Previous Article | Next Article 
Journal of Virology, March 2001, p. 2041-2050, Vol. 75, No. 5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.5.2041-2050.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Increased Neutralization Sensitivity of
CD4-Independent Human Immunodeficiency Virus Variants
Peter
Kolchinsky,1
Enko
Kiprilov,1 and
Joseph
Sodroski1,2,*
Department of Cancer Immunology and AIDS,
Dana-Farber Cancer Institute, and Department of Pathology, Harvard
Medical School,1 and Department of
Immunology and Infectious Diseases, Harvard School of Public
Health,2 Boston, Massachusetts 02115
Received 21 July 2000/Accepted 1 December 2000
 |
ABSTRACT |
Naturally occurring human immunodeficiency virus (HIV-1) variants
require the presence of CD4 and specific chemokine receptors to enter a
cell. In the laboratory, HIV-1 variants that are capable of bypassing
CD4 and utilizing only the CCR5 chemokine receptor for virus entry have
been generated. Here we report that these CD4-independent viruses are
significantly more sensitive to neutralization by soluble CD4 and a
variety of antibodies. The same amino acid changes in the HIV-1 gp120
envelope glycoprotein determined CD4 independence and neutralization
sensitivity. The CD4-independent envelope glycoproteins exhibited
higher affinity for antibodies against CD4-induced gp120 epitopes but
not other neutralizing ligands. The CD4-independent envelope
glycoproteins did not exhibit increased lability relative to the
wild-type envelope glycoproteins. The utilization of two receptors
apparently allows HIV-1 to maintain a more neutralization-resistant
state prior to engaging CD4 on the target cell, explaining the rarity
of CD4 independence in wild-type HIV-1.
 |
INTRODUCTION |
Human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2) are the etiologic agents of AIDS in humans
(6, 15, 34), and related simian immunodeficiency viruses
(SIVs) can cause AIDS-like illness in monkeys (22, 40,
49). AIDS is associated with the depletion of CD4-positive T
lymphocytes, which are the major target cells of viral infection in
vivo (30).
The entry of primate immunodeficiency viruses into target cells is
mediated by the viral envelope glycoproteins, gp120 and gp41, which are
organized into trimeric complexes on the virion surface (2, 11,
68, 86). Viral entry usually requires the binding of the
exterior envelope glycoprotein, gp120, to the primary receptor CD4
(18, 42, 51). The gp120 glycoprotein is heavily
glycosylated and contains protruding variable loops (48),
features that are thought to decrease the susceptibility of the virus
to host immune responses (88, 91). The interaction between
gp120 and CD4 promotes a series of conformational changes in gp120 that
result in the formation or exposure of a binding site for particular
members of the chemokine receptor family that serve as coreceptors
(85, 91). The chemokine receptor CCR5 is the major
coreceptor for primary HIV-1 isolates (1, 13, 21, 23, 24)
and can be utilized by HIV-2 and SIV isolates as well (12,
52). Some HIV-1 isolates use the CXCR4 chemokine receptor as a
coreceptor (31). Binding of gp120 to the coreceptor is
thought to induce additional conformational changes that lead to
activation of the transmembrane glycoprotein gp41 and subsequent fusion
of the viral and cellular membranes (10, 79, 86).
The study of receptor binding for the primate immunodeficiency viruses
has been facilitated by the creation of soluble forms of the CD4
glycoprotein (sCD4) (20, 32, 38, 75, 84). In addition to
anchoring and orienting the viral envelope glycoproteins with respect
to the target cell membrane, binding to CD4 initiates changes in the
conformation of the envelope glycoproteins (3, 4, 19, 26, 70, 71,
74, 81, 83, 87, 93). Some of these conformational changes allow
high-affinity interaction with CCR5 (85, 91). The
CD4-induced movement of the V1/V2 loops results in the exposure of
conserved, discontinuous structures on the HIV-1 gp120 glycoprotein
recognized by the 17b and 48d monoclonal antibodies (83,
93). The 17b and 48d epitopes are proximal to a gp120 region
implicated in chemokine receptor binding (46, 64, 94). A
plausible model based on current structural and mutagenic data
(46, 93, 94), is that CD4 binding repositions the V1/V2
stem, allowing formation of an antiparallel
sheet that contributes
to the 17b and 48d epitopes and to chemokine receptor binding. Other
gp120 elements such as the third variable (V3) loop also contribute to
interaction with the chemokine receptor (7, 13, 16, 78).
Infection by primate immunodeficiency viruses is generally more
efficient when CD4 is expressed on the surface of the target cells.
However, some viral isolates are able to achieve reasonably efficient
infection of cells lacking CD4. For example, some HIV-2 isolates have
been shown to enter CD4-negative cells by using CXCR4 (14,
28). Some SIV strains can infect CD4-negative brain capillary
endothelial cells or other cell types by using CCR5 as a primary
receptor (27, 70). The gp120 glycoproteins of some SIV
isolates can efficiently bind rhesus monkey CCR5 in the absence of sCD4
(53). Naturally occurring, CD4-independent HIV-1 isolates
appear to be rare, but CXCR4-using HIV-1 isolates have been derived by
passage on CD4-negative cultured cells (25, 37, 47). We
have previously derived a CD4-independent variant of the HIV-1 ADA
strain that utilizes the CCR5 coreceptor and demonstrated that changes
in the gp120 V2 loop and/or V1/V2 stem region were responsible for both
CD4-independent entry into cells and gp120 binding to CCR5 in the
absence of CD4 (43). Recently, we have shown that the
removal of a single N-linked glycosylation site in the gp120 V1/V2 stem
is sufficient for CD4 independence (43a).
The small number of changes required in the wild-type HIV-1 envelope
glycoproteins to achieve CD4 independence contrasts with the rarity
with which CD4-independent HIV-1 apparently arise in vivo. One
explanation is that CD4 independence is associated with negative
consequences that are operative in vivo but not in the tissue culture
settings in which CD4-independent HIV-1 isolates have been selected.
One such property is viral susceptibility to host immune responses.
Here we test the hypothesis that CD4-independent HIV-1 variants exhibit
altered sensitivity to neutralization by antibodies compared with the
parental wild-type virus, which is CD4 dependent.
 |
MATERIALS AND METHODS |
Cell lines.
HeLa, 293T, and Cf2Th cells were obtained from
the American Type Culture Collection and maintained as previously
described (13). Cf2Th cells expressing human CCR5
(Cf2Th-CCR5) were generated and maintained in medium containing G418
(0.6 mg/ml) as previously described (57). Cf2Th-CD4/CCR5
cells, which express both human CD4 and human CCR5, were generated and
maintained in medium containing G418 (0.6 mg/ml) and hygromycin (0.15 mg/ml) as previously described (29).
Site-directed mutagenesis.
All mutagenesis was done using
the Stratagene QuikChange protocol as previously described
(43). To generate the C-terminally deleted HIV-1 envelope
glycoproteins used for antibody binding, gp120 shedding, and syncytium
formation assays, the primer ActXba (5'-CTATAGTGAATAGAGTTAGGCAGTGATCTAGACCATTATCGTTTCAGACCCACC -3') was used to introduce a stop codon at position 711 in the
intracellular region of the gp41 glycoprotein. HIV-1 envelope
glycoprotein residues are numbered according to the sequence of the
prototypic HXBc2 isolate, as currently recommended (45).
Antibody binding to cell surface envelope glycoproteins.
Antibody binding to 293T cells expressing cytoplasmic tail-deficient
envelope glycoproteins was measured by fluorescence-activated cell
sorting (FACS). A serum mixture from HIV-1-infected individuals was
used at a 1:200 dilution in Dulbecco modified Eagle medium (DMEM) with
0.2% azide (DMEM-azide) as a control.
For FACS analysis, 0.5 × 106 to 1.0 × 106 cells were resuspended in DMEM-azide containing
different concentrations of an anti-gp120 monoclonal antibody. After 60 min of incubation at 37°C, cells were washed twice with DMEM-azide,
resuspended in DMEM-azide containing a 1:200 dilution of
phycoerythrin-conjugated goat anti-human antibody, and incubated at
37°C for another 60 min. Cells were then washed twice with FACS
buffer (2% fetal bovine serum plus 0.2% azide in phosphate-buffered
saline [PBS]) and resuspended in PBS-2% formaldehyde before being
analyzed by FACS. As a control, mock-transfected 293T cells were
stained with primary and secondary antibodies. As an additional
control, env-transfected 293T cells were stained with
secondary antibody only.
Immunoprecipitations.
Approximately 40-µl aliquots of
protein A-Sepharose beads resuspended in 1× PBS (50% of bead volume)
were added to cell supernatants containing radiolabeled gp120
glycoproteins together with the indicated amounts of human anti-gp120
antibodies or a sCD4-immunoglobulin (Ig) fusion protein (CD4-lg). The
mixture was incubated by rocking for 24 h at room temperature.
Beads were washed four times with a solution containing 150 mM NaCl, 10 mM Tris-HCl (pH 7.5), and 0.5% detergent NP-40. Beads were resuspended
in 40 µl of 2× sodium dodecyl sulfate (SDS) sample buffer, boiled,
and centrifuged briefly. The samples were analyzed under denaturing
conditions on an SDS-10% polyacrylamide gel followed by autoradiography.
CCR5 binding assay.
The binding of radiolabeled gp120 to
Cf2Th-CCR5 cells was assayed as previously described (43)
at 4°C and 37°C.
Virus entry and neutralization assay.
Recombinant reporter
viruses (38) were generated by transfecting 293T cells
with 2 µg of an env-expressing pSVIIIenv plasmid, 5 µg
of a packaging plasmid, and 15 µg of a vector plasmid expressing firefly luciferase, using the calcium phosphate method. Seventy-two hours after transfection, the virus-containing supernatant was harvested and cleared by low-speed centrifugation. The virus in the
supernatant was quantitated by measuring reverse transcriptase (RT) as
described elsewhere (36).
Target cells were seeded at a density of 6,000 cells/well in 96-well,
luminometer-compatible tissue culture plates (Dynex).
Twenty-four hours
later, 20,000 RT units of virus were preincubated
with various
concentrations of anti-envelope glycoprotein antibody
or ligand in a
volume of 50 µl of medium for 1 h at 37°C. The
medium was
removed from the wells containing the target cells,
and 20,000 RT units
of virus were added to the cells. In the case
of the receptor-directed
antibodies OKT4a and 2D7, the antibodies
were added to the target cells
in a 50-µl volume for 1 h at 37°C
prior to addition of 20,000 RT units of virus. After 8 h of virus-cell
incubation, the wells
were washed with DMEM and fresh medium (200
µl) was added.
Seventy-two hours after infection, the medium was
removed from each
well and the cells were lysed by agitation in
20 µl of lysis buffer.
Luciferase activity was measured using
an EG&G Berthold Microplate
Luminometer LB 96V in accordance with
the Promega "Luciferase Assay
System Technical
Bulletin."
Syncytium inhibition assay.
Cf2Th-CCR5/CD4 cells were
cultured in 96-well tissue culture plates at a density of 2 × 104 cells/well. Twenty-four hours later, 3 × 104 envelope glycoprotein-expressing 293T cells were added
to the Cf2Th-CCR5/CD4 cells. The 293T cells had been transfected
48 h earlier with 18 µg of a plasmid expressing HIV-1 envelope
glycoproteins with cytoplasmic tail deletions and 2 µg of a
Tat-expressing plasmid. After 24 h of cocultivation at 37°C, syncytia
were counted. For testing antibodies or sCD4 for the ability to inhibit
syncytium formation, the 293T cells expressing the envelope
glycoproteins were preincubated with various concentrations of antibody
or sCD4 for 1 h at 37°C prior to addition to the 96-well plate.
gp120 shedding assay.
Approximately 5 × 106 293T cells were transfected with 18 µg of a plasmid
expressing the HIV-1 envelope glycoprotein with cytoplasmic tail
deletions and 2 µg of a Tat-expressing plasmid. After 24 h,
cells were replated into six-well plates at a density of
106 cells/well and radiolabeled with
[35S]methionine-cysteine overnight. The labeling medium
was then replaced with medium alone or with medium containing sCD4 (30 µg/ml) or 17b antibody (10 µg/ml). The cells were incubated at 37°C for 2 h with gentle rocking. The medium was harvested, and shed
gp120 was precipitated by the C11 anti-gp120 antibody and protein
A-Sepharose beads. Samples were analyzed by SDS-polyacrylamide gel
electrophoresis and a phosphorimager.
 |
RESULTS |
Relative sensitivities of CD4-independent viruses to
neutralization.
The HIV-1 envelope glycoproteins used in this
study are shown in Fig. 1. In the initial
experiments investigating neutralization sensitivity, we used the
wild-type envelope glycoproteins derived from the ADA R5 primary HIV-1
isolate and the 197 N/K and 190 S/R-197 N/S CD4-independent variants
(43). The single amino acid change in the 197 N/K gp120
envelope glycoprotein, relative to the wild-type ADA envelope
glycoprotein, results in a loss of the N-linked glycosylation site at
position 197 in the V1/V2 stem. In the 190 S/R-197 N/S glycoprotein,
the serine-to-arginine change at position 190 results in a loss of an
N-linked glycosylation site at asparagine 188 in the V2 variable loop,
and the asparagine-to-serine change at residue 197 results in an
N-terminal shift of the glycosylation site at position 197. These
envelope glycoproteins were used to pseudotype recombinant HIV-1
variants expressing luciferase. The viruses were tested for sensitivity
to neutralization by a panel of monoclonal antibodies and sCD4, using
both CD4-expressing and CD4-negative target cells. Table
1 reports the concentrations of
antibodies or sCD4 required to neutralize 50% of the infectivity of
viruses pseudotyped with the ADA envelope glycoprotein variants (IC50). Many of the antibodies did not neutralize viruses
with the wild-type ADA envelope glycoproteins at the concentrations tested, consistent with the relative degree of neutralization resistance expected for primary HIV-1 isolates (9, 80).
The viruses with the wild-type ADA envelope glycoproteins were
neutralized by lgG1b12, an unusually potent neutralizing antibody
directed against the CD4-binding site of gp120 (9), by the
2F5 anti-gp41 antibody, which also exhibits reasonable potency against
primary HIV-1 isolates (63), and by sCD4. Infection of
CD4-expressing target cells by viruses with the 190 S/R-197 N/S and 197 N/K envelope glycoproteins was neutralized more efficiently by most of
the antibodies tested compared with infection mediated by the wild-type ADA glycoproteins. One exception was the neutralization of viruses with
the 190 S/R-197 N/S envelope glycoproteins by the lgG1b12 antibody.
This probably results from partial disruption of the lgG1b12 epitope by
the addition of carbohydrate to asparagine 195, based on the results of
mutagenic analysis. For example, lgG1b12 was able to immunoprecipitate
and neutralize envelope glycoproteins with the 197 N/Q change but not
the 197 N/S change, regardless of the residue (serine or arginine) at
position 190 (data not shown). The effect of V2 loop changes on the
integrity of the lgG1b12 epitope has been previously reported
(66). Viruses with the 197 N/K envelope glycoproteins were
more sensitive to sCD4 than viruses with the wild-type ADA envelope
glycoproteins. Viruses with the 190 S/R-197 N/S envelope glycoproteins
exhibited only a slight increase in sCD4 sensitivity relative to
wild-type viruses for infection of CD4-positive target cells. The
anti-CD4 antibody OKT4a inhibited the entry of all three viruses into
CD4-positive target cells. This is consistent with the observation that
CD4-independent viruses still utilize CD4 when it is available on
target cells and are able to infect such cells more efficiently than in
the absence of CD4 (43). At the highest concentration of
the 2D7 anti-CCR5 antibody used, infection of CD4-expressing cells was not significantly inhibited.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Linear sequence map of the HIV-1 ADA envelope
glycoproteins used in this study. The gp120 exterior glycoprotein
conserved regions (black bars) and variable regions (V1 to V5; white
bars) and the signal peptide (S) are depicted. The gp41 transmembrane
envelope glycoprotein is in grey, with the transmembrane region (T)
shown. The sequence of the wild-type ADA envelope glycoprotein in the
V1/V2 stem region is shown, with the sites of N-linked glycosylation
( )
indicated. The amino acid residues altered in the CD4-independent
variants are underlined and numbered according to the prototypic HXBc2
sequence (45). In the CD4-independent variants, altered
residues are indicated by asterisks.
|
|
The sensitivity of viruses with the 190 S/R-197 N/S and 197 N/K
envelope glycoproteins to neutralization was also examined
in target
cells lacking CD4. In general, CD4-independent infection
was extremely
sensitive to neutralization by antibodies directed
against the envelope
glycoproteins and against the CCR5 receptor.
One exception to this
generalization was the observation that
the lgG1b12 concentration
required to neutralize viruses with
the 190 S/R-197 N/S envelope
glycoproteins was comparable to that
required for neutralization of the
wild-type ADA viruses on CD4-expressing
target cells. Notably, sCD4
very efficiently inhibited infection
of CD4-negative cells by the
viruses with the 190 S/R-197 N/S
and 197 N/K envelope glycoproteins. As
expected, the anti-CD4
antibody OKT4a did not inhibit the infection of
CD4-negative cells
by these
viruses.
In summary, infection of both CD4-expressing and CD4-negative target
cells by viruses with envelope glycoproteins capable
of CD4-independent
entry was neutralized by antibodies directed
against gp120 and gp41
more effectively than infection by viruses
with the wild-type ADA
envelope glycoproteins. Modest or dramatic
increases in sensitivity to
sCD4 were also observed for the CD4-independent
viruses relative to the
wild-type viruses. Finally, the CCR5-directed
antibody neutralized the
infection of CD4-negative target cells
by CD4-independent viruses more
efficiently than infection of
CD4-expressing target cells by the same
viruses.
Other gp120 changes associated with CD4 independence result in
neutralization sensitivity.
Recently, changes in the V1/V2
stem-loop sequences of the ADA gp120 glycoprotein necessary and
sufficient for CD4 independence have been investigated
(43a). These studies demonstrated that loss or movement of
the N-linked carbohydrate on asparagine 197 resulted in CD4-independent
CCR5 binding and infection. Moreover, complete removal of the V1/V2
loops from the ADA gp120 glycoprotein resulted in similar
CD4-independent phenotypes. To examine whether CD4 independence per se
was associated with sensitivity to neutralization, we tested the
abilities of antibodies and sCD4 to inhibit virus infection mediated by
the CD4-independent ADA envelope glycoprotein variants created in the
aforementioned study (43a). The 197 N/S variant, in which
the wild-type glycosylation at asparagine 197 is shifted to asparagine
195 (Fig. 1), supports CD4-independent infection. The results in Tables
2 and 3
demonstrate that viruses with the 197 N/S envelope glycoproteins are
more sensitive to neutralization by the F105, 17b, 48d, and 2F5
antibodies than viruses with the wild-type ADA envelope glycoproteins.
Likewise, increased sensitivity to antibody neutralization was observed for viruses with the
V1/2 envelope glycoproteins, which lack the
gp120 V1 and V2 variable loops and support CD4-independent infection
(43a). By contrast, viruses with the 190 S/R envelope glycoproteins, which retain the carbohydrate at asparagine 197 (Fig. 1)
and are dependent upon CD4 for entry (43a), were resistant to neutralization by the F105 and 17b antibodies (Table 2). Thus, for
the panel of ADA gp120 variants examined, there is a strong correlation
between the ability to mediate the infection of cells lacking CD4 and
neutralization sensitivity.
Syncytium inhibition.
Cells expressing the HIV-1 envelope
glycoproteins can fuse with adjacent, receptor-bearing cells to form
multinucleated syncytia (50, 76). We examined the
sensitivity of syncytium formation mediated by the wild-type ADA and
CD4-independent 190 S/R-197 N/S envelope glycoproteins to inhibition by
antibodies and sCD4. To increase the cell surface expression of these
envelope glycoproteins (72), variant glycoproteins lacking
the gp41 cytoplasmic tail were used in the experiments. The ADA and 190 S/R-197 N/S glycoproteins induced comparable levels of syncytia
following cocultivation of envelope glycoprotein-expressing cells and
Cf2Th cells expressing CD4 and CCR5 (Fig.
2). Syncytium formation mediated by the
wild-type ADA envelope glycoproteins was minimally inhibited by sCD4 or the antibodies tested. Syncytium formation mediated by the 190 S/R-197
N/S envelope glycoproteins exhibited greater sensitivity to
antibody neutralization and demonstrated some decrease at the highest
sCD4 concentration tested. The concentrations of antibody or sCD4
required to achieve 50% inhibition of cell-cell fusion were much
greater than that required to inhibit virus entry to a similar degree.
These results indicate that the function of the 190 S/R-197 N/S
glycoproteins expressed on the cell surface is inhibited by some
antibodies more efficiently than that of the wild-type ADA envelope
glycoproteins.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Inhibition of syncytium formation by gp120 ligands. 293T
cells expressing either the wild-type ADA ( ) or 190 S/R-197 N/S
( ) envelope glycoproteins were preincubated with the indicated
concentrations of sCD4 or the F105, 19b, or 17b antibody and then
cocultivated with Cf2Th-CCR5/CD4 cells. Syncytia were scored after 24 h. The leftmost point of each curve indicates the number of syncytia
observed in the absence of added ligand. Representative results of two
independent experiments are shown.
|
|
Affinity of ligands for the envelope glycoproteins.
One
explanation for the increased relative neutralization sensitivity
observed for the CD4-independent viruses is an increase in the affinity
of their envelope glycoproteins for antibodies and sCD4. We measured
the relative affinities of these ligands for the monomeric gp120
glycoproteins and for the trimeric envelope glycoprotein complexes of
the wild-type ADA and 190 S/R-197 N/S variants.
Radiolabeled ADA and 190 S/R-197 N/S gp120 glycoproteins were
precipitated by different concentrations (0.01 to 50 µg/ml)
of the
F105 and 17b antibodies and by CD4-Ig. The estimated dissociation
constants of these ligands for the wild-type ADA and 190 S/R-197
N/S
gp120 glycoproteins were similar, in the range of 3 × 10
8 to 5 × 10
8 M (data not
shown).
The binding of ligands to functional, trimeric envelope glycoproteins
on the surface of cells expressing the wild-type ADA
and 190 S/R-197
N/S variants was measured. A range of concentrations
of primary
antibodies was used to allow differences in antibody
affinity for the
two envelope glycoproteins to be detected. Comparable
levels of surface
expression of the wild-type ADA and 190 S/R-197
N/S glycoproteins were
verified by staining with the pooled sera
from HIV-1-infected
individuals (data not shown). Mock-transfected
cells were used as
negative controls for each antibody, and this
background fluorescence
was subtracted from the values for cells
expressing the envelope
glycoproteins. The 17b and 48d antibodies
both exhibited a higher
affinity for the 190 S/R-197 N/S glycoprotein
complexes than for the
wild-type ADA glycoproteins (Fig.
3A and
B). By contrast, CD4-Ig and the F105 and
15e antibodies bound
the wild-type ADA glycoproteins at least as well
as the 190 S/R-197
N/S glycoproteins (Fig.
3C to E).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of antibodies to envelope glycoproteins on
the cell surface. 293T cells expressing cytoplasmic tail-deficient
versions of the wild-type (w.t.) ADA or 190 S/R-197 N/S envelope
glycoproteins, or mock-transfected control cells, were incubated with
the 48d antibody (A), the 17b antibody (B), the CD4-Ig protein (C), the
F105 antibody (D), or the 15e antibody (E). In parallel, cells were
incubated with a 1:200 dilution of pooled sera from HIV-1-positive
individuals to determine the relative abundance of the two envelope
glycoproteins on the cell surface. After incubation with a
phycoerythrin-conjugated secondary antibody, the cells were washed and
sorted by FACS. Background binding for each ligand was determined by
using mock-transfected cells. The mean fluorescence intensity for each
sample is indicated, after subtraction of background and normalization
for relative envelope glycoprotein expression.
|
|
The results of the binding assays suggest that increases in ligand
affinity may account for the increased sensitivity of the
CD4-independent envelope glycoproteins to inhibition by some
antibodies,
such as those directed against CD4-induced gp120 epitopes,
but
not
others.
Induction of gp120 shedding by ligands.
Although the
physiological significance is unclear, it is well documented that the
gp120 glycoprotein can be induced to shed from the HIV-1 envelope
glycoprotein complex by sCD4 binding (8, 33, 35, 41, 58-60, 82,
89). Differential susceptibility of the wild-type ADA and 190 S/R-197 N/S envelope glycoproteins to gp120 shedding after ligand
binding could potentially contribute to differences in neutralization
sensitivity. To test this hypothesis, cells expressing the two
glycoproteins, along with cells expressing an X4 HIV-1 envelope
glycoprotein (HXBc2), were radiolabeled, and the amount of gp120
present in the cell supernatants in the absence or presence of ligands
was evaluated. The amounts of gp120 spontaneously shed into the
supernatants were equivalent for the wild-type ADA and 190 S/R-197 N/S
envelope glycoproteins (Fig. 4). Slightly
more gp120 glycoprotein was present in the supernatants of untreated
cells expressing the HXBc2 envelope glycoproteins. Treatment of the
envelope glycoprotein-expressing cells with sCD4 resulted in an
increase in the amount of supernatant gp120 for all three envelope
glycoproteins. Slightly more gp120 was present in the supernatants of
cells expressing the wild-type ADA envelope glycoproteins than was seen
for cells expressing the 190 S/R-197 N/S envelope glycoproteins.
Treatment of cells with the 17b antibody did not result in higher
levels of gp120 in the cell supernatants than were observed in
untreated cells. These results argue against an increase in the
relative sensitivity of the CD4-independent envelope glycoproteins to
gp120 shedding following ligand binding.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 4.
Ligand-induced shedding of gp120. Radiolabeled cells
expressing cytoplasmic tail-deficient versions of the wild-type HXBc2
envelope glycoproteins were incubated in the absence of ligand (No
treatment), with sCD4 (30 µg/ml), or with 17b antibody (10 µg/ml).
The gp120 glycoproteins present in the supernatants were measured by
precipitation with a mixture of sera from HIV-1-infected individuals.
The experiment was performed twice with similar results.
|
|
Inhibition of CCR5 binding.
We tested
whether the 17b antibody could differentially neutralize the ability of
wild-type ADA and CD4-independent gp120 glycoproteins to bind CCR5,
both in the presence and in the absence of sCD4 (Fig.
5). The gp120 glycoproteins of the
wild-type ADA and the two CD4-independent variants (190 S/R-197 N/S and
197 N/K) were preincubated with or without sCD4. Following incubation in the presence of various concentrations of the 17b antibody, the
mixtures were added to Cf2Th-CCR5 cells. Binding of all three gp120
glycoproteins to Cf2Th-CCR5 cells, both in the presence and in the
absence of sCD4, was inhibited ~20% by 0.3 µg of 17b per ml
relative to control binding in the absence of antibody. At a
concentration of 3.0 µg/ml, the 17b antibody almost completely inhibited the binding of the different gp120 molecules to CCR5, regardless of the presence of sCD4. Thus, little difference in the
sensitivity of inhibition of CCR5 binding by the 17b antibody was
observed among the three envelope glycoproteins.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition of gp120-CCR5 binding. The wild-type ADA or
variant gp120 glycoproteins were incubated with the indicated
concentrations of the 17b antibody in the absence ( ) or presence (+)
of sCD4 (10 µg/ml). The mixtures were added to Cf2Th-CCR5 cells, and
the bound gp120 was quantitated by precipitation by a mixture of sera
from HIV-1-infected individuals. The amount of bound gp120 is
indicated, using an arbitrary scale. The experiment was performed twice
with comparable results.
|
|
 |
DISCUSSION |
We have shown that for the HIV-1 ADA envelope
glycoproteins, changes that allow CD4-independent virus entry
into cells also confer increased sensitivity to neutralization by sCD4
and antibodies. Virus entry into CD4-positive and CD4-negative cells
and syncytium formation mediated by CD4-independent envelope
glycoproteins were inhibited at concentrations of sCD4 and antibodies
significantly lower than those required to inhibit the function of
CD4-dependent envelope glycoproteins. The observation that all of the
gp120 changes associated with CD4 independence, including single amino acid substitutions and complete deletion of the V1/2 variable loops,
also were sufficient to specify an increase in neutralization sensitivity argues that these two properties of the envelope
glycoproteins are tightly linked. It may be that an increase in
neutralization sensitivity is a necessary consequence of CD4
independence. This predicts that the evolution of CD4-independent HIV-1
variants would not be favored under circumstances, such as in vivo
infection, where envelope glycoprotein-directed antibodies are present.
The utilization of the CXCR4 chemokine receptor as the sole receptor
for feline immunodeficiency viruses (88) and the ability of naturally occurring SIVs to achieve a measure of CD4-independent infection (27, 53, 59) suggest a model in which chemokine receptors or related molecules represent the primordial receptors for
the mammalian immunodeficiency viruses. The evolution of the primate
immunodeficiency viruses toward greater dependence on CD4 not only
would target virus infection to helper T cells that are critical for
antiviral immune responses (69) but would allow the
creation of a relatively neutralization-resistant conformation in the
viral envelope glycoprotein complex. Primate immunodeficiency virus
variants have been identified along this continuum of CD4 independence
and neutralization sensitivity. Macrophagetropic SIV strains can
utilize low levels of CD4 on the target cell for entry and also exhibit
some degree of CD4 independence (5, 27, 74). These SIV
strains are typically easier to neutralize than T-cell-tropic SIV
isolates such as SIVmac239 (56), which require higher
levels of target cell CD4 and exhibit little or no CD4 independence
(5, 74). In the absence of specific passage on
CD4-negative cells, most HIV-1 isolates remain dependent on CD4 to some
extent. However, tissue culture passage of primary HIV-1 isolates often
generates viruses that are capable of entering cells expressing lower
levels of CD4 (5, 39, 65) and that are neutralized more
readily by sCD4 and antibodies (17, 54, 55, 61, 62, 73, 80, 90,
95). In all of these instances, there is a direct relationship
between the degree of CD4 independence and neutralization sensitivity.
Virus attachment to target cell CD4 serves as a trigger to change the
conformation of the HIV-1 envelope glycoproteins to a state that is
competent for chemokine receptor binding. The changes that CD4 induces
in free gp120 to achieve the CD4-bound conformation include movement of
the V2 variable loop, which has been shown to mask the chemokine
receptor-binding site in the native gp120 glycoprotein
(93). Recently, the loss of glycosylation of asparagine
197 in the ADA gp120 glycoprotein has been shown to effect CD4
independence by allowing increased flexibility of the V1/2 loops and a
spontaneous exposure of the CCR5-binding region (43a).
Concomitantly, an increase in the exposure of the CD4-induced epitopes,
which are near the CCR5-binding site, occurs (Fig. 3)
(43a). Similar phenotypes were associated with
deglycosylation of asparagine 197 and complete removal of the V1/2
loops with respect to CD4 independence, exposure of the CD4-induced
gp120 epitopes, and neutralization sensitivity. The ability of these mutants to bind CCR5 in the absence of CD4 suggests that they spontaneously sample the gp120 conformation competent for chemokine receptor binding. Our results suggest that this conformation, which
presumably resembles that induced in the wild-type gp120 by CD4
binding, is potentially more susceptible to neutralization by envelope
glycoprotein-directed ligands. Such ligands during natural infection
are predominantly or exclusively antibodies; steric hindrance limits
their binding to envelope glycoprotein-CD4 complexes in the virus-cell
interface (46, 81, 94). Subneutralizing concentrations of
sCD4, when preincubated with primary HIV-1, induce dramatic increases
in sensitivity to neutralization by some antibodies against the gp120
glycoprotein (81). This observation is consistent with a
model in which the CD4-triggered envelope glycoprotein conformation,
which is competent for chemokine receptor binding, is more vulnerable
to neutralizing antibodies.
The precise mechanism that leads to increased neutralization
sensitivity in the CD4-independent envelope glycoproteins is unclear.
Neutralization sensitivity is not merely a consequence of the relative
inefficiency of infection of CD4-negative cells, because
CD4-independent viruses are also more sensitive to neutralization when
infecting CD4-positive target cells, an efficient process. The
increased susceptibility of the CD4-independent viruses to the 17b and
48d antibodies could be explained at least in part by the increased
exposure of these epitopes on these viruses. Another CD4-independent
HIV-1 isolate generated on CXCR4-expressing cells has been shown to
exhibit a greater spontaneous exposure of the 17b epitope and a greater
sensitivity to neutralization by this antibody (37).
Spontaneous exposure of gp120 regions near the chemokine
receptor-binding site may be a common feature of CD4-independent HIV-1 variants.
For sCD4 and antibodies other than the CD4-induced antibodies,
increased binding of the ligand to oligomeric envelope glycoprotein complexes did not appear to explain the enhanced neutralization sensitivity of the CD4-independent viruses. An alternative explanation is that the wild-type ADA envelope glycoprotein trimers require saturation by antibodies for neutralization (64), whereas
the CD4-independent envelope glycoprotein complexes can be neutralized by subsaturating antibody concentrations. The exposure of the chemokine
receptor-binding site may result in a metastable state vulnerable to
the binding of any ligand, which triggers an irreversible functional
inactivation. Some of these conformational transitions may relate to
those proposed to occur in the gp41 glycoprotein in response to
chemokine receptor binding (10, 86). The observation that
sCD4 dramatically inhibits the infection of CD4-negative cells by the
190 S/R-197 N/S and 197 N/K CD4-independent viruses, yet stimulates the
binding of the gp120 glycoproteins of these viruses to CCR5, supports
the notion that steps in the entry process that occur after chemokine
receptor binding may be particularly prone to disruption by ligand
binding in these viruses. Such disruption may be time dependent,
explaining why the binding of CD4 on the target cell enhances infection
by the CD4-independent viruses when sCD4 incubation with these viruses
is inhibitory.
The influence of antibodies directed against the CD4 and CCR5 receptors
on infection by the wild-type and CD4-independent viruses provides some
insight into the relative contribution of receptor density to the entry
of these viruses. Infection of CD4-positive target cells by the 190 S/R-197 N/S and 197 N/K viruses is more efficient than infection of
CD4-negative target cells, indicating that these viruses still can
utilize cell surface CD4 to assist in the virus entry process. For
CD4-positive target cells, CD4-independent viruses and the wild-type
ADA virus exhibited roughly similar dependence upon CD4, as evidenced
by comparable sensitivity to inhibition by the OKT4a anti-CD4 antibody.
For CD4-negative target cells, CCR5 concentration is critical to
successful infection by the CD4-independent viruses, as suggested by
the potent inhibition by the 2D7 anti-CCR5 antibody.
As discussed above, primate immunodeficiency viruses that exhibit
decreased dependence on CD4 for infection may share features such as
the spontaneous exposure of the chemokine receptor-binding site and an
increase in sensitivity to some neutralizing ligands. However, because
the structural elements that govern CD4 independence exhibit
variability among virus isolates, the details of the structure-function relationships are expected to differ among particular HIV-1 strains. For example, removal of the carbohydrate on asparagine 197 or deletion
of the V1/2 variable loops in some HIV-1 isolates other than ADA
results in no or only modest increases in CD4-independent chemokine
receptor binding and virus infection (10, 66, 91, 92; P. Kolchinsky and J. Sodroski, unpublished observations). The various
HIV-1 isolates that have deletions of the V1/2 variable loops exhibit
increased sensitivity to different subsets of neutralizing antibodies
compared with the wild-type virus counterparts (10, 78).
Further investigation of several examples of CD4-independent viruses
should allow an improved understanding of the different ways in which
the V1/2 and V3 variable loops and associated carbohydrate interact
within the envelope glycoprotein oligomers of multiple isolates.
 |
ACKNOWLEDGMENTS |
We thank Marshall Posner, James Robinson, Dennis Burton, Herman
Katinger, and Lijun Wu for antibodies and Tajib Mirzabekov and Mark
Cayabyab for cell lines. We thank Yvette McLaughlin and Sheri Farnum
for manuscript preparation.
This work was supported by National Institutes of Health grants
AI24755, AI31783, and AI41851 and by Center for AIDS Research grant
AI28691. Additional support was provided by the G. Harold and Leila Y. Mathers Foundation, the late William F. McCarty-Cooper, Friends 10, and
Douglas and Judith Krupp.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cancer Immunology and AIDS, Dana-Farber Cancer Institute, 44 Binney
St., JFB 824, Boston, MA 02115. Phone: (617) 632-3371. Fax: (617)
632-4338. E-mail: joseph_sodroski{at}dfci.harvard.edu.
 |
REFERENCES |
| 1.
|
Alkhatib, G.,
C. Combadiere,
C. C. Broder,
Y. Feng,
P. E. Kennedy,
P. M. Murphy, and E. A. Berger.
1996.
CC-CKR5: a RANTES, MIP-1a, MIP-1b receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 2.
|
Allan, J.,
J. Coligan,
F. Barin,
M. F. McLane,
J. Sodroski,
C. Rosen,
W. Haseltine,
T. H. Lee, and M. Essex.
1985.
Major glycoprotein antigens that induce antibodies in AIDS patients are encoded by HTLV-III.
Science
228:1091-1094[Abstract/Free Full Text].
|
| 3.
|
Allan, J. S.
1991.
Receptor-mediated activation of immunodeficiency viruses in viral fusion.
Science
252:1322-1323[Free Full Text].
|
| 4.
|
Allan, J. S.,
J. Strauss, and D. W. Buck.
1990.
Enhancement of SIV infection with soluble receptor molecules.
Science
247:1084-1088[Abstract/Free Full Text].
|
| 5.
|
Bannert, N.,
D. Schenten,
S. Craig, and J. Sodroski.
2000.
The level of CD4 expression limits the infection of primary rhesus monkey macrophages by a T-tropic simian immunodeficiency virus and macrophagetropic human immunodeficiency viruses.
J. Virol.
74:10984-10993[Abstract/Free Full Text].
|
| 6.
|
Barre-Sinoussi, F.,
J. C. Chermann,
F. Rey,
M. T. Nugeyre,
S. Chamaret,
J. Gruest,
C. Daguet,
C. Axler-Bin,
F. Vezinet-Brun,
C. Rouzioux,
W. Rozenbaum, and L. Montagnier.
1983.
Isolation of a T-lymphocyte retrovirus from a patient at risk for acquired immunodeficiency syndrome (AIDS).
Science
220:868-871[Abstract/Free Full Text].
|
| 7.
|
Bieniasz, P. D.,
R. Fridell,
I. Aramori,
S. Ferguson,
M. Caron, and B. Cullen.
1997.
HIV-1-induced cell fusion is mediated by multiple regions within both the viral envelope and the CCR5 co-receptor.
EMBO J.
16:2599-2609[CrossRef][Medline].
|
| 8.
|
Bugelski, P. J.,
H. Ellens,
T. K. Hart, and R. L. Kirsh.
1991.
Soluble CD4 and dextran sulfate mediate release of gp120 from HIV-1: implications for clinical trials.
J. Acquir. Immune Defic. Syndr.
4:923-924.
|
| 9.
|
Burton, D. R.,
J. Pyati,
R. Koduri,
S. J. Sharp,
G. B. Thornton,
P. W. H. I. Parren,
L. S. W. Sawyer,
R. M. Hendry,
N. Dunlop,
P. L. Nara,
M. Lamacchia,
I. Garratty,
E. R. Stiehm,
Y. J. Bryson,
Y. Cao,
J. P. Moore,
D. D. Ho, and C. F. Barbas, III.
1994.
Efficient neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody.
Science
266:1024-1027[Abstract/Free Full Text].
|
| 10.
|
Cao, J.,
N. Sullivan,
E. Desjardins,
C. Parolin,
J. Robinson,
R. Wyatt, and J. Sodroski.
1997.
Replication and neutralization of human immunodeficiency virus type 1 lacking the V1/V2 variable loops of the gp120 envelope glycoprotein.
J. Virol.
71:9808-9812[Abstract].
|
| 11.
|
Chan, D. C.,
D. Fass,
J. M. Berger, and P. Kim.
1997.
Core structure of gp41 from HIV envelope glycoprotein.
Cell
73:263-273.
|
| 12.
|
Chen, Z.,
P. Zhou,
D. D. Ho,
N. Landau, and P. Marx.
1997.
Genetically divergent strains of simian immunodeficiency virus use CCR5 as cofactor for entry.
J. Virol.
71:2705-2714[Abstract].
|
| 13.
|
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P. D. Ponath,
L. Wu,
C. R. Mackay,
G. LaRosa,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1996.
The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135-1148[CrossRef][Medline].
|
| 14.
|
Clapham, P. R.,
A. McKnight, and R. A. Weiss.
1992.
Human immunodeficiency virus type 2 infection and fusion of CD4-negative human cell lines: induction and enhancement by soluble CD4.
J. Virol.
66:3531-3537[Abstract/Free Full Text].
|
| 15.
|
Clavel, F.
1987.
HIV-2, the West African AIDS virus.
AIDS
1:135-140[Medline].
|
| 16.
|
Cocchi, F.,
A. DeVico,
A. Garzino-Demo,
A. Cara,
R. C. Gallo, and P. Lusso.
1996.
The V3 domain of the HIV-1 gp120 envelope glycoprotein is critical for chemokine-mediated blockade of infection.
Nat. Med.
2:1244-1247[CrossRef][Medline].
|
| 17.
|
Daar, E. S.,
X. L. Li,
T. Moudgil, and D. D. Ho.
1990.
High concentrations of recombinant soluble CD4 are required to neutralize primary human immunodeficiency virus type 1 isolates.
Proc. Natl. Acad. Sci. USA
87:6574-6578[Abstract/Free Full Text].
|
| 18.
|
Dalgleish, A. G.,
P. C. L. Beverly,
P. R. Clapham,
D. H. Crawford,
M. F. Greaves, and R. A. Weiss.
1984.
The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus.
Nature
312:763-767[CrossRef][Medline].
|
| 19.
|
Denisova, G.,
D. Raviv,
I. Mondor,
Q. J. Sattentau, and J. M. Gershoni.
1997.
Conformational transitions in CD4 due to complexation with HIV-envelope glycoprotein gp120.
J. Immunol.
158:1157-1164[Abstract].
|
| 20.
|
Deen, K.,
J. S. McDougal,
R. Inacker,
G. Folena-Wasserman,
J. Arthos,
J. Rosenberg,
P. Maddon,
R. Axel, and R. Sweet.
1988.
A soluble form of CD4 (T4) protein inhibits AIDS virus infection.
Nature
331:82-84[CrossRef][Medline].
|
| 21.
|
Deng, H.,
R. Liu,
W. Ellmeier,
S. Choe,
D. Unutmaz,
M. Burkhart,
P. di Marzio,
S. Marmon,
R. E. Sutton,
C. M. Hill,
C. B. Davis,
S. C. Peiper,
T. J. Schall,
D. R. Littman, and N. R. Landau.
1996.
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661-666[CrossRef][Medline].
|
| 22.
|
Desrosiers, R. C.
1990.
The simian immunodeficiency viruses.
Annu. Rev. Immunol.
8:557-578[CrossRef][Medline].
|
| 23.
|
Doranz, B. J.,
J. Rucker,
Y. Yi,
R. J. Smyth,
M. Samson,
S. C. Peiper,
M. Permentier,
R. G. Collman, and R. W. Doms.
1996.
A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.
Cell
85:1149-1158[CrossRef][Medline].
|
| 24.
|
Dragic, T.,
V. Litwin,
G. P. Allaway,
S. R. Martin,
Y. Huang,
K. A. Nagashima,
C. Cayanan,
P. J. Maddon,
R. A. Koup,
J. P. Moore, and W. A. Paxton.
1996.
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5.
Nature
381:667-673[CrossRef][Medline].
|
| 25.
|
Dumonceaux, J.,
S. Nisole,
C. Chanel,
L. Quivet,
A. Amara,
F. Baleux,
P. Briand, and U. Hazan.
1998.
Spontaneous mutations in the env gene of the human immunodeficiency virus type 1 NDK isolate are associated with a CD4-independent phenotype.
J. Virol.
72:512-519[Abstract/Free Full Text].
|
| 26.
|
Ebenbichler, C.,
P. Westervelt,
A. Carrillo,
T. Henkel,
D. Johnson, and L. Ratner.
1993.
Structure-function relationships of the HIV-1 envelope V3 loop tropism determinant: evidence for two distinct conformations.
AIDS
7:639-646[Medline].
|
| 27.
|
Edinger, A. L.,
J. L. Mankowski,
B. J. Doranz,
B. J. Margulies,
B. Lee,
J. Rucker,
M. Sharron,
T. L. Hoffman,
J. F. Berson,
M. C. Zink,
V. M. Hirsch,
J. E. Clements, and R. W. Doms.
1997.
CD4-independent, CCR5-dependent infection of brain capillary endothelial cells by a neurovirulent simian immunodeficiency virus strain.
Proc. Natl. Acad. Sci. USA
94:14742-14747[Abstract/Free Full Text].
|
| 28.
|
Endres, M. J.,
P. R. Clapham,
M. Marsh,
M. Ahuja,
J. D. Turner,
A. McKnight,
J. F. Thomas,
B. Stoebenau-Haggarty,
S. Choe,
P. J. Vance,
T. N. Wells,
C. A. Power,
S. S. Sutterwala,
R. W. Doms,
N. R. Landau, and J. A. Hoxie.
1996.
CD4-independent infection by HIV-2 is mediated by fusin/CXCR4.
Cell
87:745-756[CrossRef][Medline].
|
| 29.
|
Farzan, M.,
T. Mirzabekov,
P. Kolchinsky,
R. Wyatt,
M. Cayabyab,
N. Gerard,
C. Gerard,
J. Sodroski, and H. Choe.
1999.
Tyrosine sulfation of the amino-terminus of CCR5 facilitates HIV-1 entry.
Cell
96:667-676[CrossRef][Medline].
|
| 30.
|
Fauci, A.,
A. Macher,
D. Longo,
H. C. Lane,
A. Rook,
H. Masur, and E. Gelmann.
1984.
Acquired immunodeficiency syndrome: epidemiologic, clinical, immunologic, and therapeutic considerations.
Ann. Intern. Med.
100:92-106.
|
| 31.
|
Feng, Y.,
R. A. Davey,
P. E. Kennedy, and E. A. Berger.
1996.
HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor.
Science
272:872-877[Abstract].
|
| 32.
|
Fisher, R.,
J. Bertonis,
W. Meier,
V. Johnson,
D. Costopoulos,
T. Liu,
R. Tizard,
B. Walder,
M. Hirsch,
R. Schooley, and R. Flavell.
1988.
HIV infection is blocked in vitro by recombinant soluble CD4.
Nature
331:76-78[CrossRef][Medline].
|
| 33.
|
Fu, Y. K.,
T. K. Hart,
Z. L. Jonak, and P. J. Bugelski.
1993.
Physicochemical dissociation of CD4-mediated syncytium formation and shedding of human immunodeficiency virus type 1 gp120.
J. Virol.
67:3818-3825[Abstract/Free Full Text].
|
| 34.
|
Gallo, R. C.,
S. Z. Salahuddin,
M. Popovic,
G. M. Shearer,
M. Kaplan,
B. F. Haynes,
T. J. Palker,
R. Redfield,
J. Oleske,
B. Safai,
G. White,
P. Foster, and P. D. Markham.
1984.
Frequent detection and isolation of cytopathic retroviruses (HTLV-III) from patients with AIDS and at risk for AIDS.
Science
224:500-503[Abstract/Free Full Text].
|
| 35.
|
Hart, T. K.,
R. Kirsh,
H. Ellens,
R. W. Sweet,
D. M. Lambert,
S. R. Petteway, Jr.,
J. Leary, and P. J. Bugelski.
1991.
Binding of soluble CD4 proteins to human immunodeficiency virus type 1 and infected cells induces release of envelope glycoprotein gp120.
Proc. Natl. Acad. Sci. USA
88:2189-2193[Abstract/Free Full Text].
|
| 36.
|
Helseth, E.,
M. Kowalski,
D. Gabuzda,
U. Olshevsky,
W. Haseltine, and J. Sodroski.
1990.
Rapid complementation assays measuring replicative potential of human immunodeficiency virus type 1 envelope glycoprotein mutants.
J. Virol.
64:2416-2420[Abstract/Free Full Text].
|
| 37.
|
Hoffman, T. L.,
C. C. LaBranche,
W. Zhang,
G. Canziani,
J. Robinson,
I. Chaiken,
J. A. Hoxie, and R. W. Doms.
1999.
Stable exposure of the coreceptor-binding site in a CD4-independent human immunodeficiency virus type 1 envelope protein.
J. Virol.
96:6359-6364.
|
| 38.
|
Hussey, R.,
N. Richardson,
M. Kowalski,
N. Brown,
H. Change,
R. Siliciano,
T. Dorfman,
B. Walker,
J. Sodroski, and E. Reinherz.
1988.
A soluble CD4 protein selectively inhibits HIV replication and syncytium formation.
Nature
331:78-81[CrossRef][Medline].
|
| 39.
|
Kabat, D.,
S. L. Kozak,
K. Wehrly, and B. Chesebro.
1994.
Differences in CD4 dependence for infectivity of laboratory-adapted and primary isolates of human immunodeficiency virus type 1.
J. Virol.
68:2570-2577[Abstract/Free Full Text].
|
| 40.
|
Kanki, P.,
M. McLane,
N. King, and M. Essex.
1985.
Serological identification and characterization of a macaque T-lymphotropic retrovirus closely related to HTLV-III.
Science
228:1199-1422[Abstract/Free Full Text].
|
| 41.
|
Kirsh, R.,
T. Hart,
H. Ellens,
J. Miller,
S. Petteway,
D. Lambert,
B. Leary, and P. Bugelski.
1990.
Morphometric analysis of recombinant soluble CD4-mediated release of the envelope glycoprotein gp120 from HIV-1.
AIDS Res. Hum. Retrovir.
6:1209-1212[Medline].
|
| 42.
|
Klatzmann, D.,
E. Champagne,
S. Charmaret,
J. Gruest,
D. Guetard,
T. Hercend,
J.-C. Glueckman, and L. Montagnier.
1984.
T-lymphocyte T4 molecule behaves as the receptor for human retrovirus LAV.
Nature
312:767-768[CrossRef][Medline].
|
| 43.
|
Kolchinsky, P.,
T. Mirzabekov,
M. Farzan,
E. Kiprilov,
M. Cayabyab,
L. J. Mooney,
H. Choe, and J. Sodroski.
1999.
Adaptation of a CCR5-using, primary human immunodeficiency virus type 1 isolate for CD4-independent replication.
J. Virol.
73:8120-8126[Abstract/Free Full Text].
|
| 43a.
| Kolchinsky, P., E. Kiprilov, P. Bartley, R. Rubinstein,
and J. Sodroski. Loss of a single N-linked glycan allows
CD4-independent human immunodeficiency virus type 1 infection by
altering the position of the gp120 V1/V2 variable loops. J. Virol., in
press.
|
| 44.
|
Korber, B.,
B. Foley,
T. Leitner,
F. McCutchan,
B. Hahn,
J. Mellors,
G. Myers, and C. Kuiken (ed.).
1997.
Human retroviruses and AIDS 1997.
Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 45.
|
Korber, B.,
B. Foley,
C. Kuiken,
S. Pillai, and J. Sodroski.
1998.
Human retroviruses and AIDS 1998.
Los Alamos National Laboratory, Los Alamos, N.Mexi.
|
| 46.
|
Kwong, P. D.,
R. Wyatt,
J. Robinson,
R. Sweet,
J. Sodroski, and W. Hendrickson.
1998.
Structure of an HIV-1 gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing antibody.
Nature
393:648-659[CrossRef][Medline].
|
| 47.
|
LaBranche, C.,
T. Hofmann,
J. Romano,
B. Haggarty,
T. Edwards,
T. Matthews,
R. Doms, and J. Hoxie.
1999.
Determinants of CD4 independence for a human immunodeficiency virus type 1 variant map outside regions for coreceptor specificity.
J. Virol.
73:10310-10319[Abstract/Free Full Text].
|
| 48.
|
Leonard, C.,
M. Spellman,
L. Riddle,
R. Harris,
J. Thomas, and T. Gregory.
1990.
Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells.
J. Biol. Chem
265:10373-10382[Abstract/Free Full Text].
|
| 49.
|
Letvin, N. L.,
M. D. Daniel,
P. K. Sehgal,
R. C. Desrosiers,
R. D. Hunt,
L. M. Waldron,
J. J. MacKey,
D. K. Schmidt,
L. V. Chalifoux, and N. W. King.
1985.
Induction of AIDS-like disease in macaque monkeys with T-cell tropic retrovirus STLV-III.
Science
230:71-73[Abstract/Free Full Text].
|
| 50.
|
Lifson, J.,
M. Feinberg,
G. Reyes,
L. Rabin,
B. Banapour,
S. Chakrabarti,
B. Moss,
F. Wong-Staal,
K. Steimer, and E. Engelman.
1986.
Induction of CD4-independent cell fusion by the HTLV-III/LAV envelope glycoprotein.
Nature
323:725-728[CrossRef][Medline].
|
| 51.
|
Maddon, P. J.,
A. G. Dalgleish,
J. S. McDougal,
P. R. Clapham,
R. A. Weiss, and R. Axel.
1986.
The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain.
Cell
47:333-348[CrossRef][Medline].
|
| 52.
|
Marcon, L.,
H. Choe,
K. A. Martin,
M. Farzan,
P. D. Ponath,
L. Wu,
W. Newman,
N. Gerard,
G. Gerard, and J. Sodroski.
1997.
Utilization of C-C chemokine receptor 5 by the envelope glycoproteins of a pathogenic simian immunodeficiency virus (SIVmac239).
J. Virol.
71:2522-2527[Abstract].
|
| 53.
|
Martin, K. A.,
R. Wyatt,
M. Farzan,
H. Choe,
L. Marcon,
E. Desjardins,
J. Robinson,
J. Sodroski,
C. Gerard, and N. P. Gerard.
1997.
CD4-independent binding of SIV gp120 to rhesus CCR5.
Science
278:1470-1473[Abstract/Free Full Text].
|
| 54.
|
Mascola, J. R.,
S. W. Snyder,
O. S. Weislow,
S. M. Belay,
R. B. Belshe,
D. H. Schwartz,
M. L. Clements,
R. Dolin,
B. S. Graham,
G. J. Gorse,
M. C. Keefer,
M. J. McElrath,
M. C. Walker,
K. F. Wagner,
J. G. McNeil,
F. E. McCutchan, and D. S. Burke.
1996.
Immunization with envelope subunit vaccine products elicits neutralizing antibodies against laboratory-adapted but not primary isolates of human immunodeficiency virus type 1. The National Institute of Allergy and Infectious Diseases AIDS Vaccine Evaluation Group.
J. Infect. Dis.
173:340-348[Medline].
|
| 55.
|
Matthews, T. J.
1994.
Dilemma of neutralization resistance of HIV-1 field isolates and vaccine development.
AIDS Res. Hum. Retrovir.
10:631-632[Medline].
|
| 56.
|
Means, R. A.,
T. Greenough, and R. Desrosiers.
1997.
Neutralization sensitivity of cell culture-passaged simian immunodeficiency virus.
J. Virol.
71:7895-7902[Abstract].
|
| 57.
|
Mirzabekov, T.,
N. Bannert,
M. Farzan,
W. Hofmann,
P. Kolchinsky,
L. Wu,
R. Wyatt, and J. Sodroski.
1999.
Enhanced expression, native purification, and characterization of CCR5, a principal HIV-1 coreceptor.
J. Biol. Chem.
274:28745-28750[Abstract/Free Full Text].
|
| 58.
|
Moore, J.,
J. McKeating,
R. Weiss, and Q. Sattentau.
1990.
Dissociation of gp120 from HIV-1 virions induced by soluble CD4.
Science
250:1139-1142[Abstract/Free Full Text].
|
| 59.
|
Moore, J. P., and P. J. Klasse.
1992.
Thermodynamic and kinetic analysis of sCD4 binding to HIV-1 virions and of gp120 dissociation.
AIDS Res. Hum. Retrovir.
8:443-450[Medline].
|
| 60.
|
Moore, J. P.,
J. A. McKeating,
W. A. Norton, and Q. J. Sattentau.
1991.
Direct measurement of soluble CD4 binding to human immunodeficiency virus type 1 virions: gp120 dissociation and its implications for virus-cell binding and fusion reactions and their neutralization by soluble CD4.
J. Virol.
65:1133-1140[Abstract/Free Full Text].
|
| 61.
|
Moore, J. P.,
J. McKeating,
Y. Huang,
A. Ashkenazi, and D. D. Ho.
1992.
Virions of primary human immunodeficiency virus type 1 isolates resistant to soluble CD4 (sCD4) neutralization differ in sCD4 binding and glycoprotein gp120 retention from sCD4-sensitive ones.
J. Virol.
66:235-243[Abstract/Free Full Text].
|
| 62.
|
Moore, J. P.,
Y. Cao,
L. Qing,
Q. J. Sattentau,
J. Pyati,
R. Koduri,
J. Robinson,
C. F. Barbas III,
D. R. Burton, and D. D. Ho.
1995.
Primary isolates of human immunodeficiency virus type 1 are relatively resistant to neutralization by monoclonal antibodies to gp120, and their neutralization is not predicted by studies with monomeric gp120.
J. Virol.
69:101-109[Abstract].
|
| 63.
|
Muster, T.,
F. Steindl,
M. Purtscher,
A. Trkola,
A. Klima,
G. Himmler,
F. Ruker, and H. Katinger.
1993.
A conserved neutralizing epitope on gp41 of human immunodeficiency virus type 1.
J. Virol.
67:6642-6647[Abstract/Free Full Text].
|
| 64.
|
Parren, P. W.,
L. Mondor,
D. Naniche,
H. J. Ditzel,
P. J. Klasse,
D. R. Burton, and Q. J. Sattentau.
1998.
Neutralization of human immunodeficiency virus type 1 by antibody to gp120 is determined primarily by occupancy of sites on the virion irrespective of epitope specificity.
J. Virol.
72:3512-3519[Abstract/Free Full Text].
|
| 65.
|
Platt, E. J.,
S. L. Kozak, and D. Kabat.
2000.
Critical role of enhanced CD4 affinity in laboratory adaptation of human immunodeficiency virus type 1.
AIDS Res. Hum. Retrovir.
16:871-882[CrossRef][Medline].
|
| 66.
|
Rizzuto, C.,
R. Wyatt,
N. Hernádez-Ramos,
Y. Sun,
P. D. Kwong,
W. A. Hendrickson, and J. Sodroski.
1998.
A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding.
Science
280:1949-1953[Abstract/Free Full Text].
|
| 67.
|
Roben, P.,
J. Moore,
M. Thali,
J. Sodroski,
C. Barbas, and D. Burton.
1994.
Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gp120 that show differing abilities to neutralize human immunodeficiency virus type 1.
J. Virol.
68:4821-4828[Abstract/Free Full Text].
|
| 68.
|
Robey, W. G.,
B. Safai,
S. Oroszlan,
L. Arthur,
M. Gonda,
R. Gallo, and P. J. Fischinger.
1985.
Characterization of envelope and core structural gene products of HTLV-III with sera from AIDS patients.
Science
228:593-595[Abstract/Free Full Text].
|
| 69.
|
Rosenberg, E. S.,
J. Billingsley,
A. Caliendo,
S. Boswell,
P. Sax,
S. Kalams, and B. Walker.
1997.
Vigorous HIV-1-specific CD4+ T cell responses associated with the control of viremia.
Science
278:1447-1450[Abstract/Free Full Text].
|
| 70.
|
Sattentau, Q. J.,
J. P. Moore,
F. Vignaux,
F. Traincard, and P. Poignard.
1993.
Conformational changes induced in the envelope glycoproteins of the human and simian immunodeficiency viruses by soluble receptor binding.
J. Virol.
67:7383-7393[Abstract/Free Full Text].
|
| 71.
|
Sattentau, Q. J., and J. P. Moore.
1991.
Conformational changes induced in the human immunodeficiency virus envelope glycoprotein by soluble CD4 binding.
J. Exp. Med.
174:407-415[Abstract/Free Full Text].
|
| 72.
|
Sauter, M. M.,
A. Pelchen-Matthews,
R. Bron,
M. Marsh,
C. C. LaBranche,
P. J. Vance,
J. Romano,
B. S. Haggarty,
T. K. Hart,
W. M. Lee, and J. A. Hoxie.
1996.
An internalization signal in the simian immunodeficiency virus transmembrane protein cytoplasmic domain modulates expression of envelope glycoproteins on the cell surface.
J. Cell Biol.
132:795-811[Abstract/Free Full Text].
|
| 73.
|
Sawyer, L. S.,
M. T. Wrin,
L. Crawford-Miksza,
B. Potts,
Y. Wu,
P. A. Weber,
R. D. Alfonso, and C. V. Hanson.
1994.
Neutralization sensitivity of human immunodeficiency virus type 1 is determined in part by the cell in which the virus is propagated.
J. Virol.
68:1342-1349[Abstract/Free Full Text].
|
| 74.
|
Schenten, D.,
L. Marcon,
G. Karlsson,
C. Parolin,
T. Kodama,
N. Gerard, and J. Sodroski.
1999.
Effects of soluble CD4 on simian immunodeficiency virus infection of CD4-positive and CD4-negative cells.
J. Virol.
73:5373-5380[Abstract/Free Full Text].
|
| 75.
|
Smith, D.,
R. Byrn,
S. Marsters,
T. Gregory,
J. Groopman, and D. Capon.
1987.
Blocking of HIV-1 infectivity by a soluble secreted form of the CD4 antigen.
Science
238:1704-1707[Abstract/Free Full Text].
|
| 76.
|
Sodroski, J.,
W. C. Goh,
C. Rosen,
K Campbell, and W. A. Haseltine.
1986.
Role of the HTLV-III/LAV envelope in syncytium formation and cytopathicity.
Nature
322:470-474[CrossRef][Medline].
|
| 77.
|
Speck, R.,
K. Wehrly,
E. Platt,
R. Atchison,
I. Charo,
D. Kabat,
B. Chesebro, and M. Goldsmith.
1997.
Selective employment of chemokine receptors as human immunodeficiency virus type 1 coreceptors determined by individual amino acids within the envelope V3 loop.
J. Virol.
71:7136-7139[Abstract].
|
| 78.
|
Stamatatos, L., and C. Cheng-Mayer.
1998.
An envelope modification that renders a primary, neutralization-resistant clade B human immunodeficiency virus type 1 isolate highly susceptible to neutralization by sera from other clades.
J. Virol.
72:7840-7845[Abstract/Free Full Text].
|
| 79.
|
Stein, B. S.,
S. Gouda,
J. Lifson,
R. Penhallow,
K. Bensch, and E. Engelman.
1987.
pH-independent HIV entry into CD4-positive T cells via virus envelope fusion to the plasma membrane.
Cell
49:659-668[CrossRef][Medline].
|
| 80.
|
Sullivan, N.,
Y. Sun,
J. Li,
W. Hofmann, and J. Sodroski.
1995.
Replicative function and neutralization sensitivity of envelope glycoproteins from primary and T-cell line-passaged human immunodeficiency virus type 1 isolates.
J. Virol.
69:4413-4422[Abstract].
|
| 81.
|
Sullivan, N.,
Y. Sun,
Q. Sattentau,
M. Thali,
D. Wu,
G. Denisova,
J. Gershoni,
J. Robinson,
J. Moore, and J. Sodroski.
1998.
CD4-induced conformational changes in the human immunodeficiency virus type 1 gp120 glycoprotein: consequences for virus entry and neutralization.
J. Virol.
72:4694-4703[Abstract/Free Full Text].
|
| 82.
|
Thali, M.,
C. Furman,
E. Helseth,
H. Repke, and J. Sodroski.
1992.
Lack of correlation between soluble CD4-induced shedding of the human immunodeficiency virus type 1 exterior envelope glycoprotein and subsequent membrane fusion events.
J. Virol.
66:5516-5524[Abstract/Free Full Text].
|
| 83.
|
Thali, M.,
J. P. Moore,
C. Furman,
M. Charles,
D. D. Ho,
J. Robinson, and J. Sodroski.
1993.
Characterization of conserved human immunodeficiency virus type 1 gp120 neutralization epitopes exposed upon gp120-CD4 binding.
J. Virol.
67:3978-3988[Abstract/Free Full Text].
|
| 84.
|
Traunecker, A.,
W. Luke, and K. Karjalainen.
1988.
Soluble CD4 molecules neutralize human immunodeficiency virus type 1.
Nature
331:84-86[CrossRef][Medline].
|
| 85.
|
Trkola, A.,
T. Dragic,
J. Arthos,
J. M. Binley,
W. C. Olson,
G. P. Allaway,
C. Cheng-Mayer,
J. Robinson, and J. P. Moore.
1996.
CD4-dependent, antibody-sensitive interactions between HIV-1 and its coreceptor CCR5.
Nature
384:184-186[CrossRef][Medline].
|
| 86.
|
Weissenhorn, W.,
A. Dessen,
S. C. Harrison,
J. J. Skehel, and D. C. Wiley.
1997.
Atomic structure of the ectodomain from gp41.
Nature
387:426-430[CrossRef][Medline].
|
| 87.
|
Werner, W., and J. Levy.
1993.
Human immunodeficiency virus type 1 envelope gp120 is cleaved after incubation with recombinant soluble CD4.
J. Virol.
67:2566-2574[Abstract/Free Full Text].
|
| 88.
|
Willett, B. J.,
M. J. Hosie,
J. C. Neil,
J. Turner, and J. A. Hoxie.
1997.
Common mechanism of infection by lentiviruses.
Nature
385:587[Medline].
|
| 89.
|
Willey, R. L.,
M. A. Martin, and K. W. Peden.
1994.
Increase in soluble CD4 binding to and CD4-induced dissociation of gp120 from virions correlates with infectivity of human immunodeficiency virus type 1.
J. Virol.
68:1029-1039[Abstract/Free Full Text].
|
| 90.
|
Wrin, T.,
T. P. Loh,
J. C. Vennari,
H. Schuitemaker, and J. H. Nunberg.
1995.
Adaptation to persistent growth in the H9 cell line renders a primary isolate of human immunodeficiency virus type 1 sensitive to neutralization by vaccine sera.
J. Virol.
69:39-48[Abstract].
|
| 91.
|
Wu, L.,
N. P. Gerard,
R. Wyatt,
H. Choe,
C. Parolin,
N. Ruffing,
A. Borsetti,
A. A. Cardoso,
E. Desjardin,
W. Newman,
C. Gerard, and J. Sodroski.
1996.
CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5.
Nature
384:179-183[CrossRef][Medline].
|
| 92.
|
Wyatt, R.,
N. Sullivan,
M. Thali,
H. Repke,
D. Ho,
J. Robinson,
M. Posner, and J. Sodroski.
1993.
Functional and immunological characterization of human immunodeficiency virus type 1 envelope glycoproteins containing deletions of the major variable regions.
J. Virol.
67:4557-4565[Abstract/Free Full Text].
|
| 93.
|
Wyatt, R.,
J. Moore,
M. Accola,
E. Desjardins,
J. Robinson, and J. Sodroski.
1995.
Involvement of the V1/V2 variable loop structure in the exposure of human immunodeficiency virus type 1 gp120 epitopes induced by receptor binding.
J. Virol.
69:5723-5733[Abstract].
|
| 94.
|
Wyatt, R.,
P. D. Kwong,
E. Desjardins,
R. Sweet,
J. Robinson,
W. Hendrickson, and J. Sodroski.
1998.
The antigenic structure of the human immunodeficiency virus gp120 envelope glycoprotein.
Nature
393:705-711[CrossRef][Medline].
|
| 95.
|
Zhang, Y.,
R. Fredriksson,
J. McKeating, and E. M. Fenyo.
1997.
Passage of HIV-1 molecular clones into different cell lines confers differential sensitivity to neutralization.
Virology
238:254-264[CrossRef][Medline].
|
Journal of Virology, March 2001, p. 2041-2050, Vol. 75, No. 5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.5.2041-2050.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pantophlet, R., Wang, M., Aguilar-Sino, R. O., Burton, D. R.
(2009). The Human Immunodeficiency Virus Type 1 Envelope Spike of Primary Viruses Can Suppress Antibody Access to Variable Regions. J. Virol.
83: 1649-1659
[Abstract]
[Full Text]
-
Davis, K. L., Bibollet-Ruche, F., Li, H., Decker, J. M., Kutsch, O., Morris, L., Salomon, A., Pinter, A., Hoxie, J. A., Hahn, B. H., Kwong, P. D., Shaw, G. M.
(2009). Human Immunodeficiency Virus Type 2 (HIV-2)/HIV-1 Envelope Chimeras Detect High Titers of Broadly Reactive HIV-1 V3-Specific Antibodies in Human Plasma. J. Virol.
83: 1240-1259
[Abstract]
[Full Text]
-
Yuste, E., Bixby, J., Lifson, J., Sato, S., Johnson, W., Desrosiers, R.
(2008). Glycosylation of gp41 of Simian Immunodeficiency Virus Shields Epitopes That Can Be Targets for Neutralizing Antibodies. J. Virol.
82: 12472-12486
[Abstract]
[Full Text]
-
Binley, J. M., Lybarger, E. A., Crooks, E. T., Seaman, M. S., Gray, E., Davis, K. L., Decker, J. M., Wycuff, D., Harris, L., Hawkins, N., Wood, B., Nathe, C., Richman, D., Tomaras, G. D., Bibollet-Ruche, F., Robinson, J. E., Morris, L., Shaw, G. M., Montefiori, D. C., Mascola, J. R.
(2008). Profiling the Specificity of Neutralizing Antibodies in a Large Panel of Plasmas from Patients Chronically Infected with Human Immunodeficiency Virus Type 1 Subtypes B and C. J. Virol.
82: 11651-11668
[Abstract]
[Full Text]
-
Taylor, B. M., Foulke, J. S., Flinko, R., Heredia, A., DeVico, A., Reitz, M.
(2008). An Alteration of Human Immunodeficiency Virus gp41 Leads to Reduced CCR5 Dependence and CD4 Independence. J. Virol.
82: 5460-5471
[Abstract]
[Full Text]
-
Li, Y., Cleveland, B., Klots, I., Travis, B., Richardson, B. A., Anderson, D., Montefiori, D., Polacino, P., Hu, S.-L.
(2008). Removal of a Single N-Linked Glycan in Human Immunodeficiency Virus Type 1 gp120 Results in an Enhanced Ability To Induce Neutralizing Antibody Responses. J. Virol.
82: 638-651
[Abstract]
[Full Text]
-
Pacheco, B., Basmaciogullari, S., LaBonte, J. A., Xiang, S.-H., Sodroski, J.
(2008). Adaptation of the Human Immunodeficiency Virus Type 1 Envelope Glycoproteins to New World Monkey Receptors. J. Virol.
82: 346-357
[Abstract]
[Full Text]
-
Kubo, Y., Yokoyama, M., Yoshii, H., Mitani, C., Tominaga, C., Tanaka, Y., Sato, H., Yamamoto, N.
(2007). Inhibitory role of CXCR4 glycan in CD4-independent X4-tropic human immunodeficiency virus type 1 infection and its abrogation in CD4-dependent infection. J. Gen. Virol.
88: 3139-3144
[Abstract]
[Full Text]
-
Rong, R., Gnanakaran, S., Decker, J. M., Bibollet-Ruche, F., Taylor, J., Sfakianos, J. N., Mokili, J. L., Muldoon, M., Mulenga, J., Allen, S., Hahn, B. H., Shaw, G. M., Blackwell, J. L., Korber, B. T., Hunter, E., Derdeyn, C. A.
(2007). Unique Mutational Patterns in the Envelope {alpha}2 Amphipathic Helix and Acquisition of Length in gp120 Hypervariable Domains Are Associated with Resistance to Autologous Neutralization of Subtype C Human Immunodeficiency Virus Type 1. J. Virol.
81: 5658-5668
[Abstract]
[Full Text]
-
Rong, R., Bibollet-Ruche, F., Mulenga, J., Allen, S., Blackwell, J. L., Derdeyn, C. A.
(2007). Role of V1V2 and Other Human Immunodeficiency Virus Type 1 Envelope Domains in Resistance to Autologous Neutralization during Clade C Infection. J. Virol.
81: 1350-1359
[Abstract]
[Full Text]
-
Li, M., Salazar-Gonzalez, J. F., Derdeyn, C. A., Morris, L., Williamson, C., Robinson, J. E., Decker, J. M., Li, Y., Salazar, M. G., Polonis, V. R., Mlisana, K., Karim, S. A., Hong, K., Greene, K. M., Bilska, M., Zhou, J., Allen, S., Chomba, E., Mulenga, J., Vwalika, C., Gao, F., Zhang, M., Korber, B. T. M., Hunter, E., Hahn, B. H., Montefiori, D. C.
(2006). Genetic and Neutralization Properties of Subtype C Human Immunodeficiency Virus Type 1 Molecular env Clones from Acute and Early Heterosexually Acquired Infections in Southern Africa. J. Virol.
80: 11776-11790
[Abstract]
[Full Text]
-
Willett, B. J., McMonagle, E. L., Ridha, S., Hosie, M. J.
(2006). Differential Utilization of CD134 as a Functional Receptor by Diverse Strains of Feline Immunodeficiency Virus.. J. Virol.
80: 3386-3394
[Abstract]
[Full Text]
-
Moore, P. L., Crooks, E. T., Porter, L., Zhu, P., Cayanan, C. S., Grise, H., Corcoran, P., Zwick, M. B., Franti, M., Morris, L., Roux, K. H., Burton, D. R., Binley, J. M.
(2006). Nature of Nonfunctional Envelope Proteins on the Surface of Human Immunodeficiency Virus Type 1. J. Virol.
80: 2515-2528
[Abstract]
[Full Text]
-
Amberg, S. M., Netter, R. C., Simmons, G., Bates, P.
(2006). Expanded Tropism and Altered Activation of a Retroviral Glycoprotein Resistant to an Entry Inhibitor Peptide. J. Virol.
80: 353-359
[Abstract]
[Full Text]
-
Wyss, S., Dimitrov, A. S., Baribaud, F., Edwards, T. G., Blumenthal, R., Hoxie, J. A.
(2005). Regulation of Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Fusion by a Membrane-Interactive Domain in the gp41 Cytoplasmic Tail. J. Virol.
79: 12231-12241
[Abstract]
[Full Text]
-
Steckbeck, J. D., Orlov, I., Chow, A., Grieser, H., Miller, K., Bruno, J., Robinson, J. E., Montelaro, R. C., Cole, K. S.
(2005). Kinetic Rates of Antibody Binding Correlate with Neutralization Sensitivity of Variant Simian Immunodeficiency Virus Strains. J. Virol.
79: 12311-12320
[Abstract]
[Full Text]
-
Pikora, C., Wittish, C., Desrosiers, R. C.
(2005). Identification of Two N-Linked Glycosylation Sites within the Core of the Simian Immunodeficiency Virus Glycoprotein Whose Removal Enhances Sensitivity to Soluble CD4. J. Virol.
79: 12575-12583
[Abstract]
[Full Text]
-
Pancera, M., Lebowitz, J., Schon, A., Zhu, P., Freire, E., Kwong, P. D., Roux, K. H., Sodroski, J., Wyatt, R.
(2005). Soluble Mimetics of Human Immunodeficiency Virus Type 1 Viral Spikes Produced by Replacement of the Native Trimerization Domain with a Heterologous Trimerization Motif: Characterization and Ligand Binding Analysis. J. Virol.
79: 9954-9969
[Abstract]
[Full Text]
-
Vermeire, K., Schols, D.
(2005). Cyclotriazadisulfonamides: promising new CD4-targeted anti-HIV drugs. J Antimicrob Chemother
56: 270-272
[Abstract]
[Full Text]
-
Decker, J. M., Bibollet-Ruche, F., Wei, X., Wang, S., Levy, D. N., Wang, W., Delaporte, E., Peeters, M., Derdeyn, C. A., Allen, S., Hunter, E., Saag, M. S., Hoxie, J. A., Hahn, B. H., Kwong, P. D., Robinson, J. E., Shaw, G. M.
(2005). Antigenic conservation and immunogenicity of the HIV coreceptor binding site. JEM
201: 1407-1419
[Abstract]
[Full Text]
-
Overholser, E. D., Babas, T., Zink, M. C., Barber, S. A., Clements, J. E.
(2005). CD4-Independent Entry and Replication of Simian Immunodeficiency Virus in Primary Rhesus Macaque Astrocytes Are Regulated by the Transmembrane Protein. J. Virol.
79: 4944-4951
[Abstract]
[Full Text]
-
Borda, J. T., Alvarez, X., Kondova, I., Aye, P., Simon, M. A., Desrosiers, R. C., Lackner, A. A.
(2004). Cell Tropism of Simian Immunodeficiency Virus in Culture Is Not Predictive of in Vivo Tropism or Pathogenesis. Am. J. Pathol.
165: 2111-2122
[Abstract]
[Full Text]
-
Pohlmann, S., Davis, C., Meister, S., Leslie, G. J., Otto, C., Reeves, J. D., Puffer, B. A., Papkalla, A., Krumbiegel, M., Marzi, A., Lorenz, S., Munch, J., Doms, R. W., Kirchhoff, F.
(2004). Amino Acid 324 in the Simian Immunodeficiency Virus SIVmac V3 Loop Can Confer CD4 Independence and Modulate the Interaction with CCR5 and Alternative Coreceptors. J. Virol.
78: 3223-3232
[Abstract]
[Full Text]
-
Derdeyn, C. A., Decker, J. M., Bibollet-Ruche, F., Mokili, J. L., Muldoon, M., Denham, S. A., Heil, M. L., Kasolo, F., Musonda, R., Hahn, B. H., Shaw, G. M., Korber, B. T., Allen, S., Hunter, E.
(2004). Envelope-Constrained Neutralization-Sensitive HIV-1 After Heterosexual Transmission. Science
303: 2019-2022
[Abstract]
[Full Text]
-
Vermeire, K., Schols, D.
(2003). Specific CD4 down-modulating compounds with potent anti-HIV activity. J. Leukoc. Biol.
74: 667-675
[Abstract]
[Full Text]
-
Johnson, W. E., Sanford, H., Schwall, L., Burton, D. R., Parren, P. W. H. I., Robinson, J. E., Desrosiers, R. C.
(2003). Assorted Mutations in the Envelope Gene of Simian Immunodeficiency Virus Lead to Loss of Neutralization Resistance against Antibodies Representing a Broad Spectrum of Specificities. J. Virol.
77: 9993-10003
[Abstract]
[Full Text]
-
Binley, J. M., Cayanan, C. S., Wiley, C., Schulke, N., Olson, W. C., Burton, D. R.
(2003). Redox-Triggered Infection by Disulfide-Shackled Human Immunodeficiency Virus Type 1 Pseudovirions. J. Virol.
77: 5678-5684
[Abstract]
[Full Text]
-
Montefiori, D. C., Altfeld, M., Lee, P. K., Bilska, M., Zhou, J., Johnston, M. N., Gao, F., Walker, B. D., Rosenberg, E. S.
(2003). Viremia Control Despite Escape from a Rapid and Potent Autologous Neutralizing Antibody Response After Therapy Cessation in an HIV-1-Infected Individual. J. Immunol.
170: 3906-3914
[Abstract]
[Full Text]
-
Vermeire, K., Bell, T. W., Choi, H.-J., Jin, Q., Samala, M. F., Sodoma, A., De Clercq, E., Schols, D.
(2003). The Anti-HIV Potency of Cyclotriazadisulfonamide Analogs Is Directly Correlated with Their Ability to Down-Modulate the CD4 Receptor. Mol. Pharmacol.
63: 203-210
[Abstract]
[Full Text]
-
Johnson, W. E., Lifson, J. D., Lang, S. M., Johnson, R. P., Desrosiers, R. C.
(2002). Importance of B-Cell Responses for Immunological Control of Variant Strains of Simian Immunodeficiency Virus. J. Virol.
77: 375-381
[Abstract]
[Full Text]
-
Pantophlet, R., Ollmann Saphire, E., Poignard, P., Parren, P. W. H. I., Wilson, I. A., Burton, D. R.
(2002). Fine Mapping of the Interaction of Neutralizing and Nonneutralizing Monoclonal Antibodies with the CD4 Binding Site of Human Immunodeficiency Virus Type 1 gp120. J. Virol.
77: 642-658
[Abstract]
[Full Text]
-
Fouts, T., Godfrey, K., Bobb, K., Montefiori, D., Hanson, C. V., Kalyanaraman, V. S., DeVico, A., Pal, R.
(2002). Crosslinked HIV-1 envelope-CD4 receptor complexes elicit broadly cross-reactive neutralizing antibodies in rhesus macaques. Proc. Natl. Acad. Sci. USA
99: 11842-11847
[Abstract]
[Full Text]
-
Ryzhova, E., Whitbeck, J. C., Canziani, G., Westmoreland, S. V., Cohen, G. H., Eisenberg, R. J., Lackner, A., Gonzalez-Scarano, F.
(2002). Rapid Progression to Simian AIDS Can Be Accompanied by Selection of CD4-Independent gp120 Variants with Impaired Ability To Bind CD4. J. Virol.
76: 7903-7909
[Abstract]
[Full Text]
-
Gorry, P. R., Taylor, J., Holm, G. H., Mehle, A., Morgan, T., Cayabyab, M., Farzan, M., Wang, H., Bell, J. E., Kunstman, K., Moore, J. P., Wolinsky, S. M., Gabuzda, D.
(2002). Increased CCR5 Affinity and Reduced CCR5/CD4 Dependence of a Neurovirulent Primary Human Immunodeficiency Virus Type 1 Isolate. J. Virol.
76: 6277-6292
[Abstract]
[Full Text]
-
Johnson, W. E., Morgan, J., Reitter, J., Puffer, B. A., Czajak, S., Doms, R. W., Desrosiers, R. C.
(2002). A Replication-Competent, Neutralization-Sensitive Variant of Simian Immunodeficiency Virus Lacking 100 Amino Acids of Envelope. J. Virol.
76: 2075-2086
[Abstract]
[Full Text]
-
Puffer, B. A., Pohlmann, S., Edinger, A. L., Carlin, D., Sanchez, M. D., Reitter, J., Watry, D. D., Fox, H. S., Desrosiers, R. C., Doms, R. W.
(2002). CD4 Independence of Simian Immunodeficiency Virus Envs Is Associated with Macrophage Tropism, Neutralization Sensitivity, and Attenuated Pathogenicity. J. Virol.
76: 2595-2605
[Abstract]
[Full Text]
-
Edwards, T. G., Wyss, S., Reeves, J. D., Zolla-Pazner, S., Hoxie, J. A., Doms, R. W., Baribaud, F.
(2002). Truncation of the Cytoplasmic Domain Induces Exposure of Conserved Regions in the Ectodomain of Human Immunodeficiency Virus Type 1 Envelope Protein. J. Virol.
76: 2683-2691
[Abstract]
[Full Text]
-
Chakrabarti, L. A., Ivanovic, T., Cheng-Mayer, C.
(2002). Properties of the Surface Envelope Glycoprotein Associated with Virulence of Simian-Human Immunodeficiency Virus SHIVSF33A Molecular Clones. J. Virol.
76: 1588-1599
[Abstract]
[Full Text]
-
Lin, G., Lee, B., Haggarty, B. S., Doms, R. W., Hoxie, J. A.
(2001). CD4-Independent Use of Rhesus CCR5 by Human Immunodeficiency Virus Type 2 Implicates an Electrostatic Interaction between the CCR5 N Terminus and the gp120 C4 Domain. J. Virol.
75: 10766-10778
[Abstract]
[Full Text]
-
Si, Z., Cayabyab, M., Sodroski, J.
(2001). Envelope Glycoprotein Determinants of Neutralization Resistance in a Simian-Human Immunodeficiency Virus (SHIV-HXBc2P 3.2) Derived by Passage in Monkeys. J. Virol.
75: 4208-4218
[Abstract]
[Full Text]