INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Marek's disease virus (MDV) is a highly infectious herpesvirus which induces lymphomas in chickens. The nonpathogenic and antigenically related herpesvirus of turkey (HVT) is usually effective as a vaccine against Marek's disease and is the first successful vaccine against a naturally occurring tumor of any species. While being a very interesting and valuable natural host animal model for oncogenesis, this cell-associated herpesvirus system is somewhat complex. Fully enveloped infectious virions are produced only in feather follicle epithelium (FFE) of the skin; they then detach with feather dander, contaminate dust, are spread by the airborne route, and infect new hosts via the respiratory tract. Four phases of infection in vivo can be delineated: (i) early productive-restrictive virus infection causing primarily degenerative changes, (ii) latent infection, (iii) a second phase of cytolytic infection coincident with permanent immunosuppression, and (iv) a proliferative phase involving nonproductively infected lymphoid cells that may progress to the point of lymphoma formation (5).

MDV and HVT have genome structures closely resembling those of alphaherpesviruses such as herpes simplex virus type 1 (HSV-1), the prototype alphaherpesvirus, varicella-zoster virus (VZV), pseudorabies virus (PRV), bovine herpesvirus 1 (BHV-1), and equine herpesvirus 1. The alphaherpesvirus genome structure consists of covalently joined long (L) and short (S) components. The S component comprises a unique short (U_s) segment flanked by a pair of inverted repeat regions. There are four glycoprotein genes in the HSV-1 U_s region, encoding glycoproteins G (gG), D (gD), I (gI), and E (gE) (10).

HSV-1 gD is a virion envelope component which plays an essential role in HSV-1 entry into susceptible mammalian cells (15). HSV-1 gD has been implicated in receptor binding, cell fusion, and neuroinvasiveness (11). Immunization of animals with HSV-1 gD stimulates the production of virus-neutralizing antibodies and protects them from both lethal challenge with HSV-1 and the establishment of latency (4). Homologs of HSV-1 gD have been identified in the genomes of PRV and BHV-1, among other alphaherpesviruses. The gDs of HSV-1, PRV, and BHV-1 cause viral interference (7, 16, 27). Although the gD homolog of PRV is essential for penetration, its production is not required for cell-to-cell spread (26).

The gI and gE homologs of HSV-1, PRV, and VZV are found to form complexes. HSV-1 gE and VZV gE act as immunoglobulin G Fc receptors that may utilize an antibody bipolar bridging mechanism to protect virus-infected cells from antibody-dependent cellular cytotoxicity (14, 20). HSV-1 and PRV gE are involved in neurotropism and virulence during virus infection of animals (6, 23).

The entire MDV U_s region has been sequenced in our laboratory (3). Genes encoding the MDV gD, gI, and gE homologs have been found in this region, although no gG homolog was found. Antisera to their TrpE fusion proteins have been produced (see Fig. 1). MDV gI and gE have been identified in MDV-infected cells by immunoprecipitation with their respective antisera (2). In contrast, no gD was found in MDV-infected cells with antisera to its TrpE fusion proteins (2).

In this study, antiserum to TrpE-gD was used in a further attempt to detect MDV gD expression in MDV-infected cells, but no protein of the predicted size was found. When Northern blot, reverse transcriptase PCR (RT-PCR) and RNase protection analyses were performed, an abundant 3.5-kb bicistronic mRNA including the MDV gI and gE genes was detected, together with an abundant 2.0-kb monocistronic transcript specific for the gE gene. In contrast, there was no specific mRNA initiating from the gD gene promoter, although a low-abundance polycistronic mRNA including the MDV US3, SORF4, gD, gI, and gE genes was found.

(Preliminary results of this work were presented at the 1996 International Symposium on Marek's Disease.)

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Cells and viruses. The preparation, propagation, and infection of duck embryo fibroblast (DEF) and chicken embryo fibroblast (CEF) cells with cell-associated MDV were performed as described previously (8). The virulent MDV GA strain used in this study was at cell culture passage level 6 following isolation of cell-free virus from feather tips obtained from infected birds with symptoms of Marek's disease.

Generation of TrpE fusion proteins and antibodies to fusion proteins. The vector system used to express the MDV genes in Escherichia coli consists of a group of plasmids (pATH vectors) encoding approximately 37 kDa of the bacterial TrpE open reading frame (ORF) product under control of the inducible trp operon promoter. A polylinker with multiple cloning sites at the 3' end of the trpE ORF allows in-frame insertion of foreign ORFs. The TrpE fusion proteins were generated as described previously (8). The fusion proteins were purified from preparative sodium dodecyl sulfate (SDS)-7.5% polyacrylamide gels and used to prepare antisera by injecting rabbits as described previously (8).

In vitro transcription and translation. MDV SORF4, gD, gI, and gE genes were cloned downstream of T3 or T7 promoters. In vitro-coupled transcription-translation was performed with Promega's TNT coupled reticulocyte lysate system.

Radiolabeling of proteins and immunoprecipitation analysis. MDV-infected and mock-infected control DEF cells were labeled with [³⁵S]methionine at 72 h postinfection for 4 h. After labeling was complete, culture medium samples and cell lysates were prepared and immunoprecipitation analysis was carried out as previously described (8). Briefly, 400 µl of ³⁵S-labeled cell lysates were pretreated with normal rabbit serum for 2 h, protein A was added, and the mixture was incubated for 1 h and centrifuged. After centrifugation, the supernatants were mixed with the respective antisera for 2 h. Then protein A-Sepharose was added, and the suspension was incubated with gentle mixing for 2 h, followed by centrifugation. Immunoprecipitates were resuspended in sample buffer, recentrifuged, and subjected to SDS-polyacrylamide gel electrophoresis (PAGE). Protein markers (GIBCO) were used as molecular weight standards.

RNA preparation, isolation, and Northern blot analysis. RNAs were prepared from MDV-infected and mock-infected control cells at 72 h postinfection by the guanidinium isothiocyanate-phenol extraction procedure. Poly(A)⁺ RNAs were prepared by oligo(dT) cellulose spin columns. Northern blot analysis was performed as described previously (29). DNA probes were labeled by the random-priming method. Riboprobes were prepared as described below. Transcript size determinations were based on a comparison with a GIBCO RNA ladder run in parallel.

Riboprobe and RNA marker preparation. Antisense riboprobes and RNA marker were generated by in vitro transcription off linearized plasmid templates with RNA polymerase T3 or T7 (Promega). For riboprobes and RNA markers used in RNase protection, the 20-µl reaction solution included 5 mM each GTP, ATP, and CTP, in addition to 4.5 µl of [-³²P]UTP (800 µCi/mmol). For riboprobes used in Northern blot analysis, 50 µM unlabeled UTP was added to the reaction mixture.

RNase protection analysis. A 500,000-cpm portion of a riboprobe was hybridized with 40 µg of total RNA in 20 µl of hybridization buffer (40 mM PIPES [pH6.4], 1 mM EDTA, 0.4 M NaCl, 80% formamide) and incubated at 42°C overnight. The hybridization solution was diluted with 300 µl of digestion buffer (300 mM NaCl, 10 mM Tris-HCl [pH7.5], 5 mM EDTA, 40 µg of RNase A per ml, 800 U of RNase T₁ per ml) and incubated at 30°C for 60 min. After digestion, the samples were extracted with phenol-chloroform and the RNAs were precipitated in ethanol. The pellets were then resuspended in loading buffer and subjected to electrophoresis on a polyacrylamide-urea sequencing gel.

RT-PCR assays. Total RNA preparations were treated with RNase-free DNase I (10 U per mg of total RNA) for 30 min at 37°C. Reverse transcription was performed with Superscript II RT (GIBCO) using the oligo(dT) primer. This reaction mixture (1/10 aliquot) was subjected to 30 cycles of PCR consisting of 94°C for 1 min, 50°C for 2 min, and 72°C for 3 min. The product (1/10 aliquot) was loaded onto agarose gels for electrophoresis, and DNA was visualized with ethidium bromide. Nucleotide positions of the primers are shown in Fig. 5A. Primer D sense (DS) (5' TACGTGAATATGCCAACTGC 3') corresponded to nucleotide positions 7340 to 7359. Primer D antisense (DA) (5' AGTGAGTCCAGTGTAACCATCC 3') corresponded to nucleotide positions 7875 to 7896. Primer I sense (IS) (5' TGGTATATGCTCAACCTCATGG 3') corresponded to nucleotide positions 8574 to 8595. Primer I antisense (IA) (5' ACCGATGTATATCCTACGATGG 3') corresponded to nucleotide positions 8574 to 8595. Primer E sense (ES) (5' GAATCGCTAAGTCTGAATGG 3') corresponded to nucleotide positions 9791 to 9800. Primer E antisense (EA) (5' CAGAATGTCAATGTTGGATGCG 3') corresponded to nucleotide positions 10249 to 10270.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Immunoprecipitation analysis fails to detect MDV gD in MDV-infected cell culture. Of the 11 MDV U_s genes, 7 are HSV-1 homologs: US1, US10, US2, US3, US6, (gD), US7 (gI), and US8 (gE). Fragments from each gene have been cloned in-frame with trpE to make TrpE fusion proteins (Fig. 1). Antisera to each TrpE fusion protein have been produced. With these antisera, the proteins encoded by MDV US1, US10, US2, US3, US7 (gI), and US8 (gE) have been identified in extracts from MDV-infected DEF cells, but no gD (US6) protein was found (2).

View larger version (10K): [in this window] [in a new window]   FIG. 1.   Schematic representation of the MDV US region DNA fragments used for antibody production and Northern blot analysis. The nucleotide position numbers are as previously published (3). Each bar represents an MDV Us region fused to TrpE protein for antibody production. Arrows indicate fragments also used as DNA probes specific for the gD, gI, and gE regions of the transcripts in Northern blot analysis.

View larger version (77K): [in this window] [in a new window]   FIG. 2.   MDV gD is not expressed in MDV-infected DEF cells. Lanes: 1, 3, 5, 7, and 9, mock-infected DEF cells; 2, 4, 6, 8, and 10: MDV GA-infected DEF cells; 1 and 2, immunoprecipitation analysis with NRS; 3, and 4, immunoprecipitation analysis with anti-gD; 5 and 6, immunoprecipitation analysis with anti-gI; 7 and 8, immunoprecipitation analysis with anti-gE; 9 and 10, immunoprecipitation analysis with anti-gB. The illustration shows a 4-day exposure.

The MDV gD gene encodes a functional protein. Failure to detect gD expression could result from a defective ORF; the presumed gD ORF may not encode an authentic protein. To address this question, the MDV gD gene, as well as the SORF4, gI, and gE genes as controls, was cloned downstream of T3 or T7 promoters, and in vitro coupled transcription-translation was performed with T3 or T7 RNA polymerases and rabbit reticulocyte lysate (Promega). Each of the SORF4, gD, gI, and gE genes was transcribed and translated into a precursor polypeptide (Fig. 3A). The gD precursor polypeptide was about 43 kDa, close to the mass predicted from its amino acid sequence.

View larger version (38K): [in this window] [in a new window]   FIG. 3.   Expression of MDV gD and other MDV Us genes by in vitro -coupled transcription-translation. (A) Direct SDS-PAGE analysis, 12-h exposure. Lanes 1, without DNA template; 2, MDV SORF4 gene template; 3, MDV gD gene template; MDV gI gene template; 5, MDV gE gene template; 6, luciferase gene template. (B) Immunoprecipitation analysis prior to SDS-PAGE; 3-day exposure. Lanes 1, precursor polypeptide of glycoprotein gD immunoprecipitated by anti-gD; 2, precursor polypeptide of glycoprotein gI immunoprecipitated by anti-gI; 3, precursor polypeptide of glycoprotein gE immunoprecipitated by anti-gE.

Northern blot analysis of mRNA from MDV-infected cells using DNA probes. Like other alphaherpesvirus homologs, the MDV gD (US6), gI (US7), and gE (US8) genes are clustered in that order within the unique short region of the viral genome, spanning nucleotides 6943 to 10960 (Fig. 1) (3). One poly(A) terminator sequence, AATAAA, is located upstream of US6 (gD), and another AATAAA sequence is located downstream of US8 (gE). There is no such sequence downstream of US6 (gD) or US7 (gI). In eucaryotic systems, the protein is most probably translated from the first favorable ATG of an mRNA. Therefore, for efficient expression of the MDV gD or gI genes, mRNA which starts just upstream of the gD gene or the gI gene should exist. However, if MDV gD expression is down-regulated at the transcription level, the gD-specific transcript may not be detectable.

View larger version (30K): [in this window] [in a new window]   FIG. 4.   Northern blot analysis of mRNA from MDV-infected cells with DNA probes; 3-day exposure. Lanes 1, 3, and 5, uninfected DEF; 2, 4, and 6, MDV GA-infected DEF; 1 and 2; hybridized with an MDV gD-specific probe; 3 and 4, hybridized with an MDV gI-specific probe; 5 and 6, hybridized with an MDV gE-specific probe. The 7.5- to 8-kb band was of very low abundance and was seen only after a 10- to 12-day exposure (data not shown).

RT-PCR analysis of the MDV gD, gI, and gE transcripts. To confirm the existence of a low-abundance polycistronic transcript that includes the gD gene, RT-PCR was performed with DNase I-treated total RNA from MDV-infected DEF cells. First-strand cDNA was synthesized in the reverse transcription reaction, and this was followed by PCR. In the control experiment, the same procedure was performed, except that no RT was added in the cDNA synthesis step. The primers from the gD gene are designated DS (D sense) and DA (D antisense), the primers from the gI gene are designated IS and IA, and the primers from the gE gene are designated ES and EA (Fig. 5A).

View larger version (30K): [in this window] [in a new window]   FIG. 5.   RT-PCR analysis of MDV gD transcription in MDV-infected cells. (A) Nucleotide positions in the MDV Us region encompassing gD, gI, and gE. DS, primer gD sense, DA, primer gD antisense; IS, primer gI sense; IA, primer gI antisense; ES, primer gE sense; EA, primer gE antisense. The nucleotide position numbers are as previously published (3). (B) Gene-specific primer pairs. Lanes: 1, 3, and 5, reaction in the absence of RT; 2, 4, and 6, reaction in the presence of RT Left marker: /HindIII marker. Right marker: 123-bp ladder. (C) Primer pairs spanning two or more genes. Lanes: 7, 9, and 11, Reaction in the absence of RT; 8, 10, and 12, Reaction in the presence of RT. Left marker: /HindIII marker. Right marker: 1-kb ladder.

Northern blot analysis of mRNA from MDV-infected cells using riboprobes. To further characterize the low-abundance large transcript, a more sensitive Northern blot analysis was performed with riboprobes and a larger amount of mRNA. MDV-infected CEF cells were used instead of DEF cells in this experiment to determine if the transcription pattern was different between these two cell culture systems.

View larger version (50K): [in this window] [in a new window]   FIG. 6.   Northern blot analysis of mRNA from MDV-infected cells using riboprobes. Lanes: 1, 3, 5, 9, and 11, uninfected CEF cells; 2, 4, 6, 8, 10, and 12, MDV GA-infected CEF cells; 1 and 2, hybridized with a riboprobe which is in the same orientation as the US2 gene; 3 and 4, hybridized with an MDV US3-specific riboprobe; 5 and 6, hybridized with an MDV SORF4-specific riboprobe; 7 and 8, hybridized with an MDV gD-specific riboprobe; 9 and 10, hybridized with an MDV gI-specific riboprobe; 11 and 12, hybridized with an MDV gE-specific riboprobe. (A) One-day exposure. (B) Four-day exposure.

RNase protection analysis of the MDV gI and gE transcripts. In contrast to the gD gene, the gI and gE genes are transcribed efficiently in MDV-infected cells. To confirm the lack of a gD promoter and to determine the promoter regions and 3' termini of the gI and gE transcripts, RNase protection analysis was performed. A series of subgenomic fragments inclusive of ATG sites or AATAAA sequences were subcloned into pBCSK(+) plasmids. A series of riboprobes complementary to mRNA were generated (Fig. 7A), hybridized to RNA obtained from mock-infected and MDV-infected cells 72 h postinfection, digested with RNase, and analyzed on sequencing gels. The size of each fragment was calculated based on a comparison with the synthesized RNA marker. No gD gene-specific promoter region could be detected by this method (data not shown).

View larger version (22K): [in this window] [in a new window]   FIG. 7.   RNase protection assays of RNAs from MDV-infected cells. (A) Locations of probes used for RNase protection. The number adjacent to each probe indicates the distance (in nucleotides) away from the first nucleotide of each ORF. aa, amino acids. (B) CON, RNA from mock-infected DEF cells; INF, RNA from MDV GA-infected DEF cells; M, RNA markers.

View larger version (9K): [in this window] [in a new window]   FIG. 8.   MDV transcript termini deduced from Northern blot analysis and RNase protection analysis. Dotted lines indicate the 5' and 3' ends of each transcript. There are two possible 3' termini for each transcript.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

This study confirmed that MDV gD expression is below the limit of detection in MDV-infected cell culture and showed that this is because of inefficient gD gene-specific transcription. The only transcript clearly detected by the gD gene probe initiates two ORFs upstream of the gD gene. Research on HSV-1 has revealed that each viral gene has its own promoter and that each transcript contains a single functional ORF. Although some HSV-1 mRNAs contain additional protein-coding sequences downstream of their primary ORFs, proteins are not translated from these downstream regions. Instead, abundant proteins are translated from the mRNAs initiating immediately 5' to their genes (22), consistent with the overwhelmingly monocistronic nature of eukaryotic genes. Thus, a priori, the possibility of significant gD gene translation from the 7.5-kb transcript is very unlikely.

HSV-1 gD gene transcription initiates about 85 nucleotides upstream of its ATG codon. Two TATA motifs are located 108 and 126 nucleotides 5' to the ATG codon. Furthermore, DNA within the 168 nucleotides upstream is required for regulated expression of the HSV-1 gD gene, and the consensus ICP4 binding motif ATCGTC is found in this region (21). In the upstream region of the MDV gD gene, three TATA motifs are located at 27, 36, and 50 nucleotides 5' to the ATG codon. No ICP4 binding motif is found there. A consensus poly(A) signal AATAAA sequence is located 60 nucleotides 5' to the gD start codon, which is very close to the TATA motifs. The proximity of the AATAAA sequence may destabilize the transcription initiation complex formed on the TATA sequences and abort the transcription initiation from the gD gene.

MDV gI gene transcription is initiated 23 nucleotides 5' to its ATG site, in contrast to its homolog, the HSV-1 gI transcript, which is initiated 91 nucleotides 5' to its ATG site. Similarly, the MDV gE untranslated region is 24 bases long, only one-third the length of its HSV-1 homolog (73 bases). Considering that the region between MDV gD and gI genes and the region between the gI and gE genes are much shorter than the corresponding regions among the HSV-1 gD, gI, and gE genes, the relatively shorter untranslated regions of MDV gI and gE transcripts are expected.

Either the TATATA sequence or the TATAG sequence upstream of the gI gene CAP site may serve as the TATA box for transcription initiation. Similarly, the TATAT sequence, the TTTAAA sequence, or the TATAA sequence upstream of the gE initiation site may serve as the TATA box for gE transcription initiation. Since the 5' termini of the gI and gE transcripts have been mapped by the RNase protection assay, their promoter regions have been identified and can be studied. The VZV gpIV (gI homolog) promoter has a very low basal level of transcription, but viral factors or virus-induced factors can significantly activate its promoter activity (19). Whether the MDV gI and gE promoters share similar features remains to be determined.

The 2.0- and 3.5-kb transcripts of gI and gE appear to coterminate at a typical AATAAA motif. It is very common among alphaherpesvirus transcription that one polyadenylation signal is shared by several genes, each initiating from its own promoter (17, 22). Two possible 3' termini of the gI and gE transcripts were identified in the RNase protection assay. Heterogeneous 3' ends have been described previously for the VZV gpIV (gI homolog) transcript (19). It is very likely that both the 2.0-kb and 3.5-kb transcripts can terminate at either site.

Because Fig. 6 is a composite made up from the development of 12 different films, those that had been fixed somewhat longer have a darker background (Fig. 6A lanes 7 and 8; Fig. 6B, lanes 1, 2, 9, and 10). Longer exposure of the Northern blot showed several very low abundance fragments smaller than the low-abundance 7.5-kb transcript (Fig. 6B, lanes 4, 6, and 8). These signals may represent nonspecifically hybridized RNA or may represent transcripts present in extremely low abundance. Translation from these uncharacterized transcripts and leaky scanning translation from the 7.5-kb transcript may be able to produce very few gD molecules. Nonetheless, even if these rare translations take place, the few gD molecules could play no significant role in MDV infection. This notion is supported by a study by Morgan's group in which an MDV gD lacZ insertion mutant was made which had similar growth kinetics to the wild-type MDV in both cell culture and chickens (1, 25).

Among the other alphaherpesviruses, HSV-1 has an essential gD gene; VZV, a highly cell-associated virus, lacks a gD homolog altogether; and PRV and BHV-1 are cell-free viruses, but their gD mutants become cell associated, although their infectivity is greatly impaired (12, 18, 28). In keeping with these observations, MDV, a highly cell-associated virus in cell culture, lacks detectable gD expression in cell culture. The FFE of MDV-infected chickens is the only known tissue producing cell-free virus, and whether MDV gD is expressed there is a very interesting question. To address this question, other groups have made monoclonal antibody and detected MDV-gD expression in a few feather follicles (24).

Whether the MDV gD expression phenomenon (perhaps limited only to a few FFE cells) is unique to gD or whether other MDV genes also exhibit this pattern needs to be characterized, and related mechanisms need to be further explored. Learning from research on HSV-1, we can assume that there are specific cellular receptors for MDV. However, since currently known HSV-1 receptors bind to gD, the receptors for MDV probably are of a different type or react with a different viral protein.