This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bieleski, L.
Right arrow Articles by Talbot, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bieleski, L.
Right arrow Articles by Talbot, S. J.

 Previous Article  |  Next Article 

Journal of Virology, February 2001, p. 1864-1869, Vol. 75, No. 4
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.4.1864-1869.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Kaposi's Sarcoma-Associated Herpesvirus vCyclin Open Reading Frame Contains an Internal Ribosome Entry Site

Lara Bieleski and Simon J. Talbot*

Laboratory for Clinical and Molecular Virology, University of Edinburgh, Edinburgh EH9 1QH, United Kingdom

Received 15 September 2000/Accepted 29 November 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

We have previously examined the transcription and splicing of open reading frames (ORFS) 71 (K13), 72, and 73 of Kaposi's sarcoma-associated herpesvirus (KSHV) in the primary effusion lymphoma cell line BCP-1 (latently infected with KSHV) (45). The three genes encoded by these ORFs (for vFLIP, vCyclin, and latency-associated nuclear antigen [LANA]) are transcribed from a common transcription start site in BCP-1 cells during both latency and the lytic cycles. The resulting transcript is spliced to yield a 5.32-kb message encoding LANA, vCyclin, and vFLIP and a 1.7-kb bicistronic message encoding vCyclin and vFLIP. To investigate whether the vFLIP protein could be expressed from this vCyclin/vFLIP message, we utilized a bicistronic luciferase reporter system. The genes for Renilla and firefly luciferases (which utilize different substrates) were cloned in tandem downstream from a T7 RNA polymerase promoter. Fragments of DNA immediately upstream from the initiating codon of vFLIP were cloned between the two luciferase genes. The relative expression of the two luciferases, one directed by the putative internal ribosome entry site (IRES) sequences and the other by cap-dependent ribosome scanning, was used to compare the activities of the different DNA fragments. A minimum fragment of 233 bp within the coding region of vCyclin was found to direct efficient expression of the downstream cistron (firefly luciferase). The activity of this IRES was orientation dependent and unaffected by methods used to inhibit cap-dependent translation. This is the first demonstration of an IRES element encoded by a DNA virus and may represent a novel mechanism through which KSHV controls protein expression.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Kaposi's sarcoma (KS) is a vascular tumor occurring most commonly in patients with AIDS (3, 4). KS lesions are histologically complex and contain proliferating spindle-shaped cells considered to be of endothelial origin, infiltrating mononuclear cells, plasma cells, and abundant neovascular spaces (7). The recently identified KS-associated herpesvirus (KSHV) (10) is implicated in the etiology of all epidemiological forms of KS, i.e., Mediterranean classic, African endemic, posttransplant or iatrogenic, and the most commonly occurring AIDS-associated form (8). KSHV sequences have also been identified in several rare lymphomas, such as multicentric Castleman's disease and primary effusion lymphoma (PEL), also known as body cavity-based large-cell lymphoma (9, 42). The seroprevalence of KSHV in the general population exhibits variations with geographic distribution. Very low rates of prevalence have been reported for populations in Britain and North America, whereas high rates prevail in Africa and southern Europe (19, 31, 41). However, antibody kinetic studies have shown that a strong correlation exists between conversion to seropositivity and the risk for development of KS (19, 29). Thus, KSHV has been proposed as the etiologic agent for KS and other KSHV-associated malignancies.

KSHV is a gammaherpesvirus that is closely related to three other herpesviruses with oncogenic potential: herpesvirus saimiri, the murine gammaherpesvirus (MHV-68) and, more distantly, Epstein-Barr virus (34, 38). The complete nucleotide sequence of KSHV DNA has revealed several genes, which were probably captured from the host cell during viral evolution and whose products could also play a role in cellular transformation and tumor induction. These include a cyclin D homolog (vCyclin) (11, 21), a Bcl-2 homolog (13), a viral FLICE (FADD [Fas-associated death domain]-like interleukin-1 beta-converting enzyme)-inhibitory protein (vFLIP) (17, 46), and a G-protein coupled receptor homolog (1).

The three genes encoded by open reading frames (ORFs) 71, 72, and 73 (for vFLIP, vCyclin, and latency-associated nuclear antigen [LANA]) are transcribed from a common transcription start site in BCP-1 cells that are uninduced (latent) or induced (lytic) with n-butyrate. The resulting transcript is spliced to yield a 5.32-kb message encoding LANA, vCyclin, vFLIP, and a 1.7-kb bicistronic message encoding vCyclin and vFLIP (16, 45). Since a monocistronic transcript coding for vFLIP alone has never been detected, some other unconventional mechanism involving translational reinitiation, internal ribosomal entry, or leaky ribosomal scanning may be implicated in the expression of vFLIP.

All nuclear eukaryotic mRNAs possess a cap structure (m7GpppN, where N is any nucleotide) at their 5' end. The cap plays a central role in promoting ribosome binding to the mRNA and controlling the rate of translation initiation (20, 40). Ribosomes can, however, access a eukaryotic mRNA by binding to an internal ribosome entry site (IRES). IRESs were first identified in picornavirus RNA, which does not have a 5' cap structure (27, 36), and have since been characterized in other viruses, such as hepatitis C virus (47), and also in cellular mRNAs involved in cell proliferation and apoptosis (fibroblast growth factor-2 [48], vascular endothelial growth factor [43], X-linked inhibitor of apoptosis [24], and the protooncogene c-myc [33, 44]). Recently, IRES elements in two cellular mRNAs (encoding omithine decarboxylase [ODC] and PITSLRE protein kinase) have been identified which are regulated in a cell-cycle-dependent manner (15, 37). These data reveal a novel role for IRES elements in the translational regulation of protein expression during cell cycle progression.

In this paper we describe the identification of an IRES element within the KSHV cyclin ORF. This 233-nucleotide sequence could direct the translation of the downstream vFLIP ORF from the vCyclin/vFLIP bicistronic transcript.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cells. The KSHV-positive PEL B-cell line, BCP-1 (6), was grown in RPMI (Gibco) supplemented with 20% (vol/vol) fetal calf serum (FCS), 2 mM glutamine, 60 µg of penicillin/ml, and 100 µg of streptomycin/ml. The endothelial cell line KS-IMM, derived from a KS lesion (2), was grown in MCDB131 media (Gibco) supplemented with 10% (vol/vol) FCS, 10 mM glutamine, 20 ng of endothelial cell growth supplement (Sigma)/ml, 60 µg of penicillin/ml, and 100 µg of streptomycin/ml. HEK293 cells (22) were grown in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% (vol/vol) FCS, 2 mM glutamine, 60 µg of penicillin/ml, and 100 µg of streptomycin/ml. Cells were incubated at 37°C under 4% CO2.

Plasmids. The plasmid pdLUC was constructed by cloning the firefly luciferase gene (from pGL3-basic; Promega) as an NheI-XbaI fragment downstream of the Renilla luciferase gene at the XbaI site in the plasmid pRL-CMV (Promega). Plasmid pdLUC-SL is identical to pdLUC except for a 60-nucleotide sequence (5'GCTAGCGGTACGGCAGTGCCGTACGACGAATTCGTCGTACGGC ACTGCCGTACCGCTAGC3'), capable of forming a stable 28-bp stem-loop (Delta G = -62 kcal/mol), cloned at the NheI site immediately upstream from the Renilla luciferase start codon (see Fig. 1b).

The IRES sequence from encephalomyocarditis virus (EMCV) or fragments of KSHV vCyclin/vFLIP were cloned into the SmaI-NcoI sites of pdLUC and pdLUC-SL.

Transfection of cells. BCP-1 cells (105 cells per well), HEK293 (5 × 104 cells per well), or KS-IMM (5 × 104 cells per well) were seeded in 24-well trays and incubated overnight. The cells were infected with vTF7-3 (18), a recombinant vaccinia virus expressing T7 RNA polymerase, at 5 PFU per cell in 200 µl of serum-free medium (OptiMEM; Gibco-BRL) for 60 min at 37°C. The inoculum was removed, and the cells were washed once with OptiMEM. The cells were then transfected with 0.5 µg of linearized (AflII and NotI) plasmid DNA and 1.5 µl of Transfast transfection reagent per well according to the instructions of the manufacturer (Promega). Following a 1-h incubation at 37°C, 1 ml of growth medium was added to the wells. The cells were assayed for luciferase activity 24 h later as described below.

Dual luciferase assays. Transfected cells were washed twice in phosphate-buffered saline and then lysed by addition of 200 µl of passive lysis buffer (Promega). After incubation for 15 min at room temperature, the cell lysates were transferred to Eppendorf tubes and snap frozen on dry ice. The lysates were then thawed and vortexed for 1 min, and the cell debris was removed by spinning at 10,000 × g for 1 min. The activities of Renilla and firefly luciferases were assayed using the dual luciferase system as described by the manufacturer (Promega). Luciferase activities were measured using a Labsystems benchtop luminometer, and the ratio of firefly luciferase activity to Renilla luciferase activity was calculated and used as a measure of IRES function.

Northern blots. BCP-1 cells (2 × 106) were infected with vaccinia vTF7-3 (18) (multiplicity of infection = 5) and then transfected with 2 µg of linearized plasmid DNA as described above. Twenty-four hours posttransfection, Poly(A)+ RNA was isolated (Sigma) from the BCP-1 cells. The mRNA (equivalent to 106 cells per lane) was separated on formaldehyde agarose gels as described previously (39) and transferred onto a Genescreen-plus membrane by capillary blotting according to the manufacturer's instructions (NEN Research products). The filters were baked at 80°C for 2 h and then hybridized to Renilla or firefly luciferase DNA probes randomly labeled with [alpha -32P]dCTP. Filters were prehybridized for 20 min and hybridized for 60 min at 60°C in QuickHyb solution (Stratagene). Blots were washed twice for 15 min at 20°C in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% (wt/vol) sodium dodecyl sulfate and once for 30 min at 60°C in 0.1× SSC-0.1% sodium dodecyl sulfate before exposure to X-ray film (X-OMAT-AR-Kodak) at -80°C with an intensifying screen.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The major latently expressed loci within the KSHV genome contain three genes: those for LANA, vCyclin (Cyclin D homolog), and vFLIP (Flice inhibitory protein homolog) (30). Two mRNA transcripts from this region are seen in cells latently infected with KSHV. Both are transcribed from a common transcription start site and are differentially spliced to yield a tricistronic message encoding LANA, vCyclin, and vFLIP and a bicistronic message encoding vCyclin and vFLIP (Fig. 1a) (16, 45). There have been no reports of further splicing events resulting in a monocistronic transcript encoding for vFLIP alone, suggesting that this ORF may be translated via an unconventional mechanism. To test the hypothesis that this bicistronic transcript could contain an IRES allowing the translation of the downstream vFLIP ORF, we constructed a bicistronic luciferase reporter plasmid (pdLUC) (Fig. 1b). In this plasmid the downstream cistron (firefly luciferase) would ordinarily be accessed inefficiently by ribosomes which have completed translation of the upstream cistron (Renilla luciferase). However, if an IRES sequence (e.g., EMCV IRES) (Fig. 2a) is inserted before the downstream ORF, translation is considerably enhanced (up to 100-fold). This system offers the advantage that both reporter enzymes can be assayed in the same cell lysate preparation, with the activity of the two luciferase enzymes (which utilize different substrates) determined using a benchtop luminometer. In addition, the upstream reporter (Renilla luciferase) acts as an internal control to account for differences in transfection efficiency. The plasmids were constructed such that transcription of the bicistronic reporter was driven from a T7 RNA polymerase promoter. The constructs were transfected into cells infected with a recombinant vaccinia virus (vTF7-3) (18) which expresses T7 RNA polymerase, therefore allowing cytoplasmic transcription of the bicistronic mRNAs. Since this system bypasses the nuclear transcription pathway, the possibility of splicing accounting for expression of the downstream cistron is eliminated.


View larger version (20K):
[in this window]
[in a new window]
  		FIG. 1.   (a) Map of the left end of the KSHV genome showing the transcription of the latent genes ORF 71, 72, and 73 encoding vFLIP, vCyclin, and LANA, respectively. Two spliced transcripts are observed in PEL cell lines: one tricistronic transcript encoding LANA, vCyclin, and vFLIP and one bicistronic transcript encoding vCyclin and vFLIP. (b) Schematic diagram of the plasmids pdLUC and pdLUC-SL. Both plasmids have the coding sequence for the Renilla and firefly luciferase enzymes cloned downstream of a T7 RNA polymerase promoter. The plasmid pdLUC-SL has a stable 28-bp stem-loop cloned immediately upstream of the Renilla luciferase start codon.

The KSHV vCyclin coding sequence contains an IRES element. Restriction enzyme fragments of the vCyclin coding sequence immediately upstream from the vFLIP start codon were cloned into the pdLUC plasmid as shown in Fig. 2a. These plasmids were transfected into the BCP-1 cell line (latently infected with KSHV), which had been infected with vaccinia virus vTF7-3 (18) at a multiplicity of infection of 5. The Renilla luciferase and firefly luciferase activities were measured in cell lysates 24 h posttransfection. The ratio of firefly luciferase activity to Renilla luciferase activity was calculated and used as a measure of IRES function. These data (Fig. 2a) show that a 233-nucleotide sequence between the SacII and Eco47III restriction sites (nucleotides 123206 to 122973; GenBank accession no. U75698) (38) in the vCyclin coding sequence is capable of directing efficient translation of the firefly luciferase. Reducing the size of this fragment further using the AatII restriction site resulted in a complete loss of IRES activity. Although this putative IRES sequence was less efficient (10.6 versus 30%) than the well-characterized IRES from EMCV, it still promoted translation well above background levels. We also note that the expression of firefly luciferase from pdLuc8 (SacII-Eco47III) was more efficient (10.6 versus 6.2%) than that from pdLuc3 (SacII-NcoI) (Fig. 2a). This may reflect the smaller nucleotide distance from the IRES element to the downstream cistron, or alternatively, the increased activity could be due to the removal of two start codons that could potentially compete for scanning ribosomes. The function of this vCyclin IRES was orientation dependent (Fig. 2a).


View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2.   Assay for IRES activity in BCP-1 cells. The indicated restriction fragments from the vCyclin gene were cloned between the SmaI and NcoI sites of pdLUC (a) or pdLUC-SL (b). The activities of firefly (FF) and Renilla (RL) luciferase (in relative light units) and the ratio (%) of the two from a representative experiment are shown. The restriction sites shown on the schematic diagram of vCyclin and vFLIP are as follows: NcoI, BamHI, SacII, AatII, Eco47III, PvuII, HindIII, NcoI.

A Northern blot analysis of poly(A)+ RNA isolated from BCP-1 cells infected with vaccinia vTF7-3 (18) and transfected with pdLuc, pdLuc-EMCV, or pdLuc8 and probed with firefly luciferase DNA showed that the cells expressed bicistronic mRNA of the predicted size (Fig. 3). We did not observe any smaller transcripts representing alternative transcription start sites within the KSHV sequences, even on overexposed blots (data not shown). These data suggest that the enhanced expression of the downstream firefly luciferase gene resulted from IRES-driven translation rather than from unusual splicing events, RNA fragmentation, or a cryptic vaccinia virus promoter.


View larger version (51K):
[in this window]
[in a new window]
  		FIG. 3.   Northern blot of poly(A)+ RNA purified from BCP-1 cells infected with vaccinia vTF73 (18) and transfected with pdLUC (lane 1), pdLUC-EMCV (lane 2), or pdLUC-8 (lane 3) or untransfected (lane 4). The blot was probed with DNA corresponding to the firefly luciferase gene. The approximate size predicted for each transcript is 2.7 kb (pdLUC), 3.3 kb (pdLUC-EMCV), or 2.9 kb (pdLUC-8). Size markers (kb) are indicated.

The function of the vCyclin IRES element was also tested in both HEK293 (22) and KSIMM cells (2) (a KSHV-negative endothelial cell line derived from a KS biopsy). Although the EMCV IRES directed efficient translation of the second cistron in these cells, none of the vCyclin sequences appeared to function as an IRES (Table 1). These data suggest that specific KSHV or cellular factors may be required for efficient functioning of the vCyclin IRES.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   IRES activity in HEK293 cells and KSIMM cellsa

Inhibition of translation of the upstream cistron does not affect the activity of the IRES. To show that the enhanced expression of the firefly luciferase cistron was due to an IRES sequence within the vCyclin gene and was not dependent on the translation of the upstream Renilla luciferase cistron, we constructed a plasmid that inhibited translation of the first cistron. This was achieved by using an equivalent reporter construct (pdLUC-SL; Fig. 1b) that contained an inverted repeat, with the potential to form a stable 28-bp stem-loop structure in the 5' untranslated region (UTR) immediately upstream from the Renilla luciferase start codon. The data shown in Fig. 2b show that translation of the first cistron is efficiently inhibited by the presence of the stable stem-loop structure. However, translation of the second cistron via the IRES sequence within the vCyclin gene was unaffected by the presence of the stem-loop. This confirms that translation of the second cistron is dependent not on translation of the first cistron but rather on the presence of specific sequence elements within the IRES sequence.

The predicted RNA secondary structure of the vCyclin IRES. An RNA secondary model was determined for the minimum vCyclin IRES sequence. The program RNA mfold (32, 49) was used to produce a structure with the lowest free energy (Delta G = -61.4 kcal/mol), as shown in Fig. 4. The model predicts that this RNA sequence folds into two stable stem-loop structures separated by a short non-base-paired region. Sequence comparisons revealed a stretch of 11 nucleotides that is 100% complementary to a sequence in 18S rRNA (nucleotides 1150 to 1160). The secondary structure model predicts that this sequence is in a single-stranded loop and therefore has the potential for base-pairing interactions with 18S rRNA. A recent report (12) described an IRES element within the 5' UTR of the mRNA encoding the homeodomain protein Gtx, which contained a nine-nucleotide segment 100% complementary to 18S rRNA (nucleotides 1124 to 1132). This 9-nucleotide fragment still functioned as an IRES even when taken out of the context of the rest of the 5' UTR, suggesting that this IRES functioned at least in part via base-pairing between rRNA and the mRNA. To test if this was also the case for the vCyclin IRES, we cloned the 11-nucleotide sequence into the pdLUC and pdLUC-SL reporter plasmids. However, this sequence was unable to promote the translation of the second luciferase cistron on its own (data not shown). Although these data do not rule out the possibility of direct base pairing between the IRES sequence and 18S rRNA, there must be additional elements within the vCyclin IRES that are necessary for its correct function. One such element could be the polypyrimidine-rich sequence found at nucleotides 123199 to 123183. The presence of polypyrimidine-rich sequences in several other IRES elements in viruses and cellular mRNAs has been noted (37). The fact that IRES activity is lost when the two stem-loop structures are separated at the AatII site suggests that multiple structural and sequence elements are essential for correct function of the vCyclin IRES.


View larger version (14K):
[in this window]
[in a new window]
  		FIG. 4.   Predicted secondary structure of the shortest functional vCyclin IRES. The sequence between the SacII and Eco47III sites (nucleotides 123206 to 122973; GenBank accession no. U75698) (38) is shown in upper case. Vector sequences are shown in lower case. The stop codon for the Renilla luciferase gene and the start codon for the firefly luciferase gene are underlined. The 11-nucleotide sequence complementary to 18S rRNA (nucleotides 1150 to 1160) is boxed, and the polypyrimidine-rich sequence is shown in bold. The arrow shows the cleavage position of the AatII site. The RNA was folded using RNA mfold version 3.0 (32, 49). Delta G = -61.4 kcal/mol.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Analysis of KSHV gene expression has revealed a cluster of latently expressed transcripts encoding LANA (ORF 73), vCyclin (ORF 72), and vFLIP (ORF K13). The vCyclin and vFLIP coding sequences are present on a bicistronic transcript (30, 45). We have identified an IRES within the vCyclin coding sequence (nucleotides 123206 to 122973) (38) that has the potential to direct the translation of vFLIP from this bicistronic transcript. IRES elements were first identified in the 5' UTR of picornaviruses (27, 36) and are essential for the cap-independent translation of the viral polyprotein. More recently, IRES elements have been characterized for several cellular genes (14, 15, 23, 24, 28, 33, 37, 44).

It is unusual to find an IRES driving the translation of a gene within the coding sequence of an upstream cistron (vCyclin). Most IRESs examined to date are located within 5' UTR of mRNAs. Although we have not yet formally shown that this IRES actually controls the expression of vFLIP in vivo, we assume that the data presented here using a dual luciferase reporter system will parallel the situation in KSHV-infected cells.

The KSHV cyclin complexed with cyclin-dependent kinase-6 (cdk6) has been shown to inactivate the retinoblastoma (Rb) protein and thereby promote cell cycle progression and proliferation (11, 21). It has been demonstrated that ectopic expression of vCyclin in cells with elevated levels of cdk6 leads to apoptotic cell death after the cells enter S phase. Studies on the mechanisms involved in this caspase-3-mediated apoptosis indicated that it was independent of cellular p53 or pRb status, and it was not suppressed by Bcl-2. In contrast, the KSHV-encoded v-Bcl-2 efficiently suppressed vCyclin-/cdk6-induced apoptosis (35). Abnormally proliferating cells are also known to be a target for cytotoxic T-cell (CTL)-mediated cell killing through FasL or tumor necrosis factor death receptors. Cellular FLIP (cFLIP) and KSHV vFLIP have been shown to inhibit FasL-mediated apoptosis by binding to and blocking the death-effector domain on the cytoplasmic C terminus of the Fas receptor (CD95) (26, 35, 46). KSHV vFLIP protects cells from Fas-mediated apoptosis by inhibiting caspase activation and permits clonal growth in the presence of death stimuli in vitro. KSHV vFLIP also mediates a tumor-progressive activity by prevention of death receptor-induced apoptosis triggered by CTLs in vivo (17). It therefore seems likely that the function of vFLIP is to prevent CTL-mediated killing of proliferating cells infected with KSHV, and this may explain why the expression of vFLIP is so intimately linked to the expression of vCyclin.

Correct progression of the cell cycle requires that certain proteins be present or active at specific times. It has been shown that cells arrested in G2/M phase or in mitosis translate mRNAs at about 25% of the rate of interphase cells. This is in part due to an inhibition of the translation initiation step due to a loss of the cap binding protein's ability to bind the 5' m7GpppN cap structure present on eukaryotic mRNAs (5). This results in a general loss of cap-dependent translation in this phase of the cell cycle (5, 25). Recently, two reports (15, 37) have shown that two cellular mRNAs encoding ODC and PITSLRE protein kinase are expressed from IRES elements specifically during the G2/M phase of the cell cycle. These mRNAs bypass the general inhibition of cap-dependent translation in G2/M-arrested cells by utilizing a cap-independent IRES during this period of the cell cycle. These data may have parallels with the expression of KSHV vCyclin and vFLIP. If vFLIP is to protect KSHV-infected cells from CTL-mediated apoptosis, then the levels of this inhibitor of FasL-mediated apoptosis must remain at an appropriate level throughout the cell cycle. One way of achieving this would be to ensure that vFLIP is expressed via an IRES which is not susceptible to cap-dependent inhibition of translation at G2/M.

It has been previously noted that the few eukaryotic mRNAs that possess IRESs encode growth factors (fibroblast growth factor 2 and vascular endothelial growth factor), oncogenes (c-myc and ODC), and an inhibitor of apoptosis (XIAP) (37). IRES-dependent translation of these mRNAs may be essential for the survival and proliferation of cells under stressful conditions. In this paper we have identified an IRES which potentially controls the expression of a virally encoded anti apoptotic protein, vFLIP, that is intimately linked to the expression of a cell growth-promoting protein, vCyclin. Therefore, it is conceivable that the expression of vFLIP from an IRES represents a novel mechanism whereby KSHV ensures continued protection against CTL-induced apoptosis throughout the cell cycle.


    ACKNOWLEDGMENTS

This work was supported by a Career Establishment Grant from the Medical Research Council.

We thank James Stewart for reagents and useful discussions.


    FOOTNOTES

* Corresponding author. Mailing address: Laboratory for Clinical and Molecular Virology, University of Edinburgh, Summerhall, Edinburgh EH9 1QH, United Kingdom. Phone: 44 131 6507938. Fax: 44 131 6506511. E-mail: s.talbot{at}ed.ac.uk.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Bais, C., B. Santomasso, O. Coso, L. Arvanitakis, E. G. Raaka, J. S. Gutkind, A. S. Asch, E. Cesarman, M. C. Gershengorn, and E. A. Mesri. 1998. G-protein-coupled receptor of Kaposi's sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator. Nature 391:86-89[CrossRef][Medline].
2. Benelli, R., L. Repetto, S. Carlone, C. Parravicini, and A. Albini. 1994. Establishment and characterization of two new Kaposi's sarcoma cell cultures from an AIDS and a non-AIDS patient. Res. Virol. 145:251-259[Medline].
3. Beral, V. 1991. Epidemiology of Kaposi's sarcoma, p. 5-22. In V. Beral, H. W. Jaffe, and R. A. Weiss (ed.), Cancer, HIV and AIDS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
4. Beral, V., T. A. Peterman, R. L. Berkelman, and H. W. Jaffe. 1990. Kaposi's sarcoma among persons with AIDS: a sexually transmitted infection? Lancet 335:123-128[CrossRef][Medline].
5. Bonneau, A. M., and N. Sonenberg. 1987. Involvement of the 24 kDa capbinding protein in regulation of protein synthesis and mitosis. J. Biol. Chem. 262:11134-11139[Abstract/Free Full Text].
6. Boshoff, C., S. J. Gao, L. E. Healy, S. Matthews, A. J. Thomas, L. Coignet, R. A. Warnke, J. A. Strauchen, E. Matutes, O. W. Kamel, P. S. Moore, R. A. Weiss, and Y. Chang. 1998. Establishing a KSHV+ cell line (BCP-1) from peripheral blood and characterizing its growth in Nod/SCID mice. Blood 91:1671-1679[Abstract/Free Full Text].
7. Boshoff, C., T. F. Schulz, M. M. Kennedy, A. K. Graham, C. Fisher, A. Thomas, J. O. McGee, R. A. Weiss, and J. J. O'Leary. 1995. Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells. Nat. Med. 1:1274-1278[CrossRef][Medline].
8. Boshoff, C., and R. A. Weiss. 1998. Kaposi's sarcoma-associated herpesvirus. Adv. Cancer Res. 75:57-86[Medline].
9. Cesarman, E., R. G. Nador, K. Aozasa, G. Delsol, J. W. Said, and D. M. Knowles. 1996. Kaposi's sarcoma-associated herpesvirus in non-AIDS related lymphomas occurring in body cavities. Am. J. Pathol. 149:53-57[Abstract].
10. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1869[Abstract/Free Full Text].
11. Chang, Y., P. S. Moore, S. J. Talbot, C. H. Boshoff, T. Zarkowska, K. Godden, H. Paterson, R. A. Weiss, and S. Mittnacht. 1996. Cyclin encoded by KS herpesvirus. Nature 382:410[CrossRef][Medline].
12. Chappell, S. A., G. M. Edelman, and V. P. Mauro. 2000. A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity. Proc. Natl. Acad. Sci. USA 97:1536-1541[Abstract/Free Full Text].
13. Cheng, E. H., J. Nicholas, D. S. Bellows, G. S. Hayward, H. G. Guo, M. S. Reitz, and J. M. Hardwick. 1997. A Bcl-2 homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with Bax or Bak. Proc. Natl. Acad. Sci. USA 94:690-694[Abstract/Free Full Text].
14. Coldwell, M. J., S. A. Mitchell, M. Stoneley, M. MacFarlane, and A. E. Willis. 2000. Initiation of Apaf-1 translation by internal ribosome entry. Oncogene 19:899-905[CrossRef][Medline].
15. Cornelis, S., Y. Bruynooghe, G. Denecker, S. Van Huffel, S. Tinton, and R. Beyaert. 2000. Identification and characterization of a novel cell cycle-regulated internal ribosome entry site. Mol. Cell 5:597-605[CrossRef][Medline].
16. Dittmer, D., M. Lagunoff, R. Renne, K. Staskus, A. Haase, and D. Ganem. 1998. A cluster of latently expressed genes in Kaposi's sarcoma-associated herpesvirus. J. Virol. 72:8309-8315[Abstract/Free Full Text].
17. Djerbi, M., V. Screpanti, A. I. Catrina, B. Bogen, P. Biberfeld, and A. Grandien. 1999. The inhibitor of death receptor signaling, FLICE-inhibitory protein defines a new class of tumor progression factors. J. Exp. Med. 190:1025-1032[Abstract/Free Full Text].
18. Fuerst, T. R., E. G. Niles, F. W. Studier, and B. Moses. 1986. Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesises bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83:8122-8126[Abstract/Free Full Text].
19. Gao, S. J., L. Kingsley, M. Li, W. Zheng, C. Parravicini, J. Ziegler, R. Newton, C. R. Rinaldo, A. Saah, J. Phair, R. Detels, Y. Chang, and P. S. Moore. 1996. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat. Med. 2:925-928[CrossRef][Medline].
20. Gingras, A. C., B. Raught, and N. Sonenberg. 1999. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu. Rev. Biochem 68:913-963[CrossRef][Medline].
21. Godden-Kent, D., S. J. Talbot, C. Boshoff, Y. Chang, P. Moore, R. A. Weiss, and S. Mittnacht. 1997. The cyclin encoded by Kaposi's sarcoma-associated herpesvirus stimulates cdk6 to phosphorylate the retinoblastoma protein and histone H1. J. Virol. 71:4193-4198[Abstract].
22. Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36:59-74[Abstract/Free Full Text].
23. Henis-Korenblit, S., N. L. Strumpf, D. Goldstaub, and A. Kimchi. 2000. A novel form of DAP5 protein accumulates in apoptotic cells as a result of caspase cleavage and internal ribosome entry site-mediated translation. Mol. Cell. Biol. 20:496-506[Abstract/Free Full Text].
24. Holcik, M., and R. G. Korneluk. 2000. Functional characterization of the X-linked inhibitor of apoptosis (XIAP) internal ribosome entry site element: role of La autoantigen in XIAP translation. Mol. Cell. Biol. 20:4648-4657[Abstract/Free Full Text].
25. Huang, J. T., and R. J. Schneider. 1991. Adenovirus inhibition of cellular protein synthesis involves inactivation of cap-binding protein. Cell 65:271-280[CrossRef][Medline].
26. Irmler, M., M. Thome, M. Hahne, P. Schneider, K. Hofmann, V. Steiner, J. L. Bodmer, M. Schroter, K. Burns, C. Mattmann, D. Rimoldi, L. E. French, and J. Tschopp. 1997. Inhibition of death receptor signals by cellular FLIP. Nature 388:190-195[CrossRef][Medline].
27. Jang, S. K., H. G. Kräusslich, M. J. H. Nicklin, G. M. Duke, A. C. Palmenberg, and E. Wimmer. 1988. A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J. Virol. 62:2636-2643[Abstract/Free Full Text].
28. Johannes, G., and P. Sarnow. 1998. Cap-independent polysomal association of natural mRNAs encoding c-myc, BiP, and eIF4G conferred by internal ribosome entry sites. RNA 4:1500-1513[Abstract].
29. Kedes, D. H., E. Operskalski, M. Busch, R. Kohn, J. Flood, and D. Ganem. 1996. The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat. Med. 2:918-924[CrossRef][Medline].
30. Kellam, P., C. Boshoff, D. Whitby, S. Matthews, R. A. Weiss, and S. J. Talbot. 1997. Identification of a major latent nuclear antigen, LNA-1, in the human herpesvirus 8 genome. J. Hum. Virol. 1:19-29[Medline].
31. Lennette, E. T., D. J. Blackbourn, and J. A. Levy. 1996. Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients. Lancet 348:858-861[CrossRef][Medline].
32. Mathews, D. H., J. Sabina, M. Zuker, and D. H. Turner. 1999. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288:911-940[CrossRef][Medline].
33. Nanbru, C., I. Lafon, S. Audigier, M. C. Gensac, S. Vagner, G. Huez, and A. C. Prats. 1997. Alternative translation of the proto-oncogene c-myc by an internal ribosome entry site. J. Biol. Chem. 272:32061-32066[Abstract/Free Full Text].
34. Neipel, F., J. C. Albrecht, and B. Fleckenstein. 1997. Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? J. Virol. 71:4187-4192[Medline].
35. Ojala, P. M., M. Tiainen, P. Salven, T. Veikkola, E. Castanos-Velez, R. Sarid, P. Biberfeld, and T. P. Makela. 1999. Kaposi's sarcoma-associated herpesvirus-encoded v-cyclin triggers apoptosis in cells with high levels of cyclin-dependent kinase 6. Cancer Res. 59:4984-4989[Abstract/Free Full Text].
36. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334:320-325[CrossRef][Medline].
37. Pyronnet, S., L. Pradayrol, and N. Sonenberg. 2000. A cell cycle-dependent internal ribosome entry site. Mol. Cell 5:607-616[CrossRef][Medline].
38. Russo, J. J., R. A. Bohenzky, M. C. Chien, J. Chen, M. Yan, D. Maddalena, J. P. Parry, D. Peruzzi, I. S. Edelman, Y. Chang, and P. S. Moore. 1996. Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc. Natl. Acad. Sci. USA 93:14862-14867[Abstract/Free Full Text].
39. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
40. Shatkin, A. J. 1976. Capping of eukaryotic mRNAs. Cell 9:645-653[CrossRef][Medline].
41. Simpson, G. R., T. F. Schulz, D. Whitby, P. M. Cook, C. Boshoff, L. Rainbow, M. R. Howard, S. J. Gao, R. A. Bohenzky, P. Simmonds, C. Lee, A. de Ruiter, A. Hatzakis, R. S. Tedder, I. V. Weller, R. A. Weiss, and P. S. Moore. 1996. Prevalence of Kaposi's sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen. Lancet 348:1133-1138[CrossRef][Medline].
42. Soulier, J., L. Grollet, E. Oksenhendler, P. Cacoub, D. Cazals-Hatem, P. Babinet, M. F. d'Agay, J. P. Clauvel, M. Raphael, and L. Degos. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86:1276-1280[Abstract/Free Full Text].
43. Stein, I., A. Itin, P. Einat, R. Skaliter, Z. Grossman, and E. Keshet. 1998. Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia. Mol. Cell. Biol. 18:3112-3119[Abstract/Free Full Text].
44. Stoneley, M., F. E. Paulin, J. P. Le Quesne, S. A. Chappell, and A. E. Willis. 1998. C-Myc 5' untranslated region contains an internal ribosome entry segment. Oncogene 16:423-428[CrossRef][Medline].
45. Talbot, S. J., R. A. Weiss, P. Kellam, and C. Boshoff. 1999. Transcriptional analysis of human herpesvirus-8 open reading frames 71, 72, 73, K14, and 74 in a primary effusion lymphoma cell line. Virology 257:84-94[CrossRef][Medline].
46. Thome, M., P. Schneider, K. Hofmann, H. Fickenscher, E. Meini, F. Neipel, C. Mattmann, K. Burns, J. L. Bodmer, M. Schroter, C. Scaffidl, P. H. Krammer, M. E. Peter, and J. Tschopp. 1997. Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 386:517-521[CrossRef][Medline].
47. Tsukiyama-Kohara, K., N. Iizuka, M. Kohara, and A. Nomoto. 1992. Internal ribosome entry site within hepatitis C virus RNA. J. Virol. 66:1476-1483[Abstract/Free Full Text].
48. Vagner, S., M. C. Gensac, A. Maret, F. Bayard, F. Amalric, H. Prats, and A. C. Prats. 1995. Alternative translation of human FGF-2 mRNA occurs by internal entry of ribosomes. Mol. Cell. Biol. 15:35-44[Abstract].
49. Zuker, M., D. H. Mathews, and D. H. Turner. 1999. Algorithms and thermodynamics for RNA secondary structure prediction: a practical guide, p. 11-43. In J. Barciszewski, and B. F. C. Clark (ed.), RNA biochemistry and biotechnology. Kluwer Academic, Norwell, Mass.

Journal of Virology, February 2001, p. 1864-1869, Vol. 75, No. 4
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.4.1864-1869.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Tahiri-Alaoui, A., Matsuda, D., Xu, H., Panagiotis, P., Burman, L., Lambeth, L. S., Petherbridge, L., James, W., Mauro, V., Nair, V. (2009). The 5' Leader of the mRNA Encoding the Marek's Disease Virus Serotype 1 pp14 Protein Contains an Intronic Internal Ribosome Entry Site with Allosteric Properties. J. Virol. 83: 12769-12778 [Abstract] [Full Text]  
  • Tahiri-Alaoui, A., Smith, L. P., Baigent, S., Kgosana, L., Petherbridge, L. J., Lambeth, L. S., James, W., Nair, V. (2009). Identification of an Intercistronic Internal Ribosome Entry Site in a Marek's Disease Virus Immediate-Early Gene. J. Virol. 83: 5846-5853 [Abstract] [Full Text]  
  • Deniz, N., Lenarcic, E. M., Landry, D. M., Thompson, S. R. (2009). Translation initiation factors are not required for Dicistroviridae IRES function in vivo. RNA 15: 932-946 [Abstract] [Full Text]  
  • Salem, T. Z., Garcia-Maruniak, A., Lietze, V.-U., Maruniak, J. E., Boucias, D. G. (2009). Analysis of transcripts from predicted open reading frames of Musca domestica salivary gland hypertrophy virus. J. Gen. Virol. 90: 1270-1280 [Abstract] [Full Text]  
  • Carter, J. R., Fraser, T. S., Fraser, M. J. Jr (2008). Examining the relative activity of several dicistrovirus intergenic internal ribosome entry site elements in uninfected insect and mammalian cell lines. J. Gen. Virol. 89: 3150-3155 [Abstract] [Full Text]  
  • Ahasan, M. M., Sweet, C. (2007). Murine cytomegalovirus open reading frame m29.1 augments virus replication both in vitro and in vivo. J. Gen. Virol. 88: 2941-2951 [Abstract] [Full Text]  
  • Woeller, C. F., Fox, J. T., Perry, C., Stover, P. J. (2007). A Ferritin-responsive Internal Ribosome Entry Site Regulates Folate Metabolism. J. Biol. Chem. 282: 29927-29935 [Abstract] [Full Text]  
  • Majerciak, V., Yamanegi, K., Zheng, Z.-M. (2006). Gene Structure and Expression of Kaposi's Sarcoma-Associated Herpesvirus ORF56, ORF57, ORF58, and ORF59. J. Virol. 80: 11968-11981 [Abstract] [Full Text]  
  • Baird, S. D., Turcotte, M., Korneluk, R. G., Holcik, M. (2006). Searching for IRES. RNA 12: 1755-1785 [Abstract] [Full Text]  
  • Haque, M., Wang, V., Davis, D. A., Zheng, Z.-M., Yarchoan, R. (2006). Genetic Organization and Hypoxic Activation of the Kaposi's Sarcoma-Associated Herpesvirus ORF34-37 Gene Cluster. J. Virol. 80: 7037-7051 [Abstract] [Full Text]  
  • Yu, Y., Alwine, J. C. (2006). 19S Late mRNAs of Simian Virus 40 Have an Internal Ribosome Entry Site Upstream of the Virion Structural Protein 3 Coding Sequence.. J. Virol. 80: 6553-6558 [Abstract] [Full Text]  
  • Allen, R. D. III, Dickerson, S., Speck, S. H. (2006). Identification of Spliced Gammaherpesvirus 68 LANA and v-Cyclin Transcripts and Analysis of Their Expression In Vivo during Latent Infection. J. Virol. 80: 2055-2062 [Abstract] [Full Text]  
  • Pearce, M., Matsumura, S., Wilson, A. C. (2005). Transcripts Encoding K12, v-FLIP, v-Cyclin, and the MicroRNA Cluster of Kaposi's Sarcoma-Associated Herpesvirus Originate from a Common Promoter. J. Virol. 79: 14457-14464 [Abstract] [Full Text]  
  • Griffiths, A., Coen, D. M. (2005). An unusual internal ribosome entry site in the herpes simplex virus thymidine kinase gene. Proc. Natl. Acad. Sci. USA 102: 9667-9672 [Abstract] [Full Text]  
  • Shi, Y., Sharma, A., Wu, H., Lichtenstein, A., Gera, J. (2005). Cyclin D1 and c-myc Internal Ribosome Entry Site (IRES)-dependent Translation Is Regulated by AKT Activity and Enhanced by Rapamycin through a p38 MAPK- and ERK-dependent Pathway. J. Biol. Chem. 280: 10964-10973 [Abstract] [Full Text]  
  • Godfrey, A., Anderson, J., Papanastasiou, A., Takeuchi, Y., Boshoff, C. (2005). Inhibiting primary effusion lymphoma by lentiviral vectors encoding short hairpin RNA. Blood 105: 2510-2518 [Abstract] [Full Text]  
  • Coleman, H. M., Efstathiou, S., Stevenson, P. G. (2005). Transcription of the murine gammaherpesvirus 68 ORF73 from promoters in the viral terminal repeats. J. Gen. Virol. 86: 561-574 [Abstract] [Full Text]  
  • Jang, G. M., Leong, L. E.-C., Hoang, L. T., Wang, P. H., Gutman, G. A., Semler, B. L. (2004). Structurally Distinct Elements Mediate Internal Ribosome Entry within the 5'-Noncoding Region of a Voltage-gated Potassium Channel mRNA. J. Biol. Chem. 279: 47419-47430 [Abstract] [Full Text]  
  • Bieleski, L., Hindley, C., Talbot, S. J. (2004). A polypyrimidine tract facilitates the expression of Kaposi's sarcoma-associated herpesvirus vFLIP through an internal ribosome entry site. J. Gen. Virol. 85: 615-620 [Abstract] [Full Text]  
  • Coleman, H. M., Brierley, I., Stevenson, P. G. (2003). An Internal Ribosome Entry Site Directs Translation of the Murine Gammaherpesvirus 68 MK3 Open Reading Frame. J. Virol. 77: 13093-13105 [Abstract] [Full Text]  
  • Beales, L. P., Holzenburg, A., Rowlands, D. J. (2003). Viral Internal Ribosome Entry Site Structures Segregate into Two Distinct Morphologies. J. Virol. 77: 6574-6579 [Abstract] [Full Text]  
  • Sarnow, P. (2003). Viral Internal Ribosome Entry Site Elements: Novel Ribosome-RNA Complexes and Roles in Viral Pathogenesis. J. Virol. 77: 2801-2806 [Full Text]  
  • Tang, S., Zheng, Z.-M. (2002). Kaposi's Sarcoma-associated Herpesvirus K8 Exon 3 Contains Three 5'-Splice Sites and Harbors a K8.1 Transcription Start Site. J. Biol. Chem. 277: 14547-14556 [Abstract] [Full Text]  
  • Hellen, C. U.T., Sarnow, P. (2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev. 15: 1593-1612 [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bieleski, L.
Right arrow Articles by Talbot, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bieleski, L.
Right arrow Articles by Talbot, S. J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»