Previous Article | Next Article 
Journal of Virology, February 2001, p. 1879-1887, Vol. 75, No. 4
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.4.1879-1887.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Alfalfa Mosaic Virus Replicase Proteins P1 and P2
Interact and Colocalize at the Vacuolar Membrane
Maurice W.
Van Der
Heijden,1
Jan E.
Carette,2
Poula J.
Reinhoud,1
Anita
Haegi,1 and
John F.
Bol1,*
Institute of Molecular Plant Sciences,
Gorlaeus Laboratories, Leiden University, 2300 RA
Leiden,1 and Laboratory of Molecular
Biology, Wageningen University & Research Centre, 6703 HA
Wageningen,2 The Netherlands
Received 14 August 2000/Accepted 9 November 2000
 |
ABSTRACT |
Replication of Alfalfa mosaic virus (AMV) RNAs depends
on the virus-encoded proteins P1 and P2. P1 contains methyltransferase- and helicase-like domains, and P2 contains a polymerase-like domain. Coimmunoprecipitation experiments revealed an interaction between in
vitro translated-P1 and P2 and showed that these proteins are present
together in fractions with RNA-dependent RNA polymerase activity. A
deletion analysis in the yeast two-hybrid system showed that in P1 the
C-terminal sequence of 509 amino acids with the helicase domain was
necessary for the interaction. In P2, the sequence of the N-terminal
241 aa was required for the interaction. In infected protoplasts, P1
and P2 colocalized at a membrane structure that was identified as the
tonoplast (i.e., the membrane that surrounds the vacuoles) by using a
tonoplast intrinsic protein as a marker in immunofluorescence studies.
While P1 was exclusively localized on the tonoplast, P2 was found both
at the tonoplast and at other locations in the cell. As Brome
mosaic virus replication complexes have been found to be
associated with the endoplasmic reticulum (M. A. Restrepo-Hartwig
and P. Ahlquist, J. Virol. 70:8908-8916, 1996), viruses
in the family Bromoviridae apparently select different cellular membranes for the assembly of their replication complexes.
 |
INTRODUCTION |
The alphavirus-like superfamily
comprises a large number of animal and plant viruses sharing the
properties of a capped, positive-stranded RNA genome and homologies in
their RNA replication proteins. Despite homologies between the
guanylytransferase/methyltransferase-like (MT), helicase-like
(HEL), and polymerase-like (POL) domains, they may be expressed as
parts of a single protein or as separate entities distributed over two
or three proteins. Little is known about the nature of the interactions
between these polypeptides and the ratio in which they are present in
the viral replication complex, although purified RNA-dependent RNA
polymerases (RdRp) have been used extensively to study viral
replication in vitro. We have studied the interactions between the
replicase proteins of Alfalfa mosaic virus (AMV) and their
in situ localization to gain insight in the assembly of the replication complex.
AMV is the type species of the genus Alfamovirus. It belongs
to the Bromoviridae family of plant viruses, all having a
tripartite RNA genome of messenger-sense polarity. RNA 3 encodes the
movement protein (MP) and, via a subgenomic mRNA 4, the coat protein
(CP). RNAs 1 and 2 encode the P1 and P2 replicase proteins,
respectively. The N terminus of P1 contains a domain with sequence
homology to the domains involved in RNA capping of the alphavirus
Semliki Forest virus (SFV) nsP1 protein and the more
closely related Brome mosaic virus (BMV) 1a protein
(1, 2, 41). The C-terminal end of P1 has homology to
the alphavirus-like supergroup of HEL domains (17, 22),
including the SFV nsP2 protein, for which helicase activity
was recently shown in vitro (16). The P2 protein contains
a central domain with sequence motifs conserved among many polymerases,
including the presence of the Mg2+-binding GDD motif
(3, 26). The N terminus of P2 does not contain conserved
sequence elements. The corresponding sequence of the BMV 2a polymerase
protein has been shown to interact with the HEL domain of the BMV 1a
protein (23).
In addition to P1 and P2, CP is involved in AMV replication (reviewed
in reference 4). CP in the inoculum is required in a step
prior to viral minus-strand RNA synthesis, possibly translation of the
inoculum RNAs (31, 32). Subsequently, CP expressed from
RNA 3 is required for viral plus-strand RNA accumulation in vivo
(31, 48) and in vitro (11).
The replication complexes of all eukaryotic positive-stranded RNA
viruses studied so far are associated with intracellular membranes.
Alphavirus RNA replicase proteins are localized on the cytoplasmic
surface of endosomes and lysosomes, probably connected with the
50-nm membrane-associated vesicles that occupy these organelles
(14). Endoplasmic reticulum (ER)-derived 50- to
100-nm cytoplasmic vesicles detected in bromovirus-infected plants
localize with the site of replication of BMV (39).
Replication complexes of other plant viruses are localized in vesicular
structures derived from chloroplast membranes or believed to be
associated with vesicles on the tonoplast, i.e., the membrane
surrounding the vacuoles (19, 29).
In this paper we provide in vitro and in vivo evidence for the
interaction between the AMV P1 and P2 replication proteins and show
that the HEL domain of P1 and the nonconserved N terminus of P2 are
involved in this interaction. In addition, we found a colocalization of
P1 and P2 at the tonoplast of infected cowpea protoplasts.
 |
MATERIALS AND METHODS |
Construction of two-hybrid plasmids.
AMV P1 and P2 genes
were fused to the binding and activation domains of GAL4 encoded by the
yeast expression vectors pGBT9, pGAD424, pAS2-1, and pACT2 (Clontech)
as follows. The P1 coding sequence plus 3' untranslated region (3'-UTR)
and nos-terminator were excised from pCa17T-Nco (52) with
NcoI and PvuII. This sequence was ligated into a
NcoI-SmaI digested pUC21 plasmid to give pUC-P1.
The P1 sequence was removed using XhoI and PstI
and ligated into SalI-PstI digested pGBT9,
giving clone pBP1 (1-1126). Similarly, a
XhoI-BamHI fragment was cloned in pGAD424
digested with SalI and BglII, to yield plasmid
pAP1(1-1126). The resulting fusion proteins contain a 14-amino-acid
(aa) linker peptide at the junction with P1.
N- and C-terminal deletions of P1 were made by digesting pBP1(1-1126)
or pAP1(1-1126) with the appropriate endonucleases. T4 DNA polymerase
was used to generate blunt ends. The following enzymes were used (P1
amino acids encoded by the restriction fragments are given in
parentheses): SmaI-NdeI (135 to 1126),
BamHI-HpaI (340 to 1126),
BamHI-PinAI (509 to 1126),
BamHI-EcoRV (618 to 1126),
BamHI-BspEI (654 to 1126), EcoRI (684 to 1126), and PinAI-PstI (1 to 509). Additional
C-terminal deletions were obtained by BglII-PstI digestion (509 to 997 and 618 to 997). Ligation of an
NcoI-EcoRI P1-encoding fragment from pCa17T-Nco
in pAS2-1 and pACT2 resulted in clones pBP1(1-686) and pAP1(1-686).
Part of P2 was amplified by PCR from pUT27A (infectious clone of RNA 2)
(
31) using a primer that introduces an
NdeI
restriction
site around the start codon and a primer complementary to
nucleotides
789 to 806 of RNA 2. The PCR product was digested with
NdeI and
SspI (position 612) and ligated in
NdeI-
SmaI-digested pUC21. An
XhoI
(position 262)-
StuI fragment of the resulting clone was
replaced
by an
XhoI-
SmaI sequence excised from
pUT27A, yielding pUC-P2.
This plasmid was digested by
NdeI,
treated with T4 DNA polymerase,
and digested with
PstI. The
fragment containing the P2 open reading
frame and RNA 2 3'-UTR was
ligated in pGAD424 and pGBT9, each
digested with
SmaI and
PstI, yielding AP2 and BP2, respectively.
This resulted in
the addition of a 4-aa linker peptide at the
junction of the open
reading
frames.
N- and C-terminal deletions of P2 were made by digesting pAP2(1-790)
or pBP2(1-790) with the appropriate endonucleases, and
T4 DNA
polymerase was used to generate blunt ends. The following
enzyme
combinations were used (P2 amino acids encoded by the restriction
fragments are given in parentheses):
PmlI-
PstI (1 to 608),
EcoRV-
PstI
(1 to 478),
PinAI-
PstI (1 to 352),
XmnI-
PstI (1 to 241),
Eco47III-
PstI
(1 to 156),
BamHI-
PinAI (1 to 44 and 352 to 790), and
EcoRI-
ClaI
(516 to 790).
EcoRI (76 to
478, 76-352, and 76-241) or
BamHI-
EcoNI
(118 to
478) was used to make additional N-terminal deletions.
pBP2(352-790) was constructed by ligation of a P2 fragment,
isolated
from pUC-P2 by digestion with
PinAI and
PstI, to pAS2-1 previously
cut with
NdeI and
PstI.
All enzymes used were from GIBCO/BRL, and all enzymatic incubations
were performed under conditions recommended by the supplier.
All
recombinant DNAs were checked by restriction mapping and nucleotide
sequence
analysis.
Construction of other plasmids.
pCaHA17T gives
Cauliflower mosaic virus 35S promoter-driven expression of
the P1 protein with an N-terminal fusion to a hemagglutinin (HA) tag.
Plasmid pCa17T-Nco (52) was digested with NcoI.
The HA sequence was inserted by ligation of a synthetic DNA fragment, obtained by hybridization of two oligonucleotides,
CATGTACCCATACGATGTTCCAGATTACGC and CATGGCGTAATCTGGAACATCGTATGGGTA.
For the construction of pMON-HA-SITIP, pPE1000 (
18) was
first modified to allow in-frame fusion of the HA epitope-coding
sequence with the cDNA of a tonoplast intrinsic protein (

-TIP)
(
20). The QuickChange site-directed mutagenesis method
(Stratagene)
was used to create an
XbaI site upstream and to
remove four bases
downstream of the HA epitope, using suitable primers.
From the
resulting plasmid, an
XbaI-
EcoRI
fragment was removed and ligated
in the multiple cloning site of
pMON999 (
46), giving pMON-HA.
The complete coding sequence
of

-TIP was released as an
EcoRI
fragment from
pGAD10-TIP, a clone isolated from an
Arabidopsis cDNA
library (J. E. Carette, unpublished results). This fragment
was
ligated in pMON-HA digested with the same
enzyme.
Plasmids pT7L4P1 and pT7L4P2 encode RNAs 1 and 2, respectively, with
the 5'-UTRs replaced by the 5'-UTR of RNA 4. They were
constructed by
replacing the CP gene and 3'-UTR in the cDNA 4
clone pT72-42NcoCP
(
49) (
NcoI-
EcoRI fragment) by a cDNA
1 sequence
with the P1 gene and 3'-UTR (to yield pT7L4P1) or a cDNA 2 sequence
with the P2 gene and 3'-UTR (to yield pT7L4P2). The cDNA 1 sequence
was derived from plasmids pUT17A (
31)
(
NcoI-
EcoRI fragment)
and pCa17T-Nco
(
52) (
NcoI-
NcoI fragment). The cDNA
2 fragment
was derived from plasmid pCa27T-Nco (
52)
(
NcoI-
SphI fragment).
The sequence downstream of
the initiation codon in pT7L4P2 was
restored to the wild-type P2
sequence using the Promega Altered
Sites in vitro mutagenesis system
with primer
AATACTTCCATCATGTTCACTCTTTTG.
pGEX-NP2 encodes a protein with aa 43 to 349 of P2 fused to the C
terminus of glutathione
S-transferase (GST). Vector pGEX-2T
(Amersham Pharmacia Biotech) was digested with
EcoRI. A cDNA
2
fragment was cut from pCa27T using
BamHI and
DraI. Vector and
insert were treated with T4 DNA polymerase
and ligated
together.
Antibodies.
The P1-specific rabbit polyclonal antibody was
directed against the C-terminal aa 1100 to 1120 of P1
(51). For detection of CP, we used a rabbit polyclonal
CP-specific antibody. An N-terminal fragment of P2 was overexpressed as
a GST fusion protein from pGEX-NP2 in Escherichia coli
strain BL21, cleaved with thrombin to remove the GST sequence, and used
to immunize rabbits for the production of anti-P2 polyclonal antiserum
(Eurogentec). The antibody against HA was a monoclonal mouse antibody
(12CA5; Roche). The fluorescein isothiocyanate (FITC)-labeled secondary
antibodies were from Jackson Laboratories; the Alexa-568- labeled
secondary antibodies were from Molecular Probes.
In vitro RNA transcription and translation.
AMV P1, P2, MP,
and CP were translated from RNA transcripts of plasmids pT7L4P1,
pT7L4P2, pAL3, and pT72-42, respectively. Transcription of linearized
plasmids with T7 RNA polymerase was done as described elsewhere
(31, 47). In vitro translation was done in a rabbit
reticulocyte lysate according to the protocol provided by the
manufacturer (Promega), with minor modifications.
Immunoprecipitation of in vitro translated proteins.
Precipitation was performed with 10 µl of in vitro-translated
protein, in the presence of 400 µl of NET-gel buffer (50 mM Tris [pH
7.5], 150 mM NaCl, 0.2% Igepal CA630, 1 mM EDTA, 0.25% teleostean
gelatin) and 2.5 µl of antibody. The sample was incubated at 4°C
under continuous rotation. After 60 min, 50 µl of a 50% protein
A-Sepharose CL-4B (Amersham Pharmacia Biotech) solution in NET-gel was
added, and incubation was continued for another 60 min. The beads were
washed three times with 1-ml portions of NET-gel buffer and washed once
with NET buffer (which contains no gelatin). The beads were resuspended
in 30 µl of protein loading buffer (27), and the samples
were boiled for 3 min and subjected to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After
electrophoresis, the gel was fixed, dried, and exposed to X-ray film.
Immunoprecipitation of RdRp complexes.
Proteins were
precipitated from 50 µl of RdRp glycerol fractions by 5 µl of
antibody in the presence of 800 µl of NET-gel buffer. The samples
were incubated and washed as described above. After electrophoresis,
the gel was analyzed by the Western blot technique (45).
Protoplast infection and immunofluorescent labeling.
Cowpea
(Vigna unguiculata cv. Blackeye) mesophyl protoplasts were
isolated and transfected with plasmid DNA as described elsewhere (46). The same protocol was used for infection of 5 × 105 protoplasts with 10 µg of phenol-extracted AMV
RNA. Protoplasts were incubated for 42 h at 25°C under continuous
illumination. Fixation and antibody incubations were performed as
described previously (50). Primary antibodies were diluted
1:100 (HA and P2 antibodies) or 1:1,000 (CP antibody) in blocking
buffer, which is phosphate-buffered saline containing 0.1% acetylated
bovine serum albumin (Aurion) and 0.02% teleostean gelatin (Sigma).
Goat anti-mouse or goat anti-rabbit antibodies conjugated to FITC or Alexa-568 were diluted 1:40 in blocking buffer. For nuclear staining, cells were incubated for 15 min with a 5-ng/ml solution of propidium iodide in phosphate-buffered saline-before the last washing step.
Confocal laser scanning microscopy (CLSM).
Immunofluorescence images were obtained with a Bio-Rad MRC-1024 ES
confocal microscope. Images with FITC-labeled antibodies were acquired
with an excitation wavelength of 488 nm and a 522 DF 32-nm band-pass
filter. The Alexa-568 antibody and propidium iodide nuclear stain were
detected with a 568-nm laserline and 585-nm long-pass filter. Images
were acquired using one laserline at a time to minimize background and
merged later using the Confocal Assistant 4.02 software. Each
experiment was performed at least three times to ensure the
reproducibility of the results.
Yeast two-hybrid system.
All yeast experiments were
performed with Saccharomyces cerevisiae strain PJ69-4A
(21), which carries the adenine (A) and histidine (H)
reporter genes. Yeast cells were grown on minimal synthetic medium
plates containing methionine and uracil (MU plates) plus other
selective components if required. Binding domain (pB) and activation
domain (pA) plasmids carry tryptophan (T) and leucine (L) auxotrophic
markers, respectively. Yeast transformations were performed as
described before (15). All pB and pA constructs were
separately transformed to yeast and plated on MUAHL or MUAHT medium.
Single transformants were maintained on these media, and colonies were
replated to medium lacking A and H to test for activation of the
reporter genes. Combinations of pB and pA constructs were cotransformed
and plated on MUAH medium. After 2 to 3 days on MUAH plates, single
colonies were transferred to both MUAH and MU plates to test for
interaction. Growth on selective medium was monitored over 6 days.
Double transformations were performed at least three times.
RdRp isolation and activity assay.
The RdRp was purified
from Nicotiana benthamiana plants infected with AMV strain
425 as described previously (37), omitting the DEAE
ion-exchange chromatography step. The glycerol gradient was subdivided
into 16 fractions that were assayed for in vitro RdRp activity
(37).
 |
RESULTS |
Interaction of P1 and P2 in the yeast two-hybrid system.
Viral
sequences were fused to the C terminus of the activation domain or DNA
binding domain of GAL4. When the N-terminal 352 aa of P2 were fused to
the binding domain, the construct showed activation of the
ADE and HIS3 genes in the absence of a P1
construct. Therefore, most of the P1 derivatives were fused to the
binding domain (pBP1 constructs), whereas the P2 derivatives were
mainly fused to the activation domain (pAP2 constructs). In addition, we tested a few constructs with P1 or P2 sequences fused to the activation or DNA binding domain, respectively (pAP1 and pBP2 constructs). Figure 1 shows schematic
representations of the full-length P1 and P2 proteins and a selection
of pBP1 and pAP2 constructs that were used in two-hybrid assays. Table
1 summarizes all P1-P2 interactions
tested. None of the constructs shown in Fig. 1 or Table 1 was able to
self-activate the ADE and HIS3 selectable marker
genes. Western blot analysis revealed stable expression in yeast of all
fusion proteins shown in Fig. 1 (data not shown). Growth of yeast on
nonselective (MUAH) or selective (MU) medium is shown in Fig. 1. No
growth was observed using full-length P1 and P2 (Fig. 1, row 2).
However, cotransformation with several constructs encoding C-terminal
P1 and N-terminal P2 sequences resulted in growth of the yeast cells.
Growth of colonies within 1 to 2 days was found with the C-terminal 618 aa of P1 [pBP1 (509-1126)] and the N-terminal 352 aa of P2 [pAP2
(1-352)] (Fig. 1, row 6; Table 1). N-terminal extension of this P1
sequence in pBP1(340-1126) did not affect this growth rate (Fig. 1,
row 5), but truncation to a sequence corresponding to the C-terminal
509 aa of P1 [pBP1(618-1126)] strongly reduced the growth rate (Fig.
1, row 7). When the C terminus of the P1 sequence in pBP1(509-1126)
was truncated by deleting 129 aa [pBP1(509-997)], the growth of
yeast colonies was abolished (Table 1). When the P2 sequence in
pAP2(1-352) was reduced to a sequence corresponding to the N-terminal
241 aa of P2 [pAP2(1-241)], growth was reduced (Fig. 1, compare rows
6 and 11). Further deletions at the N terminus [pAP2(75-242) and
pAP2(75-351)] or C terminus [pAP2(1-157)] of this P2 sequence
abolished growth (Table 1). With the N-terminal sequence of P1 (aa 1 to
509 or 1 to 686), no interaction with any P2 sequence was detectable
(Table 1). Similarly, no interaction was found between C-terminal
domains of P2 and any P1 sequence tested (Table 1).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 1.
Examples of interactions between AMV proteins in the
yeast two-hybrid system, 4 days after plating. Yeast cells were grown
on medium that does not select for interaction (MUAH) and medium that
selects for adenine and histidine auxotrophy (MU). In the schematic
representations of P1 and P2 segments fused to the GAL4 binding domain
(B) or activation domain (A) that were used to transform yeast cells,
GAL4 sequences are represented by black bars, MT, HEL, and POL, domains
and the proline cluster (PC) are hatched, and deletions are shown as
dotted lines. Typical interactions are shown along with positive and
negative controls (rows 12 and 1, respectively). Growth rates of yeast
cells are indicated by plus and minus signs as explained in the
footnote to Table 1.
|
|
CP is known to be present in purified AMV RdRp preparations
(
37). In the two-hybrid system, a strong CP-CP interaction
is
detectable (
44), resulting in fast growth on selective
medium
(Fig.
1, row 12; constructs pADCP and pBCP in Table
1). However,
no interaction of CP could be detected with any of the P1 or P2
domains
tested in the two-hybrid system (Table
1). In addition,
in yeast
transformed with several combinations of two P1 constructs
or two P2
constructs, no evidence for a P1-P1 or P2-P2 interaction
was obtained
(Table
1).
Coimmunoprecipitation of in vitro-translated P1 and P2.
To
confirm the interaction observed in the two-hybrid system, P1 and P2
were translated in a cell-free system and interaction between the
translation products was analyzed by coimmunoprecipitation. This assay
was also used to analyze a possible interaction of P1 or P2 with other
AMV proteins. Figure 2A shows the
products obtained by translation of the AMV proteins P1, P2, MP, and
CP, along with luciferase as a control: in Fig. 2B, the radiolabeled translation products were mixed with unlabeled P2 and subjected to
precipitation with a P2 antiserum. Labeled P1 coprecipitated with P2
(Fig. 2B, lane 2), but MP, CP, and luciferase did not. The P2 antiserum
did not precipitate P1 in the absence of P2 (Fig. 2B, lane 1). Addition
of RNase A (0.1 µg ml
1) to the translated proteins
before binding had no affect on precipitation (data not shown). These
results corroborate the interactions observed in the two-hybrid system
between P1 and P2 and the finding that an interaction between replicase
proteins and CP was not detectable. The fact that interaction between
full-length P1 and P2 was detectable by coimmunoprecipitation but not
in the two-hybrid system may be due to steric hindrance caused by the
activation or DNA binding domains in the yeast system or impaired
nuclear import of these large fusion proteins.

View larger version (128K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoprecipitation of in vitro-translated proteins. AMV
P1, P2, MP, and CP and luciferase (Luc.) were translated in a rabbit
reticulocyte lysate in the presence of [35S]methionine,
and samples of the translation mixtures were analyzed by SDS-PAGE (A).
The remaining parts of the translation mixtures were incubated with
nonlabeled P2 (except the lane 1, to which no P2 was added) (B) and
subjected to immunoprecipitation with a polyclonal anti-P2 serum
followed by SDS-PAGE. The labeled proteins in the translation mixtures
are indicated above the lanes. Positions of molecular size markers (in
kilodaltons) are indicated between the panels.
|
|
Coimmunoprecipitation of P1 and P2 from purified RdRp.
AMV
RdRp was solubilized from membrane structures sedimenting at
30,000 × g and centrifuged in a glycerol gradient
(37). The gradient was subdivided into 16 fractions, each
of which was analyzed for polymerase activity by an in vitro RdRp assay
and for the presence of P1, P2, and CP by Western blotting. Over 80% of the total RdRp activity was present in fractions 8 to 11, with a
peak of 37% in fraction 9 (Fig. 3A). The
sedimentation pattern of P1 (Fig. 3B) closely corresponded to the
distribution of the RdRp activity. P2 was present in all fractions that
showed RdRp activity, but the majority of P2 was found in the top
fractions of the gradient that showed little or no RdRp activity (Fig.
3C). The antiserum against CP detected CP monomers as well as CP
dimers. CP monomers were found in all fractions of the gradient,
particularly in the top and botton fractions, with relatively little CP
in the fractions that contained RdRp activity (Fig. 3E). CP dimers were
found exclusively in the top fractions and did not cosediment with RdRp
activity. We do not know why these dimers do not dissociate in the
presence of SDS and reducing agents in the gel loading buffer.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of AMV RdRp by glycerol gradient
centrifugation. Samples from each gradient fraction were assayed for
RdRp activity (A) and analyzed by Western blotting (B to E). RdRp
activity was measured in vitro, using plus-strand AMV RNA 3 as the
template; a gel run with the radiolabeled minus-strand RNA 3 products
is shown. Western blots were analyzed using polyclonal antibodies
against AMV proteins P1 (B), P2 (C), and CP (D and E). The antiserum
against CP detected CP dimers and monomers, which are separately shown
in panels D and E, respectively. Sedimentation is from right to left.
|
|
Fraction 9 of the gradient shown in Fig.
3 was incubated with antiserum
against P1, P2, or CP or with preimmune serum. After
incubation with
protein A-Sepharose, the immunoprecipitates were
run on an SDS-gel and
analyzed by Western blotting using the P1
(Fig.
4A) or CP (Fig.
4B) antiserum. P1 was
detectable in immunoprecipitates
obtained with the P1 and P2 antisera
but not in precipitates obtained
with the CP or preimmune serum (Fig.
4A). CP was detectable in
the precipitate obtained with the CP
antiserum but not in any
of the other three precipitates (Fig.
4B).
These results support
the notion that P1 and P2 are both subunits of
the RdRp complex,
while no interaction of CP with this complex was
detectable.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
Immunoprecipitation of RdRp complexes. RdRp purified by
glycerol gradient centrifugation (Fig. 3, fraction 9) was subjected to
immunoprecipitation with a polyclonal antiserum against P1, P2, or CP
or with preimmune (P.I.) serum, as indicated. The immunoprecipitates
were analyzed by Western blotting using antiserum against P1 (A) or CP
(B). The positions of P1 and CP are indicated at the right.
|
|
Localization of P1 and P2 in infected cowpea protoplasts.
A
possible colocalization of P1 and P2 in AMV-infected cowpea protoplasts
was analyzed by immunofluorescence CLSM. Using antibodies against CP,
it was determined by immunofluorescence that 10 to 50% of the
protoplasts were infected. The P1 antibody did not give a specific
signal in any of the cells (results not shown). The P2 antibody gave a
faint signal throughout the cytoplasmic part of the cell and distinct
labeling of the tonoplast (Fig. 5A).
Labeling was not concentrated around or near the nucleus (propidium
iodide staining shown in blue).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
In situ localization of P1 and P2 in AMV-infected cowpea
protoplasts by immunofluorescence microscopy. Each column of images
shows the analysis of a single protoplast, stained with a specific
antiserum (left) and with propidium iodide to reveal the nucleus
(middle); merge of the two stained images are shown at the right (A)
Two different protoplasts infected with wild-type (wt) AMV that were
analyzed with a polyclonal antiserum against P2. (B) Two different
protoplasts infected with AMV that was engineered to express HA-tagged
P1. The protoplasts were analyzed with an antiserum against the HA
epitope. (C) Protoplast transfected with a plasmid expressing -TIP
fused to an HA epitope. The protoplast was analyzed with an antiserum
against the HA epitope. Bar = 10 µm.
|
|
N. benthamiana plants were inoculated with wild-type AMV
cDNA 2 and 3 clones and a cDNA 1 clone encoding a P1 protein with
the N
terminus extended with an HA epitope. The modified virus
accumulated at
wild-type levels and expressed the HA-P1 protein
(results not shown).
RNA extracted from the purified chimeric
virus was used to inoculate
cowpea protoplasts. Analysis of the
protoplasts by immunofluorescence
CLSM with an HA antibody showed
a clear signal of tonoplast-associated
HA-P1 in 10 to 50% of the
cells (Fig.
5B). This percentage is similar
to the percentage
of fluorescent protoplasts obtained with antibodies
against P2
or CP. Double labeling with HA and P2 antibodies showed a
clear
colocalization of P1 and P2 around the vacuole (Fig.
6A). CP was
detected
throughout the cytoplasm, with no distinct pattern around
the
vacuole (Fig.
6B). The HA and P2 antibodies did not show background
labeling of healthy protoplasts (Fig.
6D).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of the colocalization of P1, P2, and CP in
AMV-infected cowpea protoplasts by immunofluorescence microscopy. Each
column of images shows the analysis of a single protoplast: left and
middle, protoplasts analyzed with specific antisera; right, the left
and middle images merged. (A) Two protoplasts infected with AMV that
was engineered to express HA-tagged P1. The protoplasts
were analyzed with antisera against the HA epitope (left) and P2
(middle). (B) Protoplast infected with AMV that was engineered to
express HA-tagged P1. The protoplast was analyzed with antisera against
the HA epitope (left) and CP (middle). (C) Two protoplasts transfected
with a plasmid expressing -TIP fused to an HA epitope. The
protoplasts were analyzed with antisera against HA (left) and P2
(middle). (D) Healthy protoplasts analyzed with antisera against the HA
epitope (left) and P2 (middle). (E) White-field picture of the lower
protoplast shown in panel C. Bar = 10 µm.
|
|
Colocalization with
-TIP.
When transfected to cowpea
protoplasts, plasmid pMON-HA-SITIP expressed
-TIP fused N-terminally
to the HA tag. The HA antibody detected the protein exclusively at the
tonoplast and sometimes around small vesicles (Fig. 5C). Cowpea
protoplasts cotransfected with wild-type AMV RNAs and pMON-HA-SITIP
were double labeled with antibodies against HA and P2. The
-TIP and
P2 proteins were found to colocalize at the tonoplast (Fig. 6C, merged
pictures). The white-field picture shown in Fig. 6E corresponds to the
protoplast analyzed in the lower panels of Fig. 6C. These results
confirm that the colocalization of P1 and P2 (Fig. 6A) occurs at the tonoplast.
 |
DISCUSSION |
P1 and P2 replication proteins interact in vitro and in vivo.
The AMV P1 and P2 proteins show similarities with their BMV 1a and 2a
counterparts in amino acid sequence and in the organization of the MT,
HEL, and POL domains. Thus, it was expected that AMV P1 and P2 would
interact in the same way as reported for BMV 1a and 2a (23,
24). The AMV P1-P2 interaction was demonstrated by co
immunoprecipitation of full-length in vitro-translated proteins and of
RdRp complexes purified from infected plants. Application of the yeast
two-hybrid system permitted the identification of C-terminal sequences
of P1 and N-terminal sequences of P2 that are involved in the P1-P2 interaction.
The HEL domains of BMV 1a and AMV P1 are part of protease-resistant
domains, which start with a proline cluster and end at
the C termini of
the proteins (
34) (domains indicated in Fig.
1). For the
1a protein, this protease resistance was destroyed
by a small
C-terminal deletion or by N-terminal deletions that
remove the proline
cluster. The study by O'Reilly et al. (
34)
showed a good
correlation between the presence of the protease-resistant
domain and
the ability of 1a to interact with 2a in the LexA two-hybrid
system. In
the AMV P1 protein, the protease-resistant domain and
proline cluster
are present between aa 654 and 1126 (
34), but
no
interaction of this sequence with the N terminus of P2 was
detectable
in our GAL4 two-hybrid system. The slightly longer
P1 sequence of aa
618 to 1126 showed a relatively weak interaction
with P2, as suggested
by the growth rate of the yeast cells. Extension
of the P1 sequence to
aa 509 to 1126 was required in our assays
to obtain maximum growth. The
P1 sequence upstream of the proline
cluster may act as a spacer
preventing the GAL4 DNA binding domain
from interfering with proper
folding of the protease-resistant
domain, or it may directly be
required for interaction with
P2.
The (putative) polymerases of alphavirus-like viruses, which express
their HEL and POL domains in separate proteins, have
N termini with
very low sequence similarity (ProDom 2000.1 database)
(
8).
The finding that for BMV this N terminus links the POL
protein to the
MT/HEL protein led to the hypothesis that this
N terminus coordinates
the assembly of a balanced number of MT/HEL
and POL units in
replication complexes (
23,
33). Our finding
that the
N-terminal 242 aa of AMV P2 are required for interaction
with the HEL
domain of P1 further supports the proposed role of
N termini of POL
proteins. The 1a proteins of BMV,
Cowpea chlorotic mottle
virus and
Cucumber mosaic virus (CMV) are able to form
homodimers, and it has been suggested that the 2a protein interacts
with a 1a dimer in the replication complex (
33,
35). A
similar
stoichiometry of two MT and HEL domains to one POL domain has
been observed in the complex of the 126K and 183K replicase proteins
of
Tobacco mosaic virus (TMV) (
53). For
BMV, 1a-1a dimerization
involved MT-MT as well as MT-HEL interactions
(
35). We did not
observe an interaction between
full-length AMV P1 proteins in
the two-hybrid system, although we could
detect the protein on
Western blots of yeast extracts (data not shown).
This may be
due to the relatively large size of the protein
(
13). However,
we were also unable to detect dimer
formation of the MT domain
present in the N-terminal P1 sequence of aa
1 to 686 [Table
1,
vectors pBP1(1-686) and pAP1(1-686)]. Moreover,
no interaction
of this sequence was observed with C-terminal sequences
of P1
that contain the HEL domain (Table
1). In addition, we did not
find evidence for a P2-P2 interaction. It is interesting that
fusions
of the N-terminal sequences of AMV P2 (this study) and
BMV 2a
(
33) to a DNA binding domain both resulted in
self-activation
of the selectable marker in yeast although the two
sequences show
very little similarity. The possibility that P2 and 2a
act as
transcriptional activators cannot be ruled
out.
It has been proposed that the stimulatory effect of CP on plus-strand
AMV RNA synthesis in an in vitro assay is triggered
by association of
CP with the viral RdRp (
11). We did not observe
an
interaction of CP with P1 or P2 in the two-hybrid system or
by
coimmunoprecipitation assays of in vitro-translated proteins.
Also, our
inability to precipitate the P1 present in the purified
RdRp by a CP
antiserum, or CP by a P1 or P2 antiserum, suggests
that CP does not
interact with the enzyme through a P1-P2 complex
or via a putative host
subunit of the enzyme. Possibly, CP stimulates
plus-strand RNA
synthesis by its RNA binding
activity.
Replication proteins localize at the tonoplast.
Infection of
plant cells by many positive-strand RNA viruses is accompanied with the
appearance of vesicular structures that originate from various cellular
membranes. For a few viruses it has been shown that the viral RdRp and
synthesis of viral RNA are associated with these structures; for
others, the accumulation of these structures has been observed only by
electron microscopy, and their role in RNA replication is unproven
(reviewed in references 10 and 28). Induction of vesicular
structures by Cowpea mosaic virus (CPMV) is due to
proliferation of the ER membrane and requires de novo biosynthesis of
lipids (6). TMV also replicates at the ER membrane, but
replication is not dependent on de novo lipid synthesis and the
membrane aggregates appear to be derived from preexisting ER (6,
38). Replication of Turnip yellow mosaic virus is
associated with small virus-induced invaginations of the chloroplast
membrane (29). Similar 50- to 70-nm vesicles are abundant
at the tonoplast of umbravirus-infected cells (12, 30).
The family
Bromoviridae consists of the genera
Alfamovirus, Ilarvirus, Bromovirus, Cucumovirus, and
Oleavirus (
36,
43).
So far, replication
proteins have been localized only in bromovirus-infected
cells. Many
ER-derived vesicles have been detected adjacent to
the nuclei of
bromovirus-infected cells, and the BMV 1a and 2a
proteins colocalize
with these structures (
5,
25,
39,
40).
Here, we showed
that the AMV replicase proteins P1 and P2 colocalize
at the tonoplast
of infected cells. This in situ localization
was verified by using an
intrinsic tonoplast protein as marker.
In sucrose gradients of
homogenates of AMV-infected cells, RdRp
activity has been reported to
cosediment with chloroplasts and
chloroplast membranes
(
9), but these fractions may have contained
tonoplast
structures as well. Although P1 was found exclusively
at the tonoplast
of infected protoplasts, P2 was detectable both
at the tonoplast and in
the cytoplasm. The cytoplasmic fraction
of P2 may correspond to P2 that
was detectable in the top fractions
of the gradient shown in Fig.
3.
Alternatively, this slow-sedimenting
P2 may have been released from
replication complexes during solubilization
of the RdRp. The BMV 1a
protein contains the sorting signal for
targeting of 1a and 2a to the
ER (
7,
40). By transient expression
of P1 and P2 fused to
the green fluorescent protein, we are currently
investigating the
signals responsible for targeting of the AMV
replicase to the
tonoplast.
The generation of ER-derived vesicles in CPMV- and TMV-infected cells
is accompanied by drastic alterations of the endomembrane
system
(
6,
38). No structural changes of the ER were observed
in
N. benthamiana plants infected with AMV (Carette,
unpublished).
By electron microscopy, tonoplast-associated vesicles
have been
observed in AMV-infected leaf tissue, appearing before
cytoplasmic
virus particles could be detected (28, 42; J. van Lent,
personal
communication). Similarly, the formation of
tonoplast-associated
vesicles protruding into the vacuole has been
reported for cucumovirus-infected
cells (
19,
28) and was
occasionally seen in cells infected
with the ilarvirus
Tobacco
streak virus (
28). The CMV-induced
vesicles were
found to contain double-stranded RNA, pointing to
a role of these
vesicles in RNA replication (
19). Our finding
that AMV P1
and P2 co-localize at the tonoplast corroborates the
assumption that
this membrane is the site of replication of alfamo-,
ilar-, and
cucumoviruses. Replication at the tonoplast or ER may
be used as a
diagnostic tool to further clarify the taxonomy of
viruses in the
family of
Bromoviridae.
 |
ACKNOWLEDGMENTS |
We thank P. James for providing yeast strain PJ69-4A, P. Ealing
for the pPE1000 plasmid, Gerda Lamers for help with the confocal microscope, Corrie Houwing for growing the cowpea plants, and Jan van
Lent and Joan Wellink for helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Molecular Plant Sciences, Gorlaeus Laboratories, Leiden University,
P.O. Box 9502, 2300 RA Leiden, The Netherlands. Phone: (31)715274749. Fax: (31)715274469. E-mail:
j.bol{at}chem.leidenuniv.nl.
 |
REFERENCES |
| 1.
|
Ahola, T., and P. Ahlquist.
1999.
Putative RNA capping activities encoded by brome mosaic virus: methylation and covalent binding of guanylate by replicase protein 1a.
J. Virol.
73:10061-10069[Abstract/Free Full Text].
|
| 2.
|
Ahola, T.,
P. Laakkonen,
H. Vihinen, and L. Kääriäinen.
1997.
Critical residues of Semliki Forest virus RNA capping enzyme involved in methyltransferase and guanylyltransferase-like activities.
J. Virol.
71:392-397[Abstract].
|
| 3.
|
Argos, P.
1988.
A sequence motif in many polymerases.
Nucleic Acids Res.
16:9909-9916[Abstract/Free Full Text].
|
| 4.
|
Bol, J. F.
1999.
Alfalfa mosaic virus and ilarviruses: involvement of coat protein in multiple steps of the replication cycle.
J. Gen. Virol.
80:1089-1102[Medline].
|
| 5.
|
Burgess, J.,
F. Motoyoshi, and E. N. Fleming.
1974.
Structural changes accompanying infection of tobacco protoplasts with two spherical viruses.
Planta
117:133-144[CrossRef].
|
| 6.
|
Carette, J. E.,
M. Stuiver,
J. W. M. van Lent,
J. Wellink, and A. van Kammen.
2000.
Cowpea mosaic virus infection induces a massive proliferation of endoplasmic reticulum but not Golgi membranes and is dependent on de novo membrane synthesis.
J. Virol.
74:6556-6563[Abstract/Free Full Text].
|
| 7.
|
Chen, J., and P. Ahlquist.
2000.
Brome mosaic virus polymerase-like protein 2a is directed to the endoplasmic reticulum by helicase-like viral protein 1a.
J. Virol.
74:4310-4318[Abstract/Free Full Text].
|
| 8.
|
Corpet, F.,
J. Gouzy, and D. Kahn.
1999.
Recent improvements of the ProDom database of protein domain families.
Nucleic Acids Res.
27:263-267[Abstract/Free Full Text].
|
| 9.
|
De Graaff, M.,
L. Coscoy, and E. M. J. Jaspars.
1993.
Localization and biochemical characterization of alfalfa mosaic virus replication complexes.
Virology
194:878-881[CrossRef][Medline].
|
| 10.
|
De Graaff, M., and E. M. J. Jaspars.
1994.
Plant viral RNA synthesis in cell-free systems (a literature review).
Annu. Rev. Phytopathol.
32:311-335[CrossRef].
|
| 11.
|
De Graaff, M.,
M. R. Man in 't Veld, and E. M. J. Jaspars.
1995.
In vitro evidence that the coat protein of alfalfa mosaic virus plays a direct role in the regulation of plus and minus RNA synthesis: implications for the life cycle of alfalfa mosaic virus.
Virology
208:583-589[CrossRef][Medline].
|
| 12.
|
Falk, B. W.,
T. J. Morris, and J. E. Duffus.
1979.
Unstable infectivity and sedimentable ds-RNA associated with lettuce speckles mottle virus.
Virology
96:239-248[CrossRef].
|
| 13.
|
Fields, S., and R. Sternglanz.
1994.
The two-hybrid system: an assay for protein-protein interactions.
Trends Genet.
10:286-292[CrossRef][Medline].
|
| 14.
|
Froshauer, S.,
J. Kartenbeck, and A. Helenius.
1988.
Alphavirus RNA replicase is located on the cytoplasmic surface of endosomes and lysosomes.
J. Cell Biol.
107:2075-2086[Abstract/Free Full Text].
|
| 15.
|
Gietz, R. D., and R. A. Woods.
1994.
High efficiency transformation in yeast, p. 121-134.
In
J. A. Johnston (ed.), Molecular genetics of yeast: practical approaches. Oxford University Press, Oxford, England.
|
| 16.
|
Gomez de Cedrón, M.,
N. Ehsani,
M. L. Mikkola,
J. A. García, and L. Kääriäinen.
1999.
RNA helicase activity of Semliki Forest virus replicase protein nsP2.
FEBS Lett.
448:19-22[CrossRef][Medline].
|
| 17.
|
Gorbalenya, A. E., and E. V. Koonin.
1989.
Viral proteins containing the purine NTP-binding sequence pattern.
Nucleic Acids Res.
17:8413-8440[Abstract/Free Full Text].
|
| 18.
|
Hancock, K. R.,
L. D. Phillips,
D. W. R. White, and P. M. Ealing.
1997.
pPE1000: a versatile vector for the expression of epitope-tagged foreign proteins in transgenic plants.
BioTechniques
22:861-865[Medline].
|
| 19.
|
Hatta, T., and R. I. B. Francki.
1981.
Cytopathic structures associated with tonoplasts of plant cells infected with cucumber mosaic and tomato aspermy viruses.
J. Gen. Virol.
53:343-346.
|
| 20.
|
Höfte, H.,
L. Hubbard,
J. Reizer,
D. Ludevid,
E. M. Herman, and M. J. Chrispeels.
1992.
Vegetative and seed-specific forms of tonoplast intrinsic protein in the vacuolar membrane of Arabidopsis thaliana.
Plant Physiol.
99:561-570[Abstract/Free Full Text].
|
| 21.
|
James, P.,
J. Halladay, and E. A. Craig.
1996.
Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast.
Genetics
144:1425-1436[Abstract].
|
| 22.
|
Kadaré, G., and A.-L. Haenni.
1997.
Virus-encoded RNA helicases.
J. Virol.
71:2583-2590[Medline].
|
| 23.
|
Kao, C. C., and P. Ahlquist.
1992.
Identification of the domains required for direct interaction of the helicase-like and polymerase-like RNA replication proteins of brome mosaic virus.
J. Virol.
66:7293-7302[Abstract/Free Full Text].
|
| 24.
|
Kao, C. C.,
R. Quadt,
R. P. Hershberger, and P. Ahlquist.
1992.
Brome mosaic virus RNA replication proteins 1a and 2a form a complex in vitro.
J. Virol.
66:6322-6329[Abstract/Free Full Text].
|
| 25.
|
Kim, K. S.
1977.
An ultrastructural study of inclusions and disease development in plant cells infected by cowpea chlorotic mottle virus.
J. Gen. Virol.
35:535-543.
|
| 26.
|
Koonin, E. V.
1991.
The phylogeny of RNA-dependent RNA polymerases of positive-strand RNA viruses.
J. Gen. Virol.
72:2197-2206[Abstract/Free Full Text].
|
| 27.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[CrossRef][Medline].
|
| 28.
|
Martelli, G. P., and M. Russo.
1985.
Virus-host relationships, symptomatological and ultrastructural aspects, p. 163-205.
In
R. I. B. Francki (ed.), Polyhedral virions with tripartite genomes. Plenum Press, New York, N.Y.
|
| 29.
|
Matthews, R. E. F.
1991.
Plant virology.
Academic Press, Inc., San Diego, Calif.
|
| 30.
|
Murant, A. F.,
R. A. Goold,
I. M. Roberts, and J. Cathro.
1969.
Carrot mottle a persistent aphid-borne virus with unusual properties and particles.
J. Gen. Virol.
4:329-341.
|
| 31.
|
Neeleman, L., and J. F. Bol.
1999.
Cis-acting functions of alfalfa mosaic virus proteins involved in replication and encapsidation of viral RNA.
Virology
254:324-333[CrossRef][Medline].
|
| 32.
|
Olsthoorn, R. C. L.,
S. Mertens,
F. Th. Brederode, and J. F. Bol.
1999.
A conformational switch at the 3' end of a plant virus RNA regulates viral replication.
EMBO J.
18:4856-4864[CrossRef][Medline].
|
| 33.
|
O'Reilly, E. K.,
J. D. Paul, and C. C. Kao.
1997.
Analysis of the interaction of viral RNA replication proteins by using the yeast two-hybrid assay.
J. Virol.
71:7526-7532[Abstract].
|
| 34.
|
O'Reilly, E. K.,
N. Tang,
P. Ahlquist, and C. C. Kao.
1995.
Biochemical and genetic analysis of the interaction between the helicase-like and polymerase-like proteins of the brome mosaic virus.
Virology
214:59-71[CrossRef][Medline].
|
| 35.
|
O'Reilly, E. K.,
Z. Wang,
R. French, and C. C. Kao.
1998.
Interactions between the structural domains of the RNA replication proteins of plant-infecting RNA viruses.
J. Virol.
72:7160-7169[Abstract/Free Full Text].
|
| 36.
|
Pringle, C. R.
1999.
Virus taxonomy 1999.
Arch. Virol.
144:421-429[CrossRef][Medline].
|
| 37.
|
Quadt, R.,
H. J. M. Rosdorff,
T. W. Hunt, and E. M. J. Jaspars.
1991.
Analysis of the protein composition of alfalfa mosaic virus RNA-dependent RNA polymerase.
Virology
182:309-315[CrossRef][Medline].
|
| 38.
|
Reichel, C., and R. N. Beachy.
1998.
Tobacco mosaic virus infection induces severe morphological changes of the endoplasmic reticulum.
Proc. Natl. Acad. Sci. USA
95:11169-11174[Abstract/Free Full Text].
|
| 39.
|
Restrepo-Hartwig, M. A., and P. Ahlquist.
1996.
Brome mosaic virus helicase- and polymerase-like proteins colocalize on the endoplasmic reticulum at sites of viral RNA synthesis.
J. Virol.
70:8908-8916[Abstract].
|
| 40.
|
Restrepo-Hartwig, M. A., and P. Ahlquist.
1999.
Brome mosaic virus RNA replication proteins 1a and 2a colocalize and 1a independently localizes on the yeast endoplasmic reticulum.
J. Virol.
73:10303-10309[Abstract/Free Full Text].
|
| 41.
|
Rozanov, M. N.,
E. V. Koonin, and A. E. Gorbalenya.
1992.
Conservation of the putative methyltransferase domain: a hallmark of the `Sindbis-like' supergroup of positive-strand RNA viruses.
J. Gen. Virol.
73:2129-2134[Abstract/Free Full Text].
|
| 42.
|
Rubio-Huertos, M.
1978.
Atlas on ultrastructure of plant tissues infected with viruses.
Consejo Superior de Investigaciones Científicas, Madrid, Spain.
|
| 43.
|
Rybicki, E. P.
1995.
Bromoviridae, p. 450-457.
In
F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo, and M. D. Summers (ed.), Virus taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses. Springer-Verlag, New York, N.Y.
|
| 44.
|
Tenllado, F., and J. F. Bol.
2000.
Genetic dissection of the multiple functions of alfalfa mosaic virus coat protein in viral RNA replication, encapsidation, and movement.
Virology
268:29-40[CrossRef][Medline].
|
| 45.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 46.
|
van Bokhoven, H.,
J. Verver,
J. Wellink, and A. van Kammen.
1993.
Protoplasts transiently expressing the 200K coding sequence of cowpea mosaic virus B-RNA support replication of M-RNA.
J. Gen. Virol.
74:2233-2241[Abstract/Free Full Text].
|
| 47.
|
van der Kuyl, A. C.,
L. Neeleman, and J. F. Bol.
1991.
Deletion analysis of cis- and trans-acting elements involved in replication of alfalfa mosaic virus RNA 3 in vivo.
Virology
183:687-694[CrossRef][Medline].
|
| 48.
|
van der Kuyl, A. C.,
L. Neeleman, and J. F. Bol.
1991.
Role of alfalfa mosaic virus coat protein in regulation of the balance between viral plus and minus strand RNA synthesis.
Virology
185:496-499[CrossRef][Medline].
|
| 49.
|
van der Vossen, E. A. G.,
L. Neeleman, and J. F. Bol.
1994.
Early and late functions of alfalfa mosaic virus coat protein can be mutated separately.
Virology
202:891-903[CrossRef][Medline].
|
| 50.
|
van Lent, J. W. M.,
M. Storms,
F. van der Meer,
J. Wellink, and R. W. Goldbach.
1991.
Tubular structures involved in movent of cowpea mosaic virus are also formed in infected cowpea protoplasts.
J. Gen. Virol.
72:2615-2623[Abstract/Free Full Text].
|
| 51.
|
van Pelt-Heerschap, H.
1987.
Immunochemical analysis of the alfalfa mosaic virus gene products. Ph.D. thesis.
Leiden University, Leiden, The Netherlands.
|
| 52.
|
van Rossum, C. M. A.,
M. L. Garcia, and J. F. Bol.
1996.
Accumulation of alfalfa mosaic virus RNAs 1 and 2 requires the encoded proteins in cis.
J. Virol.
70:5100-5105[Abstract/Free Full Text].
|
| 53.
|
Watanabe, T.,
A. Honda,
A. Iwata,
S. Ueda,
T. Hibi, and A. Ishihama.
1999.
Isolation from tobacco mosaic virus-infected tobacco of a solubilized template-specific RNA-dependent RNA polymerase containing a 126/183K protein heterodimer.
J. Virol.
73:2633-2640[Abstract/Free Full Text].
|
Journal of Virology, February 2001, p. 1879-1887, Vol. 75, No. 4
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.4.1879-1887.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sztuba-Solinska, J., Bujarski, J. J.
(2008). Insights into the Single-Cell Reproduction Cycle of Members of the Family Bromoviridae: Lessons from the Use of Protoplast Systems. J. Virol.
82: 10330-10340
[Full Text]
-
Fujiki, M., Kawakami, S., Kim, R. W., Beachy, R. N.
(2006). Domains of tobacco mosaic virus movement protein essential for its membrane association. J. Gen. Virol.
87: 2699-2707
[Abstract]
[Full Text]
-
Aparicio, F., Sanchez-Navarro, J. A., Pallas, V.
(2006). In vitro and in vivo mapping of the Prunus necrotic ringspot virus coat protein C-terminal dimerization domain by bimolecular fluorescence complementation. J. Gen. Virol.
87: 1745-1750
[Abstract]
[Full Text]
-
Dye, B. T., Miller, D. J., Ahlquist, P.
(2005). In Vivo Self-Interaction of Nodavirus RNA Replicase Protein A Revealed by Fluorescence Resonance Energy Transfer. J. Virol.
79: 8909-8919
[Abstract]
[Full Text]
-
Jakubiec, A., Notaise, J., Tournier, V., Hericourt, F., Block, M. A., Drugeon, G., van Aelst, L., Jupin, I.
(2004). Assembly of Turnip Yellow Mosaic Virus Replication Complexes: Interaction between the Proteinase and Polymerase Domains of the Replication Proteins. J. Virol.
78: 7945-7957
[Abstract]
[Full Text]
-
Guo, Y. X., Chan, S.-W., Kwang, J.
(2004). Membrane Association of Greasy Grouper Nervous Necrosis Virus Protein A and Characterization of Its Mitochondrial Localization Targeting Signal. J. Virol.
78: 6498-6508
[Abstract]
[Full Text]
-
Miller, D. J., Schwartz, M. D., Dye, B. T., Ahlquist, P.
(2003). Engineered Retargeting of Viral RNA Replication Complexes to an Alternative Intracellular Membrane. J. Virol.
77: 12193-12202
[Abstract]
[Full Text]
-
Vlot, A. C., Laros, S. M., Bol, J. F.
(2003). Coordinate Replication of Alfalfa Mosaic Virus RNAs 1 and 2 Involves cis- and trans-Acting Functions of the Encoded Helicase-Like and Polymerase-Like Domains. J. Virol.
77: 10790-10798
[Abstract]
[Full Text]
-
Prod'homme, D., Jakubiec, A., Tournier, V., Drugeon, G., Jupin, I.
(2003). Targeting of the Turnip Yellow Mosaic Virus 66K Replication Protein to the Chloroplast Envelope Is Mediated by the 140K Protein. J. Virol.
77: 9124-9135
[Abstract]
[Full Text]
-
Fujisaki, K., Kaido, M., Mise, K., Okuno, T.
(2003). Use of Spring beauty latent virus to identify compatible interactions between bromovirus components required for virus infection. J. Gen. Virol.
84: 1367-1375
[Abstract]
[Full Text]
-
Vlot, A. C., Menard, A., Bol, J. F.
(2002). Role of the Alfalfa Mosaic Virus Methyltransferase-Like Domain in Negative-Strand RNA Synthesis. J. Virol.
76: 11321-11328
[Abstract]
[Full Text]
-
Cillo, F., Roberts, I. M., Palukaitis, P.
(2002). In Situ Localization and Tissue Distribution of the Replication-Associated Proteins of Cucumber Mosaic Virus in Tobacco and Cucumber. J. Virol.
76: 10654-10664
[Abstract]
[Full Text]
-
Weber-Lotfi, F., Dietrich, A., Russo, M., Rubino, L.
(2002). Mitochondrial Targeting and Membrane Anchoring of a Viral Replicase in Plant and Yeast Cells. J. Virol.
76: 10485-10496
[Abstract]
[Full Text]
-
Carette, J. E., van Lent, J., MacFarlane, S. A., Wellink, J., van Kammen, A.
(2002). Cowpea Mosaic Virus 32- and 60-Kilodalton Replication Proteins Target and Change the Morphology of Endoplasmic Reticulum Membranes. J. Virol.
76: 6293-6301
[Abstract]
[Full Text]
-
Carette, J. E., Verver, J., Martens, J., van Kampen, T., Wellink, J., van Kammen, A.
(2002). Characterization of plant proteins that interact with cowpea mosaic virus '60K' protein in the yeast two-hybrid system. J. Gen. Virol.
83: 885-893
[Abstract]
[Full Text]
-
Dunoyer, P., Ritzenthaler, C., Hemmer, O., Michler, P., Fritsch, C.
(2002). Intracellular Localization of the Peanut Clump Virus Replication Complex in Tobacco BY-2 Protoplasts Containing Green Fluorescent Protein-Labeled Endoplasmic Reticulum or Golgi Apparatus. J. Virol.
76: 865-874
[Abstract]
[Full Text]
-
Vlot, A. C., Neeleman, L., Linthorst, H. J. M., Bol, J. F.
(2001). Role of the 3'-Untranslated Regions of Alfalfa Mosaic Virus RNAs in the Formation of a Transiently Expressed Replicase in Plants and in the Assembly of Virions. J. Virol.
75: 6440-6449
[Abstract]
[Full Text]