatively early event in
infection, the SIVmac316 pseudotype was not affected in its ability to
carry out early steps in the infection cycle. Further, comparison of
the GFP signal intensity in infection of Molt4-Clone8 cells showed no
significant difference in the fluorescence intensities between
cells infected with the SIVmac239 and -316 envelope pseudotypes,
as expected. Together, these indicate that the block results for
SIVmac316 infection of Molt4-Clone8 cells is at a late step in
infection.
We also investigated the kinetics of reverse transcription for the
different V1EGFP pseudotypes in Molt4-Clone8 cells, as shown in Fig.
8. Consistent with the vector infection
results, there was no systematic difference in the kinetics of reverse transcription for the different pseudotypes.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 8.
Timing of reverse transcription in Molt4-Clone8 cells
infected with vector pseudotypes. A total of 106
Molt4-Clone8 cells in six-well plates were infected with
105 GFU of V1EGFP pseudotyped with different SIVmac
envelopes. A 100 µM concentration of PMPA was added at the times
indicated, and the numbers of GFP-positive cells were measured at 4 days postinfection by flow cytometry. Infection levels are shown as
percentage of GFP-positive cells in the absence of PMPA.
|
|
 |
DISCUSSION |
Previous studies of SIV tropism have employed analysis of multiple
rounds of infection, making it difficult to determine the steps in
replication where the virus is restricted. In the studies reported
here, we used helper-free SIV-based vectors to study the mechanisms of
SIV cell tropism. These vectors carry out only a single cycle of
infection since they are replication defective; in fact, they can
only carry out steps in infection from binding and entry through
reverse transcription, DNA integration, and gene expression.
V1EGFP vectors pseudotyped with either M-tropic or T-tropic envelope
proteins allowed us to determine which steps were blocked for SIVs
under the restrictive conditions. Two interesting results were
obtained. In the case of infection in primary macrophages, the block
for T-tropic SIVmac239 appeared to be at a relatively early step(s),
since V1EGFP pseudotyped with the clone 239 envelope was substantially
less infectious (ca. 200- to 300-fold) than the same vector pseudotyped
with the clone 316 or 1A11 envelope. Furthermore, there were only minor
differences (ca. threefold) in the level of nuclear SIV DNA between
macrophages infected with the 239 and 316 pseudotypes (Fig. 5). This
suggests that a major block to replication of T-tropic SIVs (SIVmac239)
lies beyond nuclear transport but before early gene expression. On the
other hand, the block for infection of M-tropic SIVmac316 in
Molt4-Clone8 T cells was at a different step in the infection cycle,
since V1EGFP pseudotyped with the SIVmac316 envelope infected these cells with the same efficiency as the same vector pseudotyped with the
SIVmac239 envelope. Thus, M-tropism and T-tropism restrictions for SIV
may involve steps for primary macrophages different from those for T lymphocytes.
The finding of a block in replication for SIVmac239 in primary
macrophages at a postreverse transcription step in infection cycle
confirms and extends work by other investigators. As mentioned above,
in a study with replication-competent virus, Mori et al. suggested that
the block for T-tropic SIVmac239 infection of primary rhesus alveolar
macrophages was at a step after reverse transcription, since the amount
of reverse-transcribed viral DNA was within ca. fivefold of the levels
detected in SIVmac316-infected cells (32). Kirchhoff et
al. also concluded that the restriction of T-tropic SIVmac239 in
PBMC-derived macrophages is not at an early step of the viral infection
cycle (27). However, Stephens et al. (49)
reported restriction of T-tropic SIVmac in PBMC-derived macrophages at
extremely late steps of infection, namely, virion assembly, release,
and/or polyprotein processing, which would differ from the conclusions
reached in the present study. Thus, our results agree with those of
Mori et al. and Kirchhoff et al., and they further suggest a major
block of the SIVmac239 pseudotype of V1EGFP in macrophages at some step
beyond nuclear translocation of viral DNA and before expression of the
integrated provirus. Another laboratory has independently used T-tropic
pseudotypes of a replication-defective SIV vector and found a
substantial reduction in infection efficiency in primary macrophages
compared to an M-tropic pseudotype (N. Bannert, D. Schenten, and J. Sodroski, personal communication).
In these experiments, we found it necessary to ensure that infections
were carried out at appropriate multiplicities. As described in
Results, it was necessary to verify that the vector infections were
carried out under conditions of linearity; in some cases, this was
achieved only after the vector stocks were diluted. Indeed, when we
carried out macrophage infections with undiluted vector pseudotypes, we
observed only a fivefold difference between the efficiencies of
infection for the SIVmac316 and SIVmac239 pseudotypes, because the
amount of SIVmac316 pseudotype was saturating.
The results shown in Fig. 6 indicate that reverse transcription for
V1EGFP pseudotyped by SIVmac316 may be completed more rapidly than that
for the SIVmac239 pseudotype. This might suggest an impairment of
SIVmac239 in macrophages at a quite early step in infection, before
reverse transcription. At first glance, this might seem to be
inconsistent with the major block at integration or gene expression
described above. However, Fig. 6 allowed us to measure the rate of
reverse transcription only for the small fraction of SIVmac239
pseudotypes that successfully completed infection to the point where
EGFP was expressed. Thus, it is possible that there may be two blocks
for SIVmac239 infection in macrophages: a minor block at a quite early
step (e.g., binding, entry, or reverse transcription) and the later
major block discussed above. It is noteworthy that Mori et al. found a
ca. fivefold reduction in reverse-transcribed viral DNA for SIVmac239
compared to that for SIVmac316 when infecting macrophages, consistent
with a minor early block (32). Recently, Bannert et al.
(personal communication) found that the low efficiency of SIVmac239
infection in primary PBMC-derived macrophages can be enhanced by
vectored overexpression of CD4 protein.
Evidence for an intracellular blockage of HIV infection has also been
reported. Prior to the attribution of M versus T tropism of HIV
to coreceptor usage, Schmidtmayerova et al. suggested that intracellular events may be involved (43). Our previous
studies (12) showed that SIVs encoding the HIV envelope
are unable to replicate in CD4+ macaque cells,
unless those cells also express the appropriate human coreceptors. When
the level of restriction was examined, it was found that in the
nonpermissive cells, DNA from SIVs encoding the HIV envelope was
synthesized, but there appeared to be a block at the level of nuclear
import. Thus, blocks for T-tropic SIV in macrophages might reflect
similar processes for HIV cell tropism; in the latter case, this may be
superimposed on coreceptor binding. More recently, it has been shown
that human macrophages do express CXCR4 coreceptor and that this
coreceptor can function on dualtropic HIV-1 isolates but not on
T-tropic isolates (29, 51, 52). Moreover, the restriction
for T-tropic virus in macrophages is after reverse transcription
(43), very similar to the major block for T-tropic SIV in
macrophages described here.
It is interesting to consider possible mechanisms by which T-tropic SIV
envelope protein could lead to restriction at postentry steps in
macrophages. One possible mechanism is preferential activation of
macrophages. Weissman et al. showed that recombinant gp120 from
the M-tropic SIV clone PBj1.9 induces an intracellular calcium flux in
the CCR5-positive B10 lymphocyte cell line, while gp120 from SIVmac239
does not (50). If gp120-mediated activation is necessary
for productive infection of macrophages, a differential ability of
M-tropic and T-tropic envelope proteins to trigger signals through CCR5
interactions might be responsible for cell tropism. However, incubation
of macrophages with SIVmac316 envelope protein (or vectored expression
in these cells) did not increase their ability to be infected by
vectors pseudotyped with SIVmac239 envelope (X. J. You and H. Fan,
unpublished data) (6). Thus, preferential activation of
macrophages by M- versus T-tropic SIV envelope protein does not
appear to be the mechanism involved.
Another possible mechanism could be that when T-tropic SIV is incubated
with macrophages, it is taken up, but the viral particles enter a
dead-end intracellular pathway due to an inappropriate interaction of
envelope protein with CD4 or coreceptor. Thus, some postentry events
may take place (e.g., reverse transcription or nuclear import), but the
products will not ultimately result in virus expression and/or
production. Such a mechanism would be consistent with the multiple
reports of postentry blocks associated with cell tropism described
above. Recent experiments have indicated that PBMC-derived macrophages
express suboptimal levels of CD4 for infection by SIVmac239 (but not
SIVmac316) and that this can be corrected by overexpression of CD4 in
those cells (6). Alveolar macrophages have also been found
to express low levels of CD4 (34). Taken together with the
results reported here, this might suggest that in the absence of
sufficient CD4, standard fusion-mediated viral entry does not occur,
but virus may still enter cells by another (nonproductive) process such
as endocytosis.
In contrast to the relatively early blocks found for infection of
T-tropic SIVmac239 in primary macrophages, the block for M-tropic
SIVmac316 in Molt4-Clone8 T-lymphoid cells was clearly at a late step
in infection, since V1EGFP pseudotyped with SIVmac316 envelope infected
these cells as efficiently as the SIVmac239 pseudotype did. This is
reminiscent of the late block in infection described by Stephens et al.
(49), although in that report the block was described for
a T-tropic SIVmac in PBMC-derived macrophages. It will be interesting
to determine how the envelope glycoprotein can affect virus replication
at such a late step. One possible mechanism is aberrant viral assembly
or maturation of virions containing SIVmac316 envelope protein in
Molt4-Clone8 cells.
In summary, the use of helper-free replication-defective SIV-based
vectors has allowed us to gain new insights into the mechanisms of SIV
cell tropism and to more closely focus on the exact location of the
restriction to replication of T-tropic SIV in macrophages. These vector
particles were identical except for the envelope proteins. While the
tropism was determined by the envelope protein, envelope-host cell interactions affect virus replication
at several steps after entry. Moreover, different steps in the
infection cycle appeared to be critical in primary macrophages and a
T-lymphocyte cell line.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant R01AI39435. S.S.K. was
supported by NIH training grant T32 AI07319 and by a fellowship from
the American Heart Association. M.-E.H was supported by NIH training grant T32 CA09229. Institutional support of the UCI Cancer Research Institute and the Chao Family Comprehensive Cancer Center is acknowledged.
We thank R. Desrosiers, T. Kodama, M. Marthas, C. Miller, K. Uberla, and Gilead Sciences for providing materials and W. E. Robinson for advice.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology and Biochemistry, University of California, Irvine, 3221 Biological Sciences II, Irvine, CA 92697-3905. Phone: (949) 824-5554. Fax: (949) 824-4023. E-mail:
hyfan{at}uci.edu.
 |
REFERENCES |
| 1.
|
Alkhatib, G.,
C. C. Broder, and E. A. Berger.
1996.
Cell type-specific fusion cofactors determine human immunodeficiency virus type 1 tropism for T-cell lines versus primary macrophages.
J. Virol.
70:5487-5494[Abstract/Free Full Text].
|
| 2.
|
Alkhatib, G.,
C. Combadiere,
C. C. Broder,
Y. Feng,
P. E. Kennedy,
P. M. Murphy, and E. A. Berger.
1996.
CC CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 3.
|
Anderson, G. M.,
D. Hauer,
D. P. Sharma,
S. V. Joag,
O. Narayan,
M. C. Zink, and J. E. Clements.
1993.
Analysis of envelope changes acquired by SIVmac239 during neuroadaption in rhesus macaques.
Virology
195:616-626[CrossRef][Medline].
|
| 4.
|
Asjo, B.,
L. Morfeldt-Manson,
J. Albert,
G. Biberfeld,
A. Karlsson,
K. Lidman, and E. M. Fenyo.
1986.
Replicative capacity of human immunodeficiency virus from patients with varying severity of HIV infection.
Lancet
ii:660-662.
|
| 5.
|
Banapour, B.,
M. L. Marthas,
R. A. Ramos,
B. L. Lohman,
R. E. Unger,
M. B. Gardner,
N. C. Pedersen, and P. A. Luciw.
1991.
Identification of viral determinants of macrophage tropism for simian immunodeficiency virus SIVmac.
J. Virol.
65:5798-5805[Abstract/Free Full Text].
|
| 6.
|
Bannert, N.,
D. Schenten,
S. Craig, and J. Sodroski.
2000.
The level of CD4 expression limits infection of primary rhesus monkey macrophages by a T-tropic simian immunodeficiency virus and macrophage-tropic human immunodeficiency viruses.
J. Virol.
74:10984-10993[Abstract/Free Full Text].
|
| 7.
|
Berson, J. F.,
D. Long,
B. J. Doranz,
J. Rucker,
F. R. Jirik, and R. W. Doms.
1996.
A seven-transmembrane domain receptor involved in fusion and entry of T-cell-tropic human immunodeficiency virus type 1 strains.
J. Virol.
70:6288-6295[Abstract].
|
| 8.
|
Bleul, C. C.,
L. Wu,
J. A. Hoxie,
T. A. Springer, and C. R. Mackay.
1997.
The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes.
Proc. Natl. Acad. Sci. USA
94:1925-1930[Abstract/Free Full Text].
|
| 9.
|
Broder, C. C., and E. A. Berger.
1995.
Fusogenic selectivity of the envelope glycoprotein is a major determinant of human immunodeficiency virus type 1 tropism for CD4+ T-cell lines vs. primary macrophages.
Proc. Natl. Acad. Sci. USA
92:9004-9008[Abstract/Free Full Text].
|
| 10.
|
Brussel, A.,
J. L. Pretet,
M. Girard, and C. Butor.
1999.
Sequences and predicted structures of chimpanzee STRL33 (Bonzo) and gpr15 (BOB).
AIDS Res. Hum. Retrovir.
15:1315-1319[CrossRef][Medline].
|
| 11.
|
Chackerian, B.,
N. L. Haigwood, and J. Overbaugh.
1995.
Characterization of a CD4-expressing macaque cell line that can detect virus after a single replication cycle and can be infected by diverse simian immunodeficiency virus isolates.
Virology
213:386-394[CrossRef][Medline].
|
| 12.
|
Chackerian, B.,
E. M. Long,
P. A. Luciw, and J. Overbaugh.
1997.
Human immunodeficiency virus type 1 coreceptors participate in postentry stages in the virus replication cycle and function in simian immunodeficiency virus infection.
J. Virol.
71:3932-3939[Abstract].
|
| 13.
|
Chelucci, C.,
I. Casella,
M. Federico,
U. Testa,
G. Macioce,
E. Pelosi,
R. Guerriero,
G. Mariani,
A. Giampaolo,
H. J. Hassan, and C. Peschle.
1999.
Lineage-specific expression of human immunodeficiency virus (HIV) receptor/coreceptors in differentiating hematopoietic precursors: correlation with susceptibility to T- and M-tropic HIV and chemokine-mediated HIV resistance.
Blood
94:1590-1600[Abstract/Free Full Text].
|
| 14.
|
Cheng-Mayer, C.,
M. Quiroga,
J. W. Tung,
D. Dina, and J. A. Levy.
1990.
Viral determinants of human immunodeficiency virus type 1 T-cell or macrophage tropism, cytopathogenicity, and CD4 antigen modulation.
J. Virol.
64:4390-4398[Abstract/Free Full Text].
|
| 15.
|
Cheng-Mayer, C.,
T. Shioda, and J. A. Levy.
1991.
Host range, replicative, and cytopathic properties of human immunodeficiency virus type 1 are determined by very few amino acid changes in tat and gp120.
J. Virol.
65:6931-6941[Abstract/Free Full Text].
|
| 16.
|
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P. D. Ponath,
L. Wu,
C. R. Mackay,
G. LaRosa,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1996.
The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135-1148[CrossRef][Medline].
|
| 17.
|
Connor, R. I., and D. D. Ho.
1994.
Human immunodeficiency virus type 1 variants with increased replicative capacity develop during the asymptomatic stage before disease progression.
J. Virol.
68:4400-4408[Abstract/Free Full Text].
|
| 18.
|
Deng, H.,
R. Liu,
W. Ellmeier,
S. Choe,
D. Unutmaz,
M. Burkhart,
P. Di Marzio,
S. Marmon,
R. E. Sutton,
C. M. Hill,
C. B. Davis,
S. C. Peiper,
T. J. Schall,
D. R. Littman, and N. R. Landau.
1996.
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661-666[CrossRef][Medline].
|
| 19.
|
Deng, H. K.,
D. Unutmaz,
V. N. KewalRamani, and D. R. Littman.
1997.
Expression cloning of new receptors used by simian and human immunodeficiency viruses.
Nature
388:296-300[CrossRef][Medline].
|
| 20.
|
Desrosiers, R. C.,
A. Hansen-Moosa,
K. Mori,
D. P. Bouvier,
N. W. King,
M. D. Daniel, and D. J. Ringler.
1991.
Macrophage-tropic variants of SIV are associated with specific AIDS-related lesions but are not essential for the development of AIDS.
Am. J. Pathol.
139:29-35[Abstract].
|
| 21.
|
Di Marzio, P.,
J. Tse, and N. R. Landau.
1998.
Chemokine receptor regulation and HIV type 1 tropism in monocyte- macrophages.
AIDS Res. Hum. Retrovir.
14:129-138[Medline].
|
| 22.
|
Dragic, T.,
V. Litwin,
G. P. Allaway,
S. R. Martin,
Y. Huang,
K. A. Nagashima,
C. Cayanan,
P. J. Maddon,
R. A. Koup,
J. P. Moore, and W. A. Paxton.
1996.
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC- CKR-5.
Nature
381:667-673[CrossRef][Medline].
|
| 23.
|
Edinger, A. L.,
A. Amedee,
K. Miller,
B. J. Doranz,
M. Endres,
M. Sharron,
M. Samson,
Z. H. Lu,
J. E. Clements,
M. Murphey-Corb,
S. C. Peiper,
M. Parmentier,
C. C. Broder, and R. W. Doms.
1997.
Differential utilization of CCR5 by macrophage and T cell tropic simian immunodeficiency virus strains.
Proc. Natl. Acad. Sci. USA
94:4005-4010[Abstract/Free Full Text].
|
| 24.
|
Edinger, A. L.,
J. E. Clements, and R. W. Doms.
1999.
Chemokine and orphan receptors in HIV-2 and SIV tropism and pathogenesis.
Virology
260:211-221[CrossRef][Medline].
|
| 25.
|
Feng, Y.,
C. C. Broder,
P. E. Kennedy, and E. A. Berger.
1996.
HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor.
Science
272:872-877[Abstract].
|
| 26.
|
Jinno, A.,
N. Shimizu,
Y. Soda,
Y. Haraguchi,
T. Kitamura, and H. Hoshino.
1998.
Identification of the chemokine receptor TER1/CCR8 expressed in brain-derived cells and T cells as a new coreceptor for HIV-1 infection.
Biochem. Biophys. Res. Commun.
243:497-502[CrossRef][Medline].
|
| 26a.
| Kim, S., N. Kothari, X. J. You, W. E. Robinson, Jr., T. Schnell, K. Uberla, and H. Fan. Generation of
replication-defective helper-free vectors based on simian
immunodeficiency virus. Virology, in press.
|
| 27.
|
Kirchhoff, F.,
S. Pohlmann,
M. Hamacher,
R. E. Means,
T. Kraus,
K. Uberla, and P. Di Marzio.
1997.
Simian immunodeficiency virus variants with differential T-cell and macrophage tropism use CCR5 and an unidentified cofactor expressed in CEMX174 cells for efficient entry.
J. Virol.
71:6509-6516[Abstract].
|
| 28.
|
Lee, B.,
J. Ratajczak,
R. W. Doms,
A. M. Gewirtz, and M. Z. Ratajczak.
1999.
Coreceptor/chemokine receptor expression on human hematopoietic cells: biological implications for human immunodeficiency virus-type 1 infection.
Blood
93:1145-1156[Abstract/Free Full Text].
|
| 29.
|
Liu, Q. H.,
D. A. Williams,
C. McManus,
F. Baribaud,
R. W. Doms,
D. Schols,
E. De Clercq,
M. I. Kotlikoff,
R. G. Collman, and B. D. Freedman.
2000.
HIV-1 gp120 and chemokines activate ion channels in primary macrophages through CCR5 and CXCR4 stimulation.
Proc. Natl. Acad. Sci. USA
97:4832-4837[Abstract/Free Full Text].
|
| 30.
|
Luciw, P. A.,
K. E. Shaw,
R. E. Unger,
V. Planelles,
M. W. Stout,
J. E. Lackner,
E. Pratt-Lowe,
N. J. Leung,
B. Banapour, and M. L. Marthas.
1992.
Genetic and biological comparisons of pathogenic and nonpathogenic molecular clones of simian immunodeficiency virus (SIVmac).
AIDS Res. Hum. Retrovir.
8:395-402[Medline].
|
| 31.
|
McNearney, T.,
Z. Hornickova,
R. Markham,
A. Birdwell,
M. Arens,
A. Saah, and L. Ratner.
1992.
Relationship of human immunodeficiency virus type 1 sequence heterogeneity to stage of disease.
Proc. Natl. Acad. Sci. USA
89:10247-10251[Abstract/Free Full Text].
|
| 32.
|
Mori, K.,
D. J. Ringler, and R. C. Desrosiers.
1993.
Restricted replication of simian immunodeficiency virus strain 239 in macrophages is determined by env but is not due to restricted entry.
J. Virol.
67:2807-2814[Abstract/Free Full Text].
|
| 33.
|
Mori, K.,
D. J. Ringler,
T. Kodama, and R. C. Desrosiers.
1992.
Complex determinants of macrophage tropism in env of simian immunodeficiency virus.
J. Virol.
66:2067-2075[Abstract/Free Full Text].
|
| 34.
|
Mori, K.,
M. Rosenzweig, and R. C. Desrosiers.
2000.
Mechanisms for adaptation of simian immunodeficiency virus to replication in alveolar macrophages.
J. Virol.
74:10852-10859[Abstract/Free Full Text].
|
| 35.
|
Naidu, Y. M.,
H. W. Kestler III,
Y. Li,
C. V. Butler,
D. P. Silva,
D. K. Schmidt,
C. D. Troup,
P. K. Sehgal,
P. Sonigo,
M. D. Daniel, and R. C. Desrosiers.
1988.
Characterization of infectious molecular clones of simian immunodeficiency virus (SIVmac) and human immunodeficiency virus type 2: persistent infection of rhesus monkeys with molecularly cloned SIVmac.
J. Virol.
62:4691-4696[Abstract/Free Full Text].
|
| 36.
|
O'Brien, W. A.,
Y. Koyanagi,
A. Namazie,
J. Q. Zhao,
A. Diagne,
K. Idler,
J. A. Zack, and I. S. Chen.
1990.
HIV-1 tropism for mononuclear phagocytes can be determined by regions of gp120 outside the CD4-binding domain.
Nature
348:69-73[CrossRef][Medline].
|
| 37.
|
Overbaugh, J.,
L. M. Rudensey,
M. D. Papenhausen,
R. E. Benveniste, and W. R. Morton.
1991.
Variation in simian immunodeficiency virus env is confined to V1 and V4 during progression to simian AIDS.
J. Virol.
65:7025-7031[Abstract/Free Full Text].
|
| 38.
|
Pohlmann, S.,
M. Krumbiegel, and F. Kirchhoff.
1999.
Coreceptor usage of BOB/GPR15 and Bonzo/STRL33 by primary isolates of human immunodeficiency virus type 1.
J. Gen. Virol.
80:1241-1251[Abstract].
|
| 39.
|
Rizvi, T. A., and A. T. Panganiban.
1993.
Simian immunodeficiency virus RNA is efficiently encapsidated by human immunodeficiency virus type 1 particles.
J. Virol.
67:2681-2688[Abstract/Free Full Text].
|
| 40.
|
Rudensey, L. M.,
J. T. Kimata,
R. E. Benveniste, and J. Overbaugh.
1995.
Progression to AIDS in macaques is associated with changes in the replication, tropism, and cytopathic properties of the simian immunodeficiency virus variant population.
Virology
207:528-542[CrossRef][Medline].
|
| 41.
|
Rudensey, L. M.,
J. T. Kimata,
E. M. Long,
B. Chackerian, and J. Overbaugh.
1998.
Changes in the extracellular envelope glycoprotein of variants that evolve during the course of simian immunodeficiency virus SIVMne infection affect neutralizing antibody recognition, syncytium formation, and macrophage tropism but not replication, cytopathicity, or CCR-5 coreceptor recognition.
J. Virol.
72:209-217[Abstract/Free Full Text].
|
| 42.
|
Samson, M.,
A. L. Edinger,
P. Stordeur,
J. Rucker,
V. Verhasselt,
M. Sharron,
C. Govaerts,
C. Mollereau,
G. Vassart,
R. W. Doms, and M. Parmentier.
1998.
ChemR23, a putative chemoattractant receptor, is expressed in monocyte-derived dendritic cells and macrophages and is a coreceptor for SIV and some primary HIV-1 strains.
Eur. J. Immunol.
28:1689-1700[CrossRef][Medline].
|
| 43.
|
Schmidtmayerova, H.,
M. Alfano,
G. Nuovo, and M. Bukrinsky.
1998.
Human immunodeficiency virus type 1 T-lymphotropic strains enter macrophages via a CD4- and CXCR4-mediated pathway: replication is restricted at a postentry level.
J. Virol.
72:4633-4642[Abstract/Free Full Text].
|
| 44.
|
Schnell, T.,
P. Foley,
M. Wirth,
J. Munch, and K. Uberla.
2000.
Development of a self-inactivating, minimal lentivirus vector based on simian immunodeficiency virus.
Hum. Gene Ther.
11:439-447[CrossRef] |