Previous Article | Next Article 
Journal of Virology, February 2001, p. 1928-1940, Vol. 75, No. 4
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.4.1928-1940.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Cytoplasmic Domain of Herpes Simplex Virus gE
Causes Accumulation in the trans-Golgi Network, a Site of
Virus Envelopment and Sorting of Virions to Cell Junctions
Tom N.
McMillan and
David C.
Johnson*
Department of Molecular Microbiology and
Immunology, Oregon Health Sciences University, Portland, Oregon 97201
Received 6 September 2000/Accepted 17 November 2000
 |
ABSTRACT |
Alphaherpesviruses express a heterodimeric glycoprotein, gE/gI,
that facilitates cell-to-cell spread between epithelial cells and
neurons. Herpes simplex virus (HSV) gE/gI accumulates at junctions formed between polarized epithelial cells at late times of infection. However, at earlier times after HSV infection, or when gE/gI is expressed using virus vectors, the glycoprotein localizes to the trans-Golgi network (TGN). The cytoplasmic (CT) domains of
gE and gI contain numerous TGN and endosomal sorting motifs and are essential for epithelial cell-to-cell spread. Here, we swapped the CT
domains of HSV gE and gI onto another HSV glycoprotein, gD. When the
gD-gICT chimeric protein was expressed using a
replication-defective adenovirus (Ad) vector, the protein was found on
both the apical and basolateral surfaces of epithelial cells, as was
gD. By contrast, the gD-gECT chimeric protein, gE/gI, and
gE, when expressed by using Ad vectors, localized exclusively to the
TGN. However, gD-gECT, gE/gI, and TGN46, a cellular TGN
protein, became redistributed largely to lateral surfaces and cell
junctions during intermediate to late stages of HSV infection.
Strikingly, gE and TGN46 remained sequestered in the TGN when cells
were infected with a gI
HSV mutant. The redistribution of
gE/gI to lateral cell surfaces did not involve widespread HSV
inhibition of endocytosis because the transferrin receptor and gE were
both internalized from the cell surface. Thus, gE/gI accumulates in the
TGN in early phases of HSV infection then moves to lateral surfaces, to
cell junctions, at late stages of infection, coincident with the
redistribution of a TGN marker. These results are related to recent
observations that gE/gI participates in the envelopment of
nucleocapsids into cytoplasmic vesicles (A. R. Brack, B. G. Klupp, H. Granzow, R. Tirabassi, L. W. Enquist, and T. C. Mettenleiter, J. Virol. 74:4004-4016, 2000) and that gE/gI can
sort nascent virions from cytoplasmic vesicles specifically to the
lateral surfaces of epithelial cells (D. C. Johnson, M. Webb,
T. W. Wisner, and C. Brunetti, J. Virol. 75:821-833, 2000).
Therefore, gE/gI localizes to the TGN, through interactions between the
CT domain of gE and cellular sorting machinery, and then participates
in envelopment of cytosolic nucleocapsids there. Nascent virions are
then sorted from the TGN to cell junctions.
 |
INTRODUCTION |
The alphaherpesviruses herpes
simplex virus (HSV) and varicella-zoster virus (VZV) and the swine
pseudorabies virus (PrV) express a heterodimer composed of
glycoproteins gE and gI that mediates cell-to-cell spread in certain
cultured cells and in epithelial and neuronal tissues (12,
14-17, 25, 26, 29, 51, 59, 62). Both gE and gI are required to
mediate efficient cell-to-cell spread; neither glycoprotein on its own
can suffice. In vivo, cell-to-cell spread is an especially important
parameter of alphaherpesvirus infection and pathogenesis. These viruses spread rapidly through mucosal or ocular epithelial tissues (in the
case of HSV) or in the skin (in the case of VZV), as well as within
synaptically connected neuronal networks. HSV and PrV gE
and gI
mutants are severely compromised in the ability to
spread in animal models (4, 15, 16, 31, 44, 57).
Cell-to-cell spread can be studied in the laboratory by using certain
polarized epithelial cells that form extensive cell junctions; in these cells, gE
and gI
mutants are markedly
reduced in the ability to spread from infected to uninfected cells. For
example, plaques formed by an HSV gE
mutant on monolayers
of HaCaT human keratinocytes were eightfold smaller than plaques
produced by wild-type HSV (58). However, in other cells,
e.g., highly transformed HeLa or HEp-2 cells, cells that do not form
extensive junctions, these mutants do not show defects in cell-to-cell
spread. Thus, the notion that gE/gI is a "nonessential"
glycoprotein is a misnomer related to the use of cells that are not
representative of those infected in vivo.
We previously reported that HSV gE/gI accumulated extensively along the
lateral surfaces of epithelial cells, colocalizing with adherens
junctions proteins but not with tight junctions (17, 58).
These results suggested that gE/gI was sorted specifically to
basolateral domains of polarized cells and then was retained at cell
junctions, and not at nonjunctional surfaces, by binding to components
of cell junctions. Moreover, we proposed that gE/gI might act by
binding cellular receptors to promote movement of HSV virus particles
from an infected cell to a neighboring uninfected cell across cell
junctions (17, 58; M. Huber, T. McMillan, T. Wisner, and
D. C. Johnson, Abstr. 25th Int. Herpesvirus Workshop, abstr. 7.06, 2000). This proposed property of gE/gI is by analogy to the
well-characterized HSV receptor binding glycoprotein, gD (20,
27). gE and gI are encoded by genes adjacent to gD and show
limited similarity to gD (34). Consistent with this
hypothesis, PrV can facilitate cell-to-cell spread in the absence of gD
in some cell types (37, 41, 45).
The extracellular domains of gE/gI are clearly important for
cell-to-cell spread, but the cytoplasmic (CT) domains of gE/gI are also
essential for this process. PrV and HSV mutants lacking the CT domains
of gE/gI behave similarly to null mutants, as they are unable to spread
well in cultured epithelial cells and are less neurovirulent (49,
51, 58). Moreover, we recently demonstrated that the gE CT
domain is essential for directed transport of nascent HSV virions to
epithelial cell junctions, a process that presumably enhances
cell-to-cell spread (28).
The CT domains of alphaherpesvirus gE and gI contain tyrosine
(YXXØ) and dileucine motifs and clusters of amino acids that are acidic and phosphorylated. These motifs act by binding components of the cellular sorting machinery to target membrane proteins to the
trans-Golgi network (TGN), direct endocytosis of membrane proteins from the plasma membrane, and sort membrane proteins to
basolateral surfaces of polarized cells (reviewed in references 8, 19, 35, and 36). Indeed, PrV gE/gI is rapidly
endocytosed (49, 51), and VZV gE and gI when expressed by
transfection are endocytosed and accumulate in the TGN (1, 2, 39,
40, 60). Tyrosine (YXXØ) motifs in gE clearly
influence endocytosis and TGN localization (1, 2, 40, 49,
61), probably through interactions with the µ subunits of the
AP-1, AP-2, AP-3, or AP-4 clathrin adapter complex (reviewed in
references 19, 23, and 36). We recently reported a role
for the µ1B/AP-1 complex in directed transport of PrV particles to
cell junctions (28). There are also clusters of acidic
residues adjacent to serine residues that are phosphorylated in the CT
domain of gE (1, 58) that can potentially act in TGN
sorting through interactions with PACS-1 (35, 53). gI
contains dileucine motifs that can serve to cause endocytosis, TGN
localization, and localization to the basolateral surfaces of polarized
cells, through interactions with the
subunits of clathrin adapter
complexes (reviewed in references 23, 32, and
36). Extensive phosphorylation of the CT tails of gE and
gI may regulate the traffick of gE/gI (1, 18, 38, 58).
Given that gE and gI of HSV, PrV, and VZV contain several different
sorting motifs, there has been intensive interest in the subcellular
distribution of these glycoproteins (1, 2, 17, 39, 40, 41, 49,
51, 58, 60). Taken together, the results of these studies are
often confusing, perhaps in part because these glycoproteins have been
expressed by transfection in some experiments and by herpesvirus
infection in other cases; moreover, in many cases gE has been expressed
without gI, and vice versa. In HSV-infected cells, gE and gI are
expressed primarily or exclusively as a complex and appear to function
as a complex (7, 22, 26). In addition, there is a case to
be made for expressing gE and gI in polarized epithelial cells or other
cells that form extensive junctions where gE/gI functions, rather than in highly transformed cells where gE/gI does not function. There have
been reports that VZV and HSV gE accumulate extensively in the TGN when
expressed by transfection or infection of nonpolarized cells (1,
2, 60, 61). We found that HSV gE/gI accumulated primarily at
epithelial cell junctions when expressed using recombinant adenovirus
(Ad) vectors or by infection with HSV (17). One
explanation for these differences could relate to inhibition of
endocytosis during infection by HSV. Rapid endocytosis from the plasma
membrane might cause accumulation of gE or gE/gI in the TGN, and
inhibition of endocytosis by alphaherpesviruses could cause cell
surface accumulation. Indeed, PrV inhibits endocytosis after 6 h
of infection (50). Transfected cells might not show this
effect or other effects of HSV, PrV, or VZV infection.
To characterize the subcellular distribution of gE/gI further and to
examine the contributions of the CT in this, the gE and gI CT domains
were substituted for the CT domain of gD. The CT domain of gE was
sufficient to cause accumulation in the TGN, and gE/gI was also found
in the TGN when expressed using recombinant Ad vectors. Moreover, gE/gI
was found in the TGN of HSV-infected cells after 5 h of infection.
However, after 11 h of infection with HSV, gE/gI was redistributed
to lateral surfaces, accumulating at cell junctions. gI was essential
for this redistribution. HSV infection did not grossly alter the
endocytic machinery of cells. Therefore, while the CT domain of gE
targets gE/gI to the TGN early in HSV infection, the complex moves to
lateral surfaces of these polarized cells at intermediate times of
infection by a process that does not involve inhibition of endocytosis.
 |
MATERIALS AND METHODS |
Cells and viruses.
All culture media were purchased from
BioWhittaker Inc., Walkersville, Md. HEC-1A endometrial epithelial
cells (5) were grown in RPMI medium supplemented with 10%
heat-inactivated fetal bovine serum (FBS; Hyclone). ARPE-19 cells
(American Type Culture Collection) Dulbecco modified Eagle medium were
grown in (DMEM)/F-12 medium (50:50) supplemented with 10% FBS.
Madin-Darby bovine kidney (MDBK) cells (American Type Culture
Collection) were grown in Eagle minimal essential medium supplemented
with 10% FBS. 293 cells (Microbix, Toronto, Ontario, Canada) were
grown in the same medium and passaged as described by Microbix. SV type
1 (HSV-1) strains F (wild type), F-US7kan (gI
), and
F-gE
(gE
) (15) were propagated and
titered on Vero cells. All Ad vectors were replication-defective
(E1
) viruses propagated and titered on 293 cells. Three
Ad vectors expressing gD [AdgD1(E1
)], gE
[Ad(E1
)gE], or gI [Ad(E1
)gI] have been
described elsewhere (10, 17); in each case, the human
cytomegalovirus immediate-early promoter drives glycoprotein expression. AdgD-gECT and AdgD-gICT, described
below, were used to express gD-gECT and gD-gICT
chimeric glycoproteins, respectively. A second Ad vector, Ad-Trans,
expressing the tetracycline transactivator, was required to
transactivate the tetracycline-regulated human cytomegalovirus
promoters in AdgD-gECT and AdgD-gICT (47,
52). All infections with Ad vectors or HSV were done in the
appropriate media supplemented with 2% FBS.
Antibodies.
Sheep anti-TGN46 immunopurified antibodies were
obtained from Serotec. Rabbit anti-
-catenin polyclonal serum was
obtained from Sigma. A mouse monoclonal antibody (MAb) specific for
-catenin was obtained from Transduction Laboratories (Lexington,
Ky.). Rabbit anticalreticulin polyclonal antibodies were obtained from Affinity Bioreagents Inc. (Golden, Colo). The rabbit polyclonal serum
specific for the 275-kDa mannose-6- phosphate receptor (MPR) was
described previously (10). DL6, a MAb specific for HSV-1 gD, was a gift from Gary Cohen and Roselyn Eisenberg (University of
Pennsylvania, Philadelphia). 3104, an HSV gI-specific MAb, and 3114, a
gE-specific MAb (26), were gifts from Anne Cross and Nigel
Stow (Institute of Virology, Glasgow, United Kingdom). 3114 was
conjugated to Oregon Green, an analog of fluorescein, using a
FluoReporter Oregon Green 488 protein labeling kit from Molecular
Probes (Eugene, Oreg.). A rat antiserum specific for gE and gI was
produced by immunizing rats with a soluble form of gE/gI
(13). Secondary antibodies
Alexa 488-conjugated goat anti-rat immunoglobulin G (IgG), Alexa 488-conjugated goat anti-mouse IgG, Alexa 488-conjugated goat antifluorescein, Alexa 594-conjugated donkey anti-sheep IgG, and Alexa 594-conjugated goat anti-rabbit IgG
were all obtained from Molecular Probes. Cy3-conjugated goat anti-rabbit IgG was obtained from Jackson Immunoresearch Laboratories Inc. (West Grove, Pa.).
Construction of recombinant DNAs encoding chimeric proteins.
gD sequences were PCR amplified from pSS17, a plasmid containing a
BamHI fragment derived from the US component of
HSV-1(KOS) (33). gE and gI sequences were amplified from
pUC-US7/8, a plasmid containing PCR-amplified DNA from the
US region of HSV-1(F) (58), using
Pfu DNA polymerase (Stratagene) and nucleotides from
Promega. The DNA sequence encoding the gD extracellular and
transmembrane domains, amino acids (aa) 1 to 364, was fused in frame to
DNA encoding either the gE CT domain (aa 447 to 552) or the CT domain of gI (aa 297 to 390) by using a two-step PCR mutagenesis procedure as
described elsewhere (58). Briefly, primers 1 and 2 (described below) were used to amplify the extracellular and
transmembrane domains of gD. Primer 3 or 4 was used to amplify the
cytosolic sequence of gE or gI. The PCR products from these two
separate reactions were gel purified and mixed together with primers 1 and 4 in a second PCR to produce DNA encoding the gD-gECT
chimera (1,467 bp) or the gD-gICT chimera (1,420 bp).
gD-gECT primers were primer 1 (CCTTGAATTCTCTTTTGTGTGGTGCGTTCCG),
primer 2 (CCAGGCACGCCTCCTCATCCAGTACACAATTCC), primer 3 (GGAATTGTGTACTGGATGAGGAGGCGTGCCTGG), and primer 4 (GGGGCCTCTAGATGGGGCTCATTACCAGAAG).
gD-gICT primers were primer 1 (CCTTGAATTCTCTTTTGTGTGGTGCGTTCCG),
primer 2 (GCGGCGTTGACATCTGTGCATCCAGTACACAATTCC), primer 3 (GGAATTGTGTACTGGATGCACAGATGTCAACGCCGC),
and primer 4 (TTAATCTAGACTATACCAACAGGGGAGGCGTTGG).
In each case, boldface letters indicate gD sequences, underlining
indicates gE or gI sequences, and italics indicate novel restriction
sites (EcoRI and XbaI). The PCR products from the
second reaction were inserted into p
E1sp1BTet to create
p
E1sp1BTet gD-gECT and p
E1sp1BTet gD-gICT. These plasmids were then entirely sequenced in
both directions to verify their integrity.
Construction of recombinant Ad vectors.
293 cells were
cotransfected with pJM17 (24), a plasmid containing the Ad
serotype 5 genome, and either p
E1sp1BTet gD-gECT or
p
E1sp1BTet gD-gICT as described elsewhere
(24). Recombinant Ad vectors were screened by PCR and for
expression of chimeric glycoproteins.
Immunoprecipitation of
[35S]methionine/cysteine-labeled glycoproteins.
HEC-1A cells were infected with HSV-1(F) (25 PFU/cell),
AdgD1(E1
) (100 PFU/cell), AdgD-gECT (10 PFU/cell), or AdgD-gICT (10 PFU/cell) in medium containing
2% FBS. Cells infected with AdgD-gECT and AdgD-gICT were coinfected with Ad-Trans using 10 PFU/cell.
In each case, the titers for Ad vectors refer to those obtained on 293 cells that express E1 and allow plaque formation. At 6 h after infection with HSV-1(F) or 26 h after infection with Ad vectors, cells
were washed three times with DMEM lacking cysteine and methionine and
then labeled for 3 h in this medium supplemented with 50 µCi of
[35S]methionine/cysteine (New England Nuclear, Boston,
Mass.) per ml. Cell extracts were made using 50 mM Tris HCl (pH
7.5)-100 mM NaCl-1% NP-40-0.5% sodium deoxycholate containing 2 mg
of bovine serum albumin (BSA) per ml and 1 mM phenylmethylsulfonyl
fluoride. gD was immunoprecipitated with anti-gD MAb DL6 as described
elsewhere (58). Proteins were analyzed on 10%
polyacrylamide gels.
Confocal immunofluorescence microscopy.
HEC-1A cells, which
were grown on Nunc Permanox 8 well slides until 70 to 80% confluent,
were infected with HSV-1 strain F, F-gE
, or F-US7kan at 25 PFU/cell.
Similar cell monolayers were infected with AdgD1(E1
) or
Ad(E1
)gE (100 PFU/cell), infected with both
Ad(E1
)gE and Ad(E1
)gI (each at 100 PFU/cell), or coinfected with AdgD-gECT and Ad-Trans or
AdgD-gICT and Ad-Trans (each at 10 PFU/cell). In
experiments examining the modulation of gE/gI expressed by Ad vectors
by subsequent HSV infection, cells were infected with
Ad(E1
)gE and Ad(E1
)gI (each at 100 PFU/cell) for 24 h and then infected with F-gE
(25 PFU/cell). For
staining with anti-
-catenin, anti-HSV glycoprotein, and anti-TGN46
antibodies, infected cells were washed with phosphate-buffered saline
(PBS) containing 1 mM MgCl2 and 1 mM CaCl2,
fixed with 4% paraformaldehyde in PBS for 30 min, then washed three
times with PBS. The cells were permeabilized using 0.2% Triton X-100 in PBS for 5 min, washed three times in PBS containing 0.02% Tween-20 (T-PBS), and then incubated with blocking buffer (T-PBS containing 2%
FBS and 2% BSA) overnight. The cells were incubated with sheep anti-TGN46 for 1 h, washed three times in T-PBS, and then
incubated with Alexa 594-conjugated donkey anti-sheep IgG for 1 h.
The cells were washed three times in T-PBS and then incubated with
blocking buffer containing 2% goat serum for 2 h. The cells were
then incubated with either mouse anti-gE MAb 3114, rat anti gE/gI
polyclonal antibody, or anti-gD MAb DL6 simultaneously with rabbit
anti-
-catenin antibody for 1 h. Cells were then washed three
times with T-PBS and incubated with Alexa 488-conjugated goat
anti-mouse IgG or Alexa 488-conjugated goat anti-mouse IgG and
Cy5-conjugated goat anti-rabbit IgG. For staining with calreticulin or
MPR-specific antibody cells were first incubated with either rabbit
anticalreticulin or rabbit anti-MPR antibody for 1 h, washed with
T-PBS, and then incubated with Alexa 594-conjugated goat anti-rabbit
IgG for 1 h. The cells were washed with T-PBS, then incubated with
gD-specific MAb DL-6 or gE-specific MAb 3114 for 1 h, washed, and
incubated with Alexa 488-conjugated goat anti-mouse IgG. Early
endosomes and late endosomes/lysosomes were stained by incubating cells with Alexa 594-conjugated transferrin (Tf; Molecular Probes) for 15 min
at 37°C. For early endosomes, the cells were then washed and
immediately fixed. For late endosomes/lysosomes, the cells were washed
and incubated for an additional 30 min at 37°C in medium. The cells
were then fixed, permeabilized, and stained with anti-HSV glycoprotein
antibodies. Cells were mounted on microscope slides using Prolong
(Molecular Probes).
BFA and cycloheximide treatments.
Cells were treated with 5 µg of brefeldin A (BFA; Epicentre Technologies, Madison, Wis.) per ml
for 30 min at 37°C or with 10 µg of cycloheximide (Sigma, St.
Louis, Mo.) per ml for 2 h at 37°C beginning 24 h after
infection with Ad vectors or after various times of HSV infection.
Confocal laser scanning immunofluorescence.
Images were
captured using a Bio-Rad 1024 ES laser scanning confocal microscope on
a Nikon Eclipse TE300 inverted fluorescence microscope using the 100×
objective. In some cases confocal images were processed by Applied
Precision Inc.'s Softworks deconvolution software running on a Silicon
Graphics Octane computer running the IRIX 6.5 operating system. This
processing was used to construct three-dimensional models of cells to
visualize apical and basolateral surfaces.
Endocytosis of If and gE.
Semiconfluent monolayers of HEC-1A
cells growing in 35-mm-diameter dishes were left uninfected or were
infected with HSV-1(F) using 10 PFU/cell. After 4, 8, or 12 h of
infection with HSV-1, the binding and uptake of
125I-labeled Tf were measured as described elsewhere
(55). To quantify the numbers of specific and nonspecific
Tf receptors, cells were washed three times with ice-cold serum-free
medium and then incubated for 1 h with ice-cold uptake medium
containing 1 mg of BSA per ml, 10 mM HEPES (pH 7.35), and 2 µg of of
125I-Tf (1.5 × 106 to 3.0 × 106 cpm/µg) per ml, with or without 2 mg of unlabeled Tf
per ml. Cells were then washed in ice-cold medium and lysed in 0.5 ml lysis solution (0.1 N NaOH, 1% Triton-X 100). To measure specific and
nonspecific Tf uptake, cells were washed three times with serum-free
medium at 37°C and then incubated at 37°C with 125I-Tf
(2 µg/ml) with or without unlabeled Tf (2 mg/ml) for 3, 6, 9, or 12 min. Cell surface Tf was removed by washing the cells once with
ice-cold acid wash buffer (0.2 N acetic acid, 0.5 M NaCl) for 2 min and
then three times in cold 150 mM NaCl-20 mM HEPES (pH 7.4)-1 mM
CaCl2-5 mM KCl-1 mM MgCl2. Cells were lysed in lysis solution, and radioactivity was counted. Specific binding and
uptake were calculated by subtracting nonspecific binding and uptake
(observed in the presence excess unlabeled Tf) from total binding and
uptake. Uptake of 125I-labeled anti-gE MAb 3114 was
determined similarly except that nonspecific binding was not measured.
Cells were incubated with 125I-labeled 3114 IgG (50 ng/ml;
7.7 × 106 cpm/µg) for 5, 10, 15, or 20 min at
37°C; then surface antibodies were removed with ice-cold acid wash
buffer, the cells were solubilized in lysis solution, and radioactivity
was counted.
 |
RESULTS |
Construction of chimeric proteins with the gE or gI CT domain
replacing the CT domain of gD.
To examine the effects of the gE
and gI CT domains on intracellular trafficking, these domains were
swapped in place of the CT domain of HSV-1 gD. This was done by using a
two-step PCR. DNA encoding aa 1 to 364 of gD was fused, in frame, to
DNA encoding either aa 447 to 552 of gE (gD-gECT) or aa 297 to 390 of gI (gD-gICT) (Fig.
1). The products of these PCRs were
ligated in shuttle plasmid p
E1sp1BTet, containing the
cytomegalovirus immediate-early core promoter coupled to the
tetracycline resistance operon (Tet-responsive element) and used to
construct replication-defective (E1
) Ad vectors (3,
47). Plasmids derived from p
E1sp1BTet and encoding
gD-gECT or gD-gICT were each cotransfected into
293 cells along with a second plasmid which contains the genome of Ad
serotype 5. Transfected 293 cells yielded Ad vectors which were
analyzed by PCR for the presence of the desired insert, and viruses
containing chimeric HSV genes were plaque purified.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic of HSV-1 glycoproteins gE/gI and gD and of
glycoproteins chimeric gD-gECT and
gD-gICT. The CT domain of gE is 106 residues in length
(aa 447 to 552) and contains a tyrosine motif (YIRV), a cluster of
acidic residues adjacent to several serine residues that are
phosphorylated (58). The CT domain of gI is 94 residues in
length (aa 297 to 390) and contains a dileucine motif at the C
terminus. The gE and gI CT domains were transferred onto the
extracellular and transmembrane domains of gD (residues 1 to 364),
replacing the gD CT domain, creating gD-gECT and
gD-gICT, respectively.
|
|
These Ad vectors were characterized for expression of HSV-1
glycoproteins by infecting HEC-1A cells and immunoprecipitating radiolabeled glycoproteins. Cells were infected with
AdgD1(E1
), which expresses HSV-1 gD (10),
with AdgD-gECT or AdgD-gICT, or with wild-type
HSV-1 (strain F). The Tet-responsive elements in AdgD-gECT
and AdgD-gICT were transactivated by coinfecting cells with
a second Ad vector, Ad-Trans, which expresses the tetracycline transactivator protein (47, 52). The levels of wild-type
gD, gD-gECT, and gD-gICT expressed by the Ad
vectors were similar to levels observed in cells infected with HSV
(Fig. 2). Chimeric glycoproteins
gD-gECT and gD-gICT were larger than gD because the small CT domain of gD was replaced by the larger CT domain of gE or
gI. In each case, there were several protein bands including various
immature and mature for those of gD-gICT which may be related to phosphorylation (58) or other posttranslational
modifications.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of gD-gECT and
gD-gICT by recombinant Ad vectors. HEC-1A cells were
infected with HSV-1(F) or with Ad(E1 )gD1 or were
coinfected with AdgD-gECT and Ad-Trans or with
AdgD-gICT and Ad-Trans. Cells infect with HSV were labeled
with [35S]methionine/cysteine from 6 to 9 h, while
cells infected with Ad vectors were labeled from 26 to 29 h. Cell
extracts were incubated with MAb DL6, which is specific for gD, and the
antibody-antigen complexes were precipitated using protein-A agarose.
Immunoprecipitated proteins were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis. Positions of size markers
in kilodaltons are shown on the right, and the approximate positions of
mature gD and immature gD (pgD) are indicated on the left.
|
|
The cytosolic tail of gE, but not that of gI, mediates accumulation
of gD in the TGN.
Previously, we found that gD was found on the
apical as well as the basolateral surfaces of epithelial cells, and
also throughout the cytoplasm, whereas gE/gI accumulated primarily at
cell junctions (17). When gE was expressed without gI, the
glycoprotein accumulated in cytoplasmic vesicles (17). To
ascertain whether the CT domain of gE or gI could alter the subcellular
distribution of gD, human epithelial HEC-1A cells were infected with Ad
vectors expressing gD-gECT and gD-gICT for
24 h. The cells were fixed, permeabilized, and simultaneously
stained with MAb specific for gD or gE and simultaneously with
anti-TGN46 antibodies. TGN46, a type 1 transmembrane protein found
predominantly in the TGN, rapidly cycles back to the TGN from endosomes
and the basolateral surfaces of polarized cells (6, 21, 42,
43). Images of the cells were obtained using a laser scanning
confocal microscope. The gD-gICT chimeric glycoprotein was
found predominately on apical and lateral cell surfaces, as was
wild-type gD (Fig. 3). The apical surface
expression of these constructs was confirmed by processing confocal
images taken every 0.2 µm through the field by deconvolution
software, producing z-axis images (results not shown).
Smaller fractions of gD and gD-gICT were also colocalized
with TGN46 (yellow staining in Fig. 3).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
The gE CT domain mediates accumulation of glycoproteins
in the TGN. The distributions of gD-gECT,
gD-gICT, gE, gE/gI, and gD were compared in HEC-1A cells
respectively infected with the following replication-defective Ad
vectors: AdgD-gECT/Ad-Trans,
AdgD-gICT/Ad-Trans, Ad(E1 )gE,
Ad(E1 )gE and Ad(E1 )gI, and
AdgD1(E1 ). In some cases, cells were treated with BFA (5 µg/ml) for 30 min before fixing (rightmost panels). Cells were fixed,
permeabilized with 0.2% Triton X-100, blocked, and then incubated
sheep anti-TGN46 followed by Alexa 594-coupled donkey anti-sheep IgG.
The cells were washed, blocked to eliminate cross-reactivity between
donkey anti-sheep IgG and secondary goat antibodies, and then incubated
with mouse MAb specific for gD, DL6 in the case of gD-gECT,
gD-gICT, and gD, or a rat polyclonal serum specific for
HSV-1 gE/gI. The mouse and rat antibodies were detected by using Alexa
488-conjugated goat anti-mouse IgG and goat anti-rat, respectively. The
cells were viewed by laser scanning confocal microscopy. The green (HSV
glycoproteins) and red (TGN46) channels were superimposed in the Both
Markers column.
|
|
In contrast to the gD-gICT chimeric glycoprotein,
gD-gECT, as well as gE and gE/gI, was predominantly or
exclusively found in cytoplasmic vesicles, extensively colocalizing
with TGN46 (Fig. 3). This distribution of gE and gE/gI was observed at
24, 48, and 72 h after infection with replication-defective Ad
vectors at different multiplicities of infection. This was consistent with the conclusion that the CT domain of gE causes gE/gI to localize specifically to the TGN. However, it is frequently difficult to ascertain by immunofluorescence whether proteins are present in the TGN
rather than in Golgi membranes (6). To examine this further, we used BFA to collapse the TGN and the Golgi apparatus. In
cells treated with BFA, TGN membranes redistribute into a distinct perinuclear structure that colocalizes with microtubule-organizing centers, while other Golgi (cis- and medial-Golgi) membranes
redistribute into the endoplasmic reticulum (46). After
treatment of cells with BFA for 30 min, gE, gE/gI, and
gD-gECT continued to be colocalized with TGN46 (Fig. 3,
right panels), suggesting that these glycoproteins accumulated in the
TGN rather than other Golgi membranes. BFA treatment of cells reduced
colocalization between TGN46 and gD, and also between TGN46 and
gD-gICT, but did not affect the accumulation of gD and
gD-gICT at the apical and lateral cell surfaces. In addition, a 2-h cycloheximide treatment to block de novo protein synthesis beginning 24 h after infection with
AdgD1(E1
) or AdgD-gICT reduced the small
fraction of gD and gD-gICT that colocalized with TGN46 but
did not affect accumulation of gE/gI or gD-gECT in the TGN
(results not shown). This suggested that gD and gD-gICT
move transiently through the TGN on their path to the cell surface, and
when protein synthesis is blocked the glycoproteins are not found in
the TGN.
To further characterize the subcellular localization dictated by the gE
CT domain, the distribution of gD-gECT was determined with
respect to several other cellular membrane markers. gD-gECT did not colocalize with calreticulin, a marker for the endoplasmic reticulum (Fig. 4). There was some
limited colocalization of gD-gECT with the 275-kDa MPR, a
protein found in the cis-Golgi apparatus but also known to
be present in the TGN, as well as in endosomes and on the plasma
membrane (30). gD-gECT also showed limited colocalization with Tf receptors, early endosomes labeled by incubation with Alexa 594-conjugated Tf for 15 min and to a lesser extent with
late endosomes/lysosomes, where the label was chased for 30 additional
min (Fig. 4A). The presence of gD-gECT in endosomal compartments suggested that the glycoprotein might be cycling between
the plasma membrane and the TGN in a manner analogous to TGN46. By
contrast, the distribution of gD-gICT was very different; the glycoprotein did not colocalize with calreticulin, the MPR, or the
Tf receptor and was found predominantly on the cell surfaces (Fig. 4B).
Therefore, the CT domain of gE causes gD to accumulate in the TGN,
whereas the CT domain of gI did not substantially alter the largely
cell surface distribution of gD.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
Subcellular localization of gD-gECT and
gD-gICT compared with that of other cellular markers.
HEC-1A cells were coinfected with either AdgD-gECT and
Ad-Trans (A) or AdgD-gICT and Ad-Trans (B) as described in
the legend to Fig. 3. The cells were stained with anti-gD MAb DL6
(green) and rabbit anticalreticulin antibodies or rabbit anti-MPR
antibody (red) followed by Alexa 594-conjugated goat anti-rabbit IgG
and Alexa 488-conjugated goat anti mouse IgG. Staining for early
endosomes involved incubation with Alexa 594-conjugated Tf (red) for 15 min at 37°C, followed by washing and immediate fixation. Late
endosomes/lysosomes were stained as for early endosomes, except that
there was a further incubation at 37°C for 30 min.
|
|
Accumulation of gE/gI and gD-gECT in the TGN compared
with previous results showing accumulation of gE/gI at cell
junctions.
In an earlier study, gE/gI expressed by using Ad
vectors accumulated primarily at cell junctions (17).
Here, gD-gECT, gE, and gE/gI were all found predominantly
in the cytoplasm, colocalizing extensively with TGN46. In these more
recent experiments, accumulation of gE, gE/gI, and gD-gECT
in the TGN was observed at early (24 h) and later (48 and 72 h)
times after infection with these replication defective
(E1
) Ad vectors, as well as with substantially different
amounts of input virus (25 to 800 PFU/cell, as determined by titering on 293 cells) (data not shown). Thus, broadly different expression levels did not produce a different picture. Moreover, gE/gI, gE, and
gD-gECT expressed using these Ad vectors in MDBK (bovine
kidney epithelia) and ARPE-19 (human retinal epithelial) cells also
accumulated in the TGN (data not shown). This discrepancy appears to
relate to differences in the methods for staining of gE/gI in this
study compared with the previous study. In the previous work
(17), cells expressing gE/gI were stained with a mouse MAb
specific for
-catenin, followed by a secondary goat anti-mouse
conjugated to Texas Red; then the cells were washed and stained with
mouse anti-gE MAb 3114 which had been modified with Oregon Green (a fluorescein analog), followed by BODIPY-conjugated goat antifluorescein antibodies. In reviewing this protocol, we realized that there was the
potential for mouse anti-gE MAb used in the second round of staining to
bind to anti-mouse IgG antibodies used in the first round of staining.
To determine if this was the case, we repeated this protocol, adding an
additional step in which the cells were incubated with mouse serum, to
block any remaining sites on goat anti-mouse IgG antibodies, after the
first step of staining and before addition of the anti-gE MAb. Using
this blocking step, gE/gI was found in a perinuclear distribution (Fig.
5B), whereas without blocking with mouse
serum, gE/gI appeared largely at cell junctions in a distribution
identical to that of
-catenin (Fig. 5A). The perinuclear
localization of gE/gI was also observed when cells were stained with
anti-gE MAb 3114 alone (no anti-
-catenin antibodies), at 24, 48, and
72 h postinfection with Ad vectors, and using rat polyclonal
anti-gE/gI antibodies (not shown). Therefore, it appears that the
actual distribution of gE/gI expressed using these Ad vectors is in the
TGN, rather than on the cell surface at cell junctions.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 5.
gE/gI accumulate in the TGN, rather than at cell
junctions, in Ad-infected cells. HEC-1A cells were infected with
Ad(E1 )gE and Ad(E1 )gI for 24 h and
then stained by one of two methods. In panel A, the cells were stained
essentially as previously described (17). The cells were
incubated with a mouse MAb specific for -catenin, followed by Alexa
594-conjugated goat anti-mouse IgG antibodies. The cells were washed
and incubated with Oregon Green (a fluorescein analog) conjugated
anti-gE MAb 3114, washed, and incubated with goat anti-fluorescein
antibodies conjugated to Alexa 488. In panel B, the same protocol was
followed except that following the Alexa 594-conjugated goat anti-mouse
IgG antibodies, the cells were incubated with 2% mouse serum for
2 h, in order to prevent the anti-mouse antibodies from reacting
with MAb 3114.
|
|
HSV-1 infection causes both gE/gI and TGN46 to move from the TGN to
cell junctions, but infection with a gI- HSV mutant does not have this
effect.
In previous studies, the distribution of gE/gI was
characterized in HSV-infected cells, 12 h after infection, and
gE/gI was found predominantly at cell junctions, although there was
also some gE/gI observed in cytoplasmic vesicles (17, 58).
In both of these studies, HSV-infected cells were stained with rabbit polyclonal antibodies specific for
-catenin and simultaneously with
mouse anti-gE MAb 3114. Therefore, there was no possibility for
cross-reactivity of secondary antibodies, and we expected that this
staining represents the true distribution of anti-
-catenin and gE.
To further characterize this, we infected HEC-1A cells with wild-type
HSV-1 and compared the distribution of gE (green), TGN46 (red), and
-catenin (blue) simultaneously at early and later times after
infection. After 5 h of infection, gE was exclusively in
cytoplasmic vesicles colocalizing extensively with TGN46 and not with
-catenin (Fig. 6, row 1). Note that
the cell in upper center of the upper panels, marked with a white
arrow, was not infected and showed perinuclear TGN46 (red) but no gE
staining, while other HSV-infected cells showed primarily yellow
staining (red and green combined). After 11 h of infection with
wild-type HSV, gE was seen more extensively on the cell surface,
colocalizing with
-catenin (Fig. 6, row 2). Of particular interest,
TGN46 also moved extensively to cell junctions by 11 h of infection with wild-type HSV (colocalization of all three fluorophores appears white). When cells were infected for 11 h and stained with
anti-TGN antibody alone, i.e., without anti-gE and anti-
-catenin
antibodies, TGN46 was also found at cell junctions (not shown). These
results demonstrate that gE/gI produced in cells infected with
wild-type HSV-1 gE/gI initially accumulates in the TGN, but
progressively moves to lateral cell surfaces and specifically to cell
junctions, at late times. Coincident with this movement, TGN46 was
redistributed to lateral surfaces as well.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 6.
gE/gI accumulates in the TGN early after infection with
wild-type HSV-1 but moves to cell junctions late in the infection.
HEC-1A cells were infected with wild-type HSV-1 or with F-US7kan, a
gI-negative HSV mutant. After 5 or 11 h, the cells were fixed,
permeabilized, incubated with blocking buffer, and then incubated with
sheep anti-TGN46 (red) for 1 h. The cells were then washed and
incubated with donkey anti-sheep IgG coupled to Alexa 594. The cells
were washed, blocked with 2% goat serum and 2% BSA, and then
incubated simultaneously with a rat polyclonal serum specific for gE/gI
(green) and rabbit serum specific for -catenin (blue). The cells
were washed and incubated with Alexa 488-conjugated goat anti-rat IgG
antibodies and CY5-conjugated goat anti-rabbit IgG antibodies for
1 h. The cells were viewed by laser scanning confocal microscopy.
The red, green, and blue channels were superimposed in the right panels
(All markers).
|
|
After 5 h of infection of HEC-1A cells with F-US7kan, a mutant
that does not express gI, gE was also predominantly in the TGN,
colocalizing with TGN46 (Fig. 6, row 3). In some cells infected with
F-US7kan, there was a fraction of gE that appeared to be in
nonvesicular cytoplasmic structures, which did not stain with TGN46
antibodies. Importantly, and in contrast to the results with wild-type
HSV-1, at 11 h of infection with F-US7kan, gE was found primarily
sequestered in the TGN (Fig. 6, row 4). Moreover, TGN46 also did not
move to lateral cell surfaces without gI. These are very striking
observations, suggests that gE/gI, or at least gI, participates in, or
is essential for, redistribution of gE/gI and TGN46 to lateral cell surfaces.
To determine whether gE/gI expressed by Ad vectors can be redistributed
to the cell surface after superinfection of cells with HSV-1, HEC-1A
cells were infected with Ad(E1
)gE and
Ad(E1
)gI for 24 h and subsequently infected with an
HSV gE
mutant, F-gE
. In cells that were not infected
with F-gE
, and at early times after F-gE
infection (7 h), the gE
remained in the TGN (Fig. 7A). After
9 h of infection with the HSV gE
mutant, a small
portion of the gE was observed at cell junctions, and by 11 h a
large fraction of the gE was localized at cell junctions (Fig. 7B).

View larger version (139K):
[in this window]
[in a new window]
|
FIG. 7.
HSV infection causes redistribution of gE/gI expressed
by Ad vectors to lateral cell surfaces. HEC-1A cells were
coinfected with 1 Ad(E1 )gE and Ad(E1 )gI;
after 24 h the cells were infected with F-gE (a
gE mutant) or were left uninfected. Cells were fixed at
7, 9, or 11 h after HSV infection and stained for TGN46, -catenin,
and gE as described in the legend to Fig. 6. Only the gE signal is
presented here. The TGN46 stain extensively overlapped that of gE in
cells left uninfected or HSV infected for 7 h, and the -catenin
stain overlapped extensively with the gE stain in cells infected with
HSV for 11 h.
|
|
Endocytosis of the Tf receptor and gE/gI is not altered by HSV
infection.
Cellular proteins that are resident in the TGN
frequently recycle from endosomes and from the plasma membrane via
endosomes. If endocytosis were to be inhibited, these membrane proteins
could accumulate on the cell surface. Thus, inhibition of endocytosis could explain the movement of HSV gE/gI and TGN46 to the cell surface.
It was reported that PrV inhibits the endocytosis of gE/gI, gB, and the
Tf receptor after 6 h of infection (48, 50).
To examine the effects of HSV infection on endocytosis of a cellular
protein, we characterized uptake of the Tf receptor. Uptake of
125I-labeled Tf was measured in uninfected HEC-1A cells and
in cells infected with HSV-1 for 4, 8, and 12 h. Preceding the
uptake experiments, we measured the number of Tf receptors present on
cells, by binding labeled Tf at 4°C for 3 min. There was a steady
increase in the number of available Tf receptors on the surfaces of
cells during infection, apparently related to release of Tf receptors
from intracellular sites to the plasma membrane (not shown). For uptake experiments, cells were incubated with labeled Tf at 37°C for 3, 6, 9, or 12 min and then washed with acid buffer to remove surface label.
Control experiments at 4°C indicated that the acid buffer removed
over 99% of the surface label. No measurement of uptake at time zero
was made because binding had not occurred at this point. Measurements
of Tf uptake after various times of HSV infection demonstrated that
there was no change in the kinetics of Tf uptake until 12 h of HSV
infection (Fig. 8). Given that gE/gI was
largely redistributed to lateral surfaces by 11 h, endocytosis measurements were not made after 12 h.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 8.
HSV-1 does not inhibit endocytosis of Tf. HEC-1A
cells were infected with wild-type HSV-1 for 4, 8, or 12 h or left
uninfected. Specific binding of Tf was assessed by washing the cells in
ice-cold uptake medium followed by a 1-h incubation with ice-cold
uptake medium containing 125I-labeled Tf in either the
presence or absence of a 1,000-fold excess of unlabeled Tf. Cells were
washed and lysed with detergent, and cell-associated radioactivity was
counted. Uptake of Tf was assessed by washing the cells with serum-free
medium at 37°C and incubating cells for 3, 6, 9, or 12 min with
125I-Tf in either the presence or absence of excess
unlabeled Tf at 37°C. Following these incubations, surface Tf was
stripped from the cells by washing with 0.2 N acetic acid-0.5 M NaCl,
the cells were washed, and internalized radioactivity was counted.
Nonspecific binding or uptake (observed in the presence of excess
unlabeled Tf) was subtracted from the total binding or uptake to give
specific values. In all cases, nonspecific binding or uptake was less
than 10% of the total binding. Percent Tf internalized was calculated
by comparing the specific uptake at 37°C with the Tf that bound
specifically at 4°C. Data points represent the mean of duplicate
samples.
|
|
To examine internalization of gE/gI, HSV-infected cells were incubated
with 125I-labeled anti-gE antibody 3114. Uptake of 3114 was
observed at late times (12 h) of HSV infection (Fig.
9). Over 80% of the radiolabeled anti-gE
antibody that was bound to cells was internalized within 20 min. This
may or may not reflect the normal rates of internalization of gE/gI,
because the antibody could increase the uptake. However, gE/gI appears
to be free to be internalized, and there is no global inhibition of
endocytosis in HSV-infected cells until 12 h of infection.
Together these results suggest that HSV infection does not cause global
disruption of the endocytic machinery, at least until after 12 h
of infection, yet gE/gI relocalizes to lateral cell surfaces.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 9.
Internalization of radiolabeled anti-gE MAb 3114. HEC-1A cells that had been infected with wild-type HSV-1 for 12 h
or left uninfected were incubated with 125I-labeled MAb
3114, which is specific for gE, for 5, 10, 15, or 20 min at 37°C.
Surface antibodies were stripped by washing with 0.2 N acetic acid-0.5
M NaCl, the cells were washed further and lysed with detergent, and
radioactivity was counted.
|
|
 |
DISCUSSION |
When HSV gE/gI was expressed in epithelial cells using
replication-defective Ad vectors, the glycoprotein was found
predominantly in the TGN colocalizing with TGN46. This was also the
case during early stages of HSV infection, until 6 to 7 h.
However, at intermediate to late stages of HSV infection, by 11 h,
gE/gI moved to the lateral cell surfaces, to cell junctions,
colocalizing with
-catenin.
It bears repeating that transport of gE/gI is preferentially to cell
junctions; there is little or no glycoprotein on apical surfaces late
in HSV infection of epithelial cells (17, 58; Huber et
al., Abstr. 25th Int. Herpesvirus Workshop). This is not observed in
other cells which form less extensive cell junctions or which do not
become polarized. However, this said, the HEC-1A cell monolayers used
in many of the experiments shown here were not fully confluent; there
were free borders. Thus, a fraction of the cells were not in contact
with other cells along a portion of their surfaces. With these cells,
gE/gI accumulated extensively at cell junctions late after infection
with HSV, and there was much less or no gE/gI at those lateral surfaces
of cells that were not in contact with other cells, i.e., nonjunctional
surfaces. This was previously documented by Wisner et al.
(58) in experiments in which z-axis images were
collected, and this demonstrated accumulation at cell junctions rather
than on apical surfaces. It is important to note that
-catenin and
E-cadherin, components of adherens junctions, can also distribute
preferentially to cell junctions before cells are fully polarized (to
the extent that tight junctions ring the entire subapical lateral
surface and there is high transepithelial resistance). In fact,
formation of adherens junctions precedes that of tight junctions and is
a necessary prerequisite for tight junctions. Clearly, gE/gI can
accumulate at cell junctions in epithelial cells, whether or not cells
are fully polarized. However, it should also be noted that a large
fraction or majority of cells in these monolayers were considered to be
polarized, in that there was a ring of other cells surrounding them.
With these cells, extensive contacts were formed between cells,
including adherens junctions (see staining of
-catenin in Fig. 6,
similar staining was observed with anti-E-cadherin antibodies) and
tight junctions (staining with anti-ZO-1 antibodies). Whether or not
these cells were "fully" polarized, as defined by transfer of small
molecules across tight junctions, is not clear. Therefore, there is
directed transport of gE/gI to epithelial cell junctions and/or
retention there once the junctions are formed and regardless of whether cells are "fully" polarized.
The TGN localization of gE/gI seen early after HSV infection or in the
absence of HSV proteins, in Ad-infected cells, appears to be largely
due to the effects of the CT domain of gE, because a chimeric
glycoprotein composed of the HSV gE CT domain fused to gD was also
found exclusively in the TGN. Previous experiments demonstrated that
the CT domain of gE was necessary for cell-to-cell spread
(58), for accumulation at cell junctions in HSV-infected cells (a process that is intrinsically tied to TGN sorting)
(58), and for specific sorting of nascent virions to cell
junctions (28). We expect that the tyrosine motif
(YIRV468) in the CT domain of gE is involved in TGN
localization, linking gE to AP-1 clathrin adapter complexes (reviewed
in references 8, 19, and 36). This hypothesis is supported
by observations involving a similar tyrosine motif in VZV gE that
participates in TGN localization (1, 61). Moreover,
mutations affecting a tyrosine motif in the CT domain of PrV gE
compromised cell-to-cell spread (49). However, it is also
likely that the cluster of acidic residues in the CT domain of gE
(D476 WSSDSEGERDQ) plays an important role in TGN
localization. Similar acidic clusters in furin and in VZV gE, when
phosphorylated, bind to PACS-1, which can then link to clathrin adapter
complexes causing retrieval to the TGN (35, 53, 61).
By contrast to these results, a fusion protein including the gI CT
domain was found largely on the apical and lateral cell surfaces, as
was wild-type gD. Thus, the CT domain of HSV gI does not, on its own,
cause TGN localization in these cells. Previous studies of cellular
proteins have shown that dileucine motifs, similar to that in gI, can
cause endocytosis and TGN localization, but this was not seen in these
epithelial cells. The VZV gI was targeted to some extent to the TGN, as
well as to the plasma membrane, when expressed without gE by
transfection (54). However, there was little retrieval of
VZV gI from the surface to the TGN, but coexpression with VZV gE
promoted TGN localization (54). Thus, it appears that the
CT domain of VZV and HSV gI is less effective than that of gE in
causing TGN accumulation. Again, it is important to consider that the
dileucine motif may well augment the effects of the gE CT. Consistent
with the importance of the gI CT domain, PrV mutants lacking this
domain were less neurovirulent and compromised in transynaptic spread
(51). One of the most striking observations of the work
described here is that gI was required for movement of gE/gI from the
TGN to cell junctions during late stages of HSV infection. It seems
likely that the CT of gI and its dileucine motif function in this
process; this is under further study.
The extensive accumulation of gE and gE/gI in the TGN occurs during
early phases of HSV infection or after expression of proteins using Ad
vectors, but at intermediate to late times of infection, gE/gI moves to
the lateral surfaces, to cell junctions. One obvious explanation for
these observations was HSV-mediated inhibition of endocytosis or
recycling from endosomes or the cell surface plasma. Consistent with
this notion, Tirabassi and colleagues found that PrV uptake of gE- and
gB-specific antibodies, and of the Tf receptors, was inhibited after
6 h of PrV infection (48, 50). However, we found that
endocytosis of Tf receptors and of gE/gI was not inhibited by HSV
infection before 12 h of infection. Our results may differ from
that of Tirabassi et al. because the HSV may lack a viral function that
blocks endocytosis or this difference may relate to our use of
epithelial cells rather than nonpolarized PK15 cells. Nevertheless, HSV
does not cause global inhibition of the host endocytic machinery, at
least by 12 h; thus, this cannot explain the redistribution of
gE/gI to lateral cell surfaces. However, it is possible that HSV
inhibits intracellular recycling from endosomes back to TGN
compartments (35, 53), and this could redirect gE/gI from
these TGN compartments to endosomes and onward to the plasma membrane.
This possibility is under further study.
Our results appear to be closely related to two other sets of
observations. First, Brack et al. recently reported that PrV gE/gI
functions in envelopment of nucleocapsids in the cytoplasm (9). PrV mutants lacking gE, or the CT domain of gE, as
well as second glycoprotein, gM, accumulated large numbers of
unenveloped capsids in the cytoplasm. This suggests that gE/gI and gM
collaborate to drive envelopment of cytosolic capsids; i.e., budding
occurs into cytoplasmic membranes. When viewed in the context of the results presented here and previous reports from Gershon and colleagues involving VZV gE/gI (54, 60) and Whealy et al.
(56), it is likely that PrV, HSV, and VZV are all
enveloped predominately into the TGN. Second, we recently reported that
HSV virions were specifically delivered to the lateral surfaces, i.e.,
cell junctions of polarized epithelial cells, with 10- to 20-fold fewer
particles delivered to apical surfaces (28). gE, and
specifically the CT domain of gE, was required for this targeted
delivery of nascent virions to cell junctions. In the absence of gE or
its CT domain, there were 15- to 30-fold fewer virus particles at cell
junctions, and increased numbers particles on apical surfaces, in the
cell culture supernatants and accumulation of virions in cytoplasmic vesicles (28). Selective sorting of PrV to cell junctions
was also observed, and this process was enhanced by expression of the
µ1B subunit of AP-1 clathrin adapter complexes. Thus, in polarized cells, accumulation of gE/gI in the TGN appears to lead to envelopment there, followed by directed transport of nascent HSV and PrV virions to
cell junctions. Without gE/gI, or just the CT domains, particles are
misdirected and accumulate in the cytoplasm of epithelial cells.
The observation that TGN46 was also redistributed to lateral cell
surfaces has important implications for understanding the movement of
gE/gI from the TGN to lateral surfaces. TGN46 is a cellular protein
that rapidly recycles from endosomes to the TGN, without residing
extensively on the cell surface (21). Relocalization of
both gE and TGN46 to lateral surfaces required expression of gI in
cells. Since gI is extensively complexed with gE and is required for
gE/gI to function, it appears that this process is connected to the
movement of newly formed virions from intracellular membranes, i.e.,
the TGN, to cell epithelial junctions that occurs at intermediate to
late times of HSV infection (28). The simplest conclusion
is that the movement of gE/gI to cell junctions occurs as a consequence
of, or in association with, movement of virions to cell junctions. gE
is essential for movement of particles to cell junctions
(28), and apparently gI is important as well. It is not
clear why TGN46 also moves along with the virion during this process.
A model that attempts to describe the multiple effects of gE/gI in
mediating cell-to-cell spread is depicted in Fig.
10. In step 1 (budding), gE/gI
accumulates extensively in the TGN based on interactions with cellular
sorting machinery, AP clathrin adapters, PACS-1, and perhaps other
factors. This process likely involves recycling from endosomal
compartments and the plasma membrane. Other alphaherpesvirus
glycoproteins must also be targeted to this compartment through
interactions with tegument proteins, gE/gI, other glycoproteins (gM,
US9) or by mechanisms that have not yet been described. Envelopment of
cytosolic nucleocapsids occurs, probably driven by gE/gI and gM, and
enveloped virions are deposited within TGN vesicles. In step 2 (sorting), in epithelial cells, gE/gI apparently interacts with AP-1
clathrin adapters and perhaps other cellular sorting machinery, in part
through the gE CT domain, so that transport vesicles containing nascent virions are sorted to lateral cell surfaces, rather than apical domains
of the plasma membrane. This moves not only virions but also the
contents of the TGN to cell junctions. It is also conceivable that the
envelopment of capsids occurs in vesicles that have been previously
sorted to lateral cell surfaces. In this latter scenario, gE/gI and
other virions components assemble in a subset of TGN vesicles, those
that have previously interacted with cellular sorting machinery, so
that the contents of the vesicles are destined to lateral surfaces.
Once virions reach cell junctions, gE/gI can mediate binding to
cellular receptors there and entry into the apposing cell (step 3, receptor binding). This is based on evidence that gE/gI can accumulate
extensively at cell junctions and may be able to substitute for gD to
mediate cell-to-cell spread. Of course, other HSV glycoproteins (gD,
gB, and gH/gL) are also necessary for receptor binding and fusion of
the virion envelope with the recipient cell. Therefore, cell-to-cell
spread relies on both the CT domains of gE/gI that sort virus to cell
junctions and the extracellular domains that function to promote entry
into other host cells.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 10.
A model summarizing the effects of gE/gI in sorting of
virions to cell junctions and infection of neighboring cells. (1)
gE/gI, other HSV glycoproteins, and tegument components accumulate in
or at the TGN. Interactions between the CT domains of gE/gI and AP-1
clathrin adapter complexes are involved in the accumulation of gE/gI in
the TGN. Cytoplasmic nucleocapsids bind to regions enriched in viral
glycoproteins and envelopment occurs, delivering virions into the TGN
vesicles. The CT domains of gE/gI are involved in this envelopment
process, along with gM. (2) Vesicles containing nascent virions are
sorted to lateral domains of the cell surface and away from the apical
surface. This process requires the CT domains of gE/gI and involves
AP-1 clathrin adapters. (3) Transport vesicles fuse with the plasma
membrane, delivering virions into the space between two closely
connected cells. gE/gI interacts with cellular receptors to mediate
entry and infection of the apposing cell.
|
|
 |
ACKNOWLEDGMENTS |
We are very indebted to Aurelie Snyder for all her hard work and
valuable expertise with the laser scanning confocal and deconvolution software. We thank Mary Huber for advice and for carefully reading the
manuscript and Todd Wisner for excellent technical assistance, for
advice on confocal experiments, and for disposing of all the radioactivity. We are also grateful to Gary Thomas for advice and
antibodies, to the laboratory of Carolyn Enns for assistance with
transferrin uptake assays, and to Andrew Townsend for help with the
graphics. T.N.M. thanks Kim Goldsmith for watching his back throughout
this work.
This work was supported by National Institutes of Health grant CA73996.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Microbiology and Immunology, Oregon Health Sciences
University, Portland, OR 97201. Phone: (503) 494-0834. Fax: (503)
494-6862. E-mail: johnsoda{at}ohsu.edu.
 |
REFERENCES |
| 1.
|
Alconada, A.,
U. Bauer, and B. Hoflack.
1996.
A tyrosine-based motif and a casein kinase II phosphorylation site regulate the intracellular trafficking of the varicella-zoster virus glycoprotein I, a protein localized in the trans-Golgi network.
EMBO J.
15:6096-6110[Medline].
|
| 2.
|
Alconada, A.,
U. Bauer,
B. Sodeik, and B. Hoflack.
1999.
Intracellular traffic of herpes simplex virus glycoprotein gE: characterization of the sorting signals required for its trans-Golgi network localization.
J. Virol.
73:377-387[Abstract/Free Full Text].
|
| 3.
|
Altschuler, Y.,
S. M. Barbas,
L. J. Terlecky,
K. Tang,
S. Hardy,
K. E. Mostov, and S. L. Schmid.
1998.
Redundant and distinct functions for dynamin-1 and dynamin-2 isoforms.
J. Cell Biol.
143:1871-1881[Abstract/Free Full Text].
|
| 4.
|
Balan, P.,
N. Davis-Poynter,
S. Bell,
H. Atkinson,
H. Browne, and T. Minson.
1994.
An analysis of the in vitro and in vivo phenotypes of mutants of herpes simplex virus type 1 lacking glycoproteins gG, gE, gI or the putative gJ.
J. Gen. Virol.
75:1245-1258[Abstract/Free Full Text].
|
| 5.
|
Ball, J. M.,
Z. Moldoveaunu,
L. R. Melsen,
P. A. Kozlowski,
S. Jackson,
M. J. Mulligan,
J. F. Mestecky, and R. W. Compans.
1995.
A polarized human endometrial cell line that binds and transports polymeric IgA.
In Vitro Cell Dev. Biol.
31:196-206.
|
| 6.
|
Banting, G., and S. Ponnambalam.
1997.
TGN38 and its orthologues: roles in post-TGN vesicle formation and maintenance of TGN morphology.
Biochim. Biophys. Acta
1355:209-217[Medline].
|
| 7.
|
Bell, S.,
M. Cranage,
L. Borysiewicz, and T. Minson.
1990.
Induction of immunoglobulin G Fc receptors by recombinant vaccinia viruses expressing glycoproteins E and I of herpes simplex virus type 1.
J. Virol.
64:2181-2186[Abstract/Free Full Text].
|
| 8.
|
Bonifacino, J. S., and E. C. Dell'Angelica.
1999.
Molecular bases for recognition of tyrosine-based sorting signals.
J. Cell Biol.
145:923-926[Free Full Text].
|
| 9.
|
Brack, A. R.,
B. G. Klupp,
H. Granzow,
R. Tirabassi,
L. W. Enquist, and T. C. Mettenleiter.
2000.
Role of the cytoplasmic tail of pseudorabies virus glycoprotein E in virion formation.
J. Virol.
74:4004-4016[Abstract/Free Full Text].
|
| 10.
|
Brunetti, C. R.,
K. S. Dingwell,
C. Wale,
F. L. Graham, and D. C. Johnson.
1998.
Herpes simplex virus gD and virions accumulate in endosomes by mannose-6-phosphate-dependent and -independent mechanisms.
J. Virol.
72:3330-3339[Abstract/Free Full Text].
|
| 11.
|
Campadelli, G.,
R. Brandimarti,
C. Di Lazzaro,
P. L. Ward,
B. Roizman, and M. R. Torrisi.
1993.
Fragmentation and dispersal of Golgi proteins and redistribution of glycoproteins and glycolipids processed through the Golgi apparatus after infection with herpes simplex virus 1.
Proc. Natl. Acad. Sci. USA
90:2798-2802[Abstract/Free Full Text].
|
| 12.
|
Card, J. P., and L. W. Enquist.
1995.
Neurovirulence of pseudorabies virus.
Crit. Rev. Neurobiol.
9:137-162[Medline]. (Erratum, 9: preceding 311.)
|
| 13.
|
Chapman, T. L.,
I. You,
I. M. Joseph,
P. J. Bjorkman,
S. L. Morrison, and M. Raghavan.
1999.
Characterization of the interaction between the herpes simplex virus I Fc receptor and immunoglobulin G.
J. Biol. Chem.
274:6911-6919[Abstract/Free Full Text].
|
| 14.
|
Cohen, J. I., and H. Nguyen.
1997.
Varicella-zoster virus glycoprotein I is essential for growth of virus in Vero cells.
J. Virol.
71:6913-6920[Abstract].
|
| 15.
|
Dingwell, K. S.,
C. R. Brunetti,
R. L. Hendricks,
Q. Tang,
M. Tang,
A. J. Rainbow, and D. C. Johnson.
1994.
Herpes simplex virus glycoproteins E and I facilitate cell-to-cell spread in vivo and across junctions of cultured cells.
J. Virol.
68:834-845[Abstract/Free Full Text].
|
| 16.
|
Dingwell, K. S.,
L. C. Doering, and D. C. Johnson.
1995.
Glycoproteins E and I facilitate neuron-to-neuron spread of herpes simplex virus.
J. Virol.
69:7087-7098[Abstract].
|
| 17.
|
Dingwell, K. S., and D. C. Johnson.
1998.
Herpes simplex virus gE/gI facilitates cell-to-cell spread and binds to components of cell junctions.
J. Virol.
72:8933-8942[Abstract/Free Full Text].
|
| 18.
|
Edson, C. M.
1993.
Phosphorylation of neurotropic alphaherpesvirus envelope glycoproteins: herpes simplex virus type 2 gE2 and pseudorabies virus gI.
Virology
195:268-270[CrossRef][Medline].
|
| 19.
|
Folsch, H.,
H. Ohno,
J. S. Bonifacino, and I. Mellman.
1999.
A novel clathrin adaptor complex mediates basolateral targeting in polarized epithelial cells.
Cell
99:189-198[CrossRef][Medline].
|
| 20.
|
Geraghty, R. J.,
C. Krummenacher,
G. H. Cohen,
R. J. Eisenberg, and P. Spear.
1998.
Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor.
Science
280:1618-1620[Abstract/Free Full Text].
|
| 21.
|
Ghosh, R. N.,
W. G. Mallet,
T. T. Soe,
T. E. McGraw, and F. R. Maxfield.
1998.
An endocytosed TGN38 chimeric protein is delivered to the TGN after trafficking through the endocytic recycling compartment in CHO cells.
J. Cell Biol.
142:923-936[Abstract/Free Full Text].
|
| 22.
|
Hanke, T.,
F. L. Graham,
V. Lulitanond, and D. C. Johnson.
1990.
Herpes simplex virus IgG Fc receptors induced using recombinant adenovirus vectors expressing glycoproteins E and I.
Virology
177:437-444[CrossRef][Medline].
|
| 23.
|
Hirst, J., and M. S. Robinson.
1998.
Clathrin and adaptors.
Biochim. Biophys. Acta
1404:173-193[Medline].
|
| 24.
|
Hitt, M.,
A. J. Bett,
C. L. Addison,
L. Prevec, and F. L. Graham.
1995.
Techniques for human adenovirus vector construction and characterization.
Methods Mol. Genet.
78:13-30.
|
| 25.
|
Johnson, D. C., and V. Feenstra.
1987.
Identification of a novel herpes simplex virus type 1-induced glycoprotein which complexes with gE and binds immunoglobulin.
J. Virol.
61:2208-2216[Abstract/Free Full Text].
|
| 26.
|
Johnson, D. C.,
M. C. Frame,
M. W. Ligas,
A. M. Cross, and N. D. Stow.
1988.
Herpes simplex virus immunoglobulin G Fc receptor activity depends on a complex of two viral glycoproteins, gE and gI.
J. Virol.
62:1347-1354[Abstract/Free Full Text].
|
| 27.
|
Johnson, D. C., and M. W. Ligas.
1988.
Herpes simplex viruses lacking glycoprotein D are unable to inhibit virus penetration: quantitative evidence for virus-specific cell surface receptors.
J. Virol.
62:4605-4612[Abstract/Free Full Text].
|
| 28.
|
Johnson, D. C.,
M. Webb,
T. W. Wisner, and C. Brunetti.
2000.
Herpes simplex virus gE/gI sorts nascent virions to epithelial cell junctions, promoting virus spread.
J. Virol.
75:821-833[Abstract/Free Full Text].
|
| 29.
|
Kimura, H.,
S. E. Straus, and R. K. Williams.
1997.
Varicella-zoster virus glycoproteins E and I expressed in insect cells form a heterodimer that requires the N-terminal domain of glycoprotein I.
Virology
233:382-391[CrossRef][Medline].
|
| 30.
|
Kornfeld, S.
1992.
Structure and function of the mannose 6-phosphate/insulinlike growth factor II receptors.
Annu. Rev. Biochem.
61:307-330 |