Previous Article | Next Article 
Journal of Virology, February 2001, p. 1857-1863, Vol. 75, No. 4
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.4.1857-1863.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Mechanisms Governing Expression of the v-FLIP Gene
of Kaposi's Sarcoma-Associated Herpesvirus
Adam
Grundhoff and
Don
Ganem*
Howard Hughes Medical Institute, Departments
of Microbiology and Medicine, University of California Medical
Center, San Francisco, California 94143-0414
Received 12 September 2000/Accepted 20 November 2000
 |
ABSTRACT |
Open reading frame 71 (ORF 71) of Kaposi's sarcoma-associated
herpesvirus (KSHV) encodes a death effector domain-containing protein
that is homologous to cellular FLIPs (FLICE-inhibitory proteins) and is
proposed to inhibit Fas-mediated apoptosis. Transcripts bearing ORF 71 (v-FLIP) sequences are present in all latently infected cells. However,
mapping studies reveal these to be bi- or tricistronic mRNAs with ORF
71 located 3' to ORFs 72 (v-cyclin) and 73 (latency-associated nuclear
antigen), raising the question of how efficient expression of
v-FLIP is achieved. We explored this question by examining the
expression of model bicistronic (v-cyclin/LUC) transcripts in
which a luciferase (LUC) reporter replaced v-FLIP coding sequences. SLK
spindle cells transfected with such constructs efficiently expressed
luciferase from the 3' position, and this expression was independent of
the expression of the 5' v-cyclin gene. Surprisingly, transcript
mapping showed that in these cultures, efficient splicing occurred to
remove v-cyclin sequences and generate monocistronic LUC transcripts. Similar splicing events produced monocistronic v-FLIP transcripts in
KSHV-infected primary effusion lymphoma cells. However, these RNAs were
of low abundance and were inducible by treatment with 12-O-tetradecanoylphorbol-13-acetate. Examination of
the more abundant bicistronic latent RNAs revealed the presence of an
efficient internal ribosome entry site (IRES) overlapping
ORF 72 coding sequences. Thus, two potential mechanisms exist for
v-FLIP expression, but the evidence suggests that IRES-mediated
internal translational initiation on latent polycistronic mRNAs is
the principal source of v-FLIP in latency.
 |
INTRODUCTION |
Infection by Kaposi's
sarcoma-associated herpesvirus (KSHV) (also called human
herpesvirus 8) is strongly linked to development of Kaposi's sarcoma
(4, 26). KSHV is a lymphotropic (
-2) herpesvirus whose
principal target is the B cell; rarely, infection of such cells leads
to lymphoproliferative disease, including primary effusion lymphoma
(PEL) and multicentric Castleman's disease (3, 21, 26).
In all of these neoplasms, KSHV is principally found as a latent
infection, though lytic reactivation is also found in a small subset of
cells in these lesions (16, 17, 22). Since latent
viral gene products are thought to be the prime effectors of
cell proliferation in other gammaherpesvirus infections, much
attention has been focused on the KSHV latency program. One important
cluster of KSHV latency genes maps to open reading frames (ORFs) 73, 72, and 71, encoding the viral latency-associated nuclear antigen
(LANA), v-cyclin, and v-FLIP, respectively. LANA plays a role in
maintenance of the latent viral genome but also has been shown to block
function of p53 and pRb (2, 6, 9, 14). v-cyclin is a viral
homolog of cellular cyclin D and may play a role in cell cycle
deregulation (13, 18), though cell immortalization has
never been observed following KSHV infection of primary B cells. v-FLIP
is a viral death effector domain-containing protein that is homologous
to cellular FLICE (caspase-8)-inhibitory proteins (FLIPs). v-FLIPS of
other herpesviruses are known to block Fas-mediated apoptosis
(25) by preventing recruitment of caspase-8 to the
death-inducing signaling complex, and a similar activity has been
reported for KSHV v-FLIP (8). On this basis, v-FLIP is
assumed to play an important role in extending the survival of latently
infected cells.
Analysis of the fine structure of latent mRNAs from the ORF 71 to
73 coding regions has thus far revealed no monocistronic v-FLIP
mRNA (7, 19, 20, 24). Rather, v-FLIP coding sequences are found as the 3' ORF in bi- and tricistronic mRNAs bearing either ORF 72 alone or ORFs 73 and 72 upstream of the v-FLIP
AUG (see Fig. 1A). This has raised the question of how v-FLIP
expression is achieved in latency. Possibilities include (i) that
v-FLIP is encoded from the bi- or tricistronic mRNAs via either
leaky ribosomal scanning or direct, internal ribosome entry site
(IRES)-mediated initiation or (ii) that v-FLIP is expressed from a
previously overlooked monocistronic mRNA. Here we present data
indicating that multiple mechanisms may operate in KSHV infection, but
IRES-mediated internal initiation appears to be the predominant
expression strategy in latency.
 |
MATERIALS AND METHODS |
Cell lines.
293 and SLK (10) cells were
maintained in Dulbecco's modified Eagle medium H21 supplemented with
10% fetal calf serum (FCS). The KSHV-negative Burkitt's lymphoma cell
line BJAB was grown in RPMI 1640 supplemented with 10% FCS. The
KSHV-positive PEL cell lines BCBL-1 (17) and BC-3
(1) were cultured in RPMI 1640 supplemented with 10% FCS,
0.005 mM 2-mercaptoethanol, 1 mM sodium pyruvate, and 2 mM
L-glutamine or RPMI 1640 supplemented with 20% FCS,
respectively. For the induction of lytic viral replication, cells were
treated with 12-O-tetradecanoylphorbol-13-acetate (TPA) at a
final concentration of 20 ng/ml for 48 h.
Plasmids.
For the generation of bicistronic ORF 72/71
constructs, a genomic fragment containing the second exon of the
bicistronic ORF 72/71 mRNA (nucleotide positions 123776 to 122037 of the KSHV genome; GenBank accession number U75698) which includes the 3' nontranslated region (NTR) was PCR amplified with primers containing KpnI and EcoRI restriction sites and cloned in
the vector pCDNA3 (Invitrogen) to produce construct pCMV 72/71. An
alternative 5' primer was used for the generation of construct pCMV
72/71
uORF (containing nucleotides 123583 to 122037 of the KSHV
genome), which lacks most of the 5' region of the bicistronic
transcript (including the 5' upstream open reading frame [uORF]).
For the generation of bicistronic ORF 72/luciferase (LUC) reporter
constructs, a BamHI/EcoRI restriction fragment
containing ORF 71 was removed from the construct pCMV 72/71 and cloned
into the vector pRSETB (Invitrogen), ORF 71 was excised with the
restriction enzymes NcoI and BglII and replaced
by the coding region of the Photinus luciferase amplified
from the vector pGL3-basic (Promega), and the cassette was reinserted
into the parental construct pCMV 72/71 using the BamHI and
EcoRI restriction sites to yield construct pCMV 72/LUC.
Additional reporters were generated based on these constructs: (i) the
region upstream of a HindIII site overlapping the ORF 72 stop codon was excised to generate a monocistronic luciferase construct
(pCMV LUC) which served as a positive control; overlapping PCR with
primers containing the desired mutations was used (ii) to eliminate the
ORF 72 start codon (GCTCGCCACTCTATATGGCA
GCTCGCCACTCTATCGATCA; the ORF 72 start codon is shown
in bold and mutated nucleotides are underlined) or (iii) to optimize
the nucleotides surrounding the ORF 72 start codon with regard to the
efficiency of translational initiation
(GCTCGCCACTCTATATGGCA
GCTCGGCCGCCACCATGGCA)
(12); (iv) the 82-bp noncoding segment between the
HindIII and NcoI sites overlapping the ORF 72 stop codon or the ORF 71 start codon, respectively, was replaced by an
unrelated nucleotide sequence of 83 bp consisting of a
ScaI-NcoI polylinker fragment of the vector pGL3
basic (Invitrogen); (v) with the exception of the 16 nucleotides (nt)
immediately upstream of the ORF 72 start codon, the complete 5' region,
including a small uORF, was removed.
Bicistronic
Renilla/
Photinus luciferase (RP)
reporter constructs are based on the construct pRP (kindly provided by
Anne E.
Willis, University of Leicester, Leicester, United Kingdom
[
23]).
The construct contains the coding region of the
Photinus luciferase
downstream of the gene for the
Renilla luciferase. Fragments spanning
232, 474, 658, or 856 bp of the region upstream of the ORF 71
start codon were PCR amplified
with primers containing
EcoRI and
NcoI
restriction sites and inserted in the
EcoRI and
NcoI sites
located in the intercistronic region of the
construct pRP. To
generate a negative control, an
NcoI
fragment containing 856 bp
of the region upstream of ORF 71 was removed
from the bicistronic
pCMV 72/LUC construct optimized for translational
initiation (see
above) and inserted into the
NcoI site of
the construct pRP in
an antisense orientation (

856as). Positive
controls were obtained
by cloning the IRES elements of the
encephalomyocarditis virus
(EMCV) or the poliovirus (nt 260 to 851 of
the EMCV genome, GenBank
accession number NC_001479, and
nucleotides 66 to 755 of the poliovirus
genome, GenBank accession
number NC_002058). Finally, because
the original vector pRP
contains a chimeric intron immediately
downstream of the SV40 promoter,
the expression cassettes from
all bicistronic constructs were excised
with
EcoRV and
XbaI and
inserted into the vector
pCDNA3.1/Zeo(+) (Invitrogen) to yield
constructs pCMV:RP,
pCMV:RP

232, pCMV:RP

474, pCMV:RP

658,
pCMV:RP

856,
pCMV:RP

856as, pCMV:RP ECMV, and pCMV:RP
Polio.
Transfections.
SLK cells were transfected with plasmid DNA
using the Fugene 6 transfection reagent (Boehringer Mannheim) according
to the manufacturer's recommendations and harvested after 36 h.
For the introduction of in vitro-transcribed RNA into 293 cells by
electroporation, cells were trypsinized, washed three times with
phosphate-buffered saline and resuspended in phosphate-buffered saline
at a concentration of 4 × 106 cells/ml. Aliquots (400 µl each) of the cell suspension (1.6 × 106 cells)
were mixed with 10 µg of in vitro-transcribed RNA in cuvettes with a
0.2-cm electrode gap and immediately subjected to electroporation, using an Electro Cell Manipulator 600 (BTX Inc., San Diego, Calif.) with the following settings: 150 V, 500 µF, 24
. After the pulse, cells were resuspended in complete medium and incubated at 37°C in a
5% CO2 incubator. Aliquots of the cells (4 × 105 cells) were harvested after 1.5, 2.5, 3.5, and 4.5 h and analyzed for luciferase expression.
RNA isolation and Northern blotting.
Total RNA was isolated
using the RNAzol reagent (Tel-Test, Inc., Friendswood, Tex.) according
to the supplier's instructions. For Northern blotting, 12 µg of RNA
was separated on a 1% formaldehyde gel, transferred to nylon
membranes, and analyzed by hybridization to radioactively labeled
probes as described previously (11).
RT-PCR and Southern blotting.
Reverse transcription-PCR
(RT-PCR) was performed using the Titan One-Tube RT-PCR System
(Boehringer Mannheim) following the manufacturer's instructions. For
the analysis of spliced RNA transcripts produced in transiently
transfected SLK cells, total RNA was isolated from SLK cells
transfected with pCMV 72/LUC and subjected to RT-PCR with primers
specific for nt 123777 to 123762 and 122813 to 122790 of the KSHV
genome, initiating 210 bp upstream and 4 bp downstream of the ORF 72 start and stop codons, respectively. RT-PCR products of 988 bp
(amplified from the unspliced transcript) and 253 bp (amplified from
the spliced transcript) were obtained and analyzed by sequencing.
For the detection of monocistronic ORF 71 transcripts in PEL cells, 1 µg of total RNA was subjected to cDNA synthesis with
a 3' primer
specific for nt 122541 to 122566 of the KSHV genome
(5'-CGCTAACAGGGGAAACGTTAACCTGC) for 35 min at 50°C,
followed by
30 cycles of PCR amplification using the same 3' primer and
a
5' primer specific for nt 127894 to 127871 of the KSHV genome
(5'-GCGCCACGAAGCAGTCACGTCCC). Aliquots of the samples (15 µl of
a 50-µl reaction mixture) were analyzed by Southern blotting
as
described previously (
15) using a probe
encompassing nucleotides
122645 to 122859 of the KSHV
genome.
In vitro transcription and translation.
Transcription and
translation of bicistronic ORF 71/72 constructs were carried out using
the TNT T7 quick coupled transcription/translation system (Promega)
following the manufacturer's instructions. Aliquots of the reaction
mixtures (3 µl of a 50-µl reaction mixture) were analyzed by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
subsequent autoradiography. For the transfection of bicistronic
reporter transcripts into 293 cells, large-scale in vitro synthesis of
capped RNAs was carried out using the mMESSAGE mMACHINE kit (Ambion,
Austin, Tex.) according to the manufacturer's instructions. Briefly, 1 µg of linearized plasmid DNA was transcribed for 2 h at 37°C
in a reaction mixture with a final 7-methyl-GTP:GTP ratio of 1.3:1.
After addition of DNase 1, reaction mixtures were incubated for 15 min at 37°C to remove template DNA; the complete loss of template DNA
was verified by gel electrophoresis. RNA was recovered by precipitation
with 1/2 volumes of a 7.5 M lithium chloride-75 mM EDTA solution,
washed twice with 70% ethanol, and resuspended in H2O.
Luciferase assays.
For quantification of luciferase
expressed from bicistronic ORF 72/luciferase RNAs, SLK cells were
cotransfected with the various bicistronic constructs and a
-galactosidase expression construct. Luciferase activity was
determined using the luciferase assay system (Promega) according to the
manufacturer's instructions in a TD-20/20 luminometer (Turner
Designs). Luciferase activity was normalized for transfection
efficiency, as determined by quantification of
-galactosidase
activity with Promega's
-galactosidase enzyme assay system. The
activities of Renilla and Photinus luciferase in
SLK cells transfected with bicistronic RP constructs or 293 cells
electroporated with bicistronic RP-RNA transcripts were quantitated
simultaneously with Promega's dual-luciferase reporter assay system.
The kit allows discrimination of the two enzymatic activities due to
different cofactor requirements.
 |
RESULTS AND DISCUSSION |
Experimental strategy.
To explore the translational potential
of the bicistronic ORF 72/71 mRNA, we constructed a model of this
transcript in which the v-FLIP coding region was replaced by a
luciferase reporter. Plasmid pCMV 72/LUC (Fig.
1A, line 2) employs a cytomegalovirus (CMV) promoter to drive expression of a transcript containing the
authentic 5' NTR, v-cyclin gene, intergenic region, and v-FLIP AUG of the bicistronic RNA's second exon; however, the v-FLIP start codon is fused to a LUC reporter to permit sensitive
enzymatic detection of its translation product. If either leaky
scanning or internal initiation is used, efficient luciferase
expression should result. Scanning can be readily differentiated from
internal ribosome entry in such a system, because in scanning models,
altering the utilization of the 5' AUG influences expression of the 3' cistron; such maneuvers, however, do not affect IRES-mediated internal
initiation at the 3' cistron. Accordingly, in addition to the parental
pCMV 72/LUC construct, we constructed derivatives in which the 5'
v-cyclin AUG was ablated (Fig. 1B, line 2) or in which its context was
changed to conform to a consensus sequence optimized for translational
initation (Fig. 1B, line 3) (12). In constructing these
plasmids, we noted the existence of a previously unrecognized small ORF
in the 5' NTR of the ORF 72/71 mRNA (termed uORF) (Fig. 1A); since
such small ORFs sometimes play a role in translational control, we also
constructed a derivative in which it was deleted (Fig. 1B, line 5).
Each construct was transfected into SLK cells, an immortalized but
KSHV-negative spindle cell line derived from a classical Kaposi's
sarcoma tumor (10). Thirty-six hours later, luciferase
activity was measured in cell extracts and compared to that expressed
by pCMV LUC, encoding a monocistronic RNA driven by the same promoter.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Luciferase expression from bicistronic ORF 72/luciferase
reporter constructs. (A) Design of a bicistronic ORF 72/luciferase
construct. A genomic fragment containing the second exon of the
bicistronic ORF 72/71 mRNA was cloned in the vector pCDNA3, and ORF
71 was replaced by the coding region of the Photinus
luciferase. From the resulting construct, pCMV 72/LUC, the region
upstream of a HindIII site overlapping the ORF 72 stop
codon was excised to generate a monocistronic luciferase construct
(pCMV LUC) serving as a positive control. (B) Expression of luciferase
from bicistronic reporter constructs in SLK cells. The bicistronic
construct pCMV 72/LUC described above is shown in line 1. Additional
reporters derived from this construct were modified as follows: the ORF
72 start codon was eliminated (line 2); the nucleotides surrounding
the ORF 72 start codon were optimized for translational initiation
(12) (line 3); the noncoding segment between ORF 72 and
ORF 71 was replaced by an unrelated nucleotide sequence of similar size
(line 4); and the region upstream of the ORF 72 start codon was
deleted (line 5). The luciferase activity expressed by the
monocistronic luciferase construct pCMV LUC described above was set to
100%. Relative luciferase activity of the bicistronic constructs
is shown as a percentage of that activity. Each transfection
was performed in triplicate per experiment, and the values shown
are averaged from three independent experiments.
|
|
Expression of luciferase is efficient and is independent of
v-cyclin translation.
As shown in Fig. 1B, substantial amounts of
luciferase were expressed from all of the bicistronic
constructs
levels were generally within 40% of that of the
monocistronic control. Interestingly, ablation of the 5' v-cyclin AUG
did not enhance expression of the reporter, nor did optimization of
that AUG impair reporter expression. These findings were consistent
with an IRES-directed mechanism for v-FLIP expression. However, a
paradoxical result with the remaining mutant led us to examine the
situation more closely. Deletion of the uORF in the 5'-NTR appeared to
reduce reporter expression to 10% of that of the monocistronic
construct. This result does not accord well with either a scanning or
an IRES model, unless the deletion incidentally affected the structure or accumulation of the mRNA.
mRNA structure analysis.
Accordingly, we examined the
transcripts produced by all these constructs by Northern blotting (Fig.
2). Total RNA prepared from transfected
SLK cells was analyzed with probes specific for either luciferase (Fig.
2A) or ORF 72/v-cyclin (Fig. 2B). Surprisingly, most constructs
produced two sets of transcripts
an upper doublet that hybridized with
both probes, consistent with the expected bicistronic RNA, and a lower
doublet that annealed only to luciferase sequences. [The doublet
character of each band is due to the alternative use of one of two
poly(A) signals present in the construct.] Since there is no existing
evidence for a promoter within ORF 72, we surmised that the lower
species must have been derived by splicing out v-cyclin sequences from
a bicistronic pre-mRNA. Indeed, inspection of the nucleotide
sequence of the locus revealed a consensus splice donor and acceptor
that could account for these findings. The candidate splice donor was
located at nt 123595 between the 5' uORF and the v-cyclin AUG, and the
putative splice acceptor was positioned distally within ORF 72, 14 nt
downstream of the last internal AUG (Fig.
3). Consistent with this, we noted that
the deletion of the 5' uORF (Fig. 1B, line 5) also encompassed the potential splice donor; this deletion ablated the production of the
lower bands while preserving synthesis of the upper (unspliced) RNA
species (Fig. 2, lane 5).

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of luciferase-bearing transcripts in cells
transfected with bicistronic reporters. SLK cells were transfected
with the bicistronic constructs illustrated in Fig. 1 (lanes 1 to 5), the monocistronic luciferase control pCMV LUC (lane 6), or a
vector control (rightmost lane). Total RNA was extracted 36 h
posttransfection and analyzed by Northern blotting, using probes
specific for luciferase (A) or the 5'-proximal 600 bp of ORF 72 (B).
The expected transcript sizes were approximately 3.2 and 3.0 kb for the
unspliced bicistronic transcripts in lanes 1 to 4 or lane 5, respectively, and 2.2 kb for the monocistronic luciferase construct in
lane 6. The position of the spliced transcripts in lanes 1 to 4 is
marked by an arrow in panel A. Bands appear as doublets as a result of
usage of two different transcriptional termination sites. The
constructs contain the KSHV polyadenylation signal downstream of ORF 71 in addition to the bovine growth hormone polyadenylation signal which
is provided by the vector pCDNA3.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
A 735-nt segment spanning most of the ORF 72 coding
region is flanked by functional splice sites. The location of splice
sites was determined by RT-PCR amplification and sequencing of splice
products as described in Materials and Methods. The genomic sequences
flanking the splice donor and acceptor sites are shown in the left and
right text boxes, respectively. Within the text boxes, slashes indicate
the exact position of the splice donor and acceptor sites, located at
nt 123595 and 122859 of the KSHV genome, respectively. Conserved
nucleotides (shown in bold) at both sites and a pyrimidine-rich tract
(shown underlined) upstream of the acceptor site identify them as
consensus splice sites. The start codon of ORF 72 is shown framed
within the left text box. The structures of the bicistronic ORF 72/71
and the spliced monocistronic ORF 71 transcripts are illustrated in the
lower part of the figure. The locations of the splice sites are
indicated by lines emanating from the text boxes. Simple arrows
indicate the start codon and the positions of additional AUG
codons within the coding region of ORF 72. Arrows marked with
asterisks indicate the Kozak start codons (12) which
initiate the 5' uORF and ORF 71. Note that the splice sites are
situated to remove the ORF 72 start codon as well as all internal
AUG codons, leaving a 66-bp fragment of ORF 72 devoid of potential
translation initiation sites.
|
|
To verify that splicing was indeed occurring and to map the putative
splice junctions, we used RT-PCR to determine the fine
structure of the
lower RNA band. Primers flanking ORF 72 were
used to PCR amplify
reverse transcripts of RNA from pCMV 72/LUC-transfected
SLK cells (data
not shown). Sequencing of the RT-PCR product established
the splice
junction shown in Fig.
3, exactly in accord with the
predicted splice
junctions.
Does this splicing event occur in bona fide KSHV infection, or is it
limited to cells transiently transfected with recombinant
plasmids? To
answer this question, we examined several PEL cell
lines that harbor
latent KSHV genomes, both before and after lytic
induction with TPA. As
previously reported (
7,
19,
20,
24), neither BCBL-1 nor
BC-3 cells harbored monocistronic v-FLIP
mRNAs detectable by
Northern blotting (data not shown). RT-PCR
analysis was carried out to
look for transcripts of lower abundance.
Since the promoter for the ORF
73/72/71 transcription unit is
5' to ORF 73, we positioned the 5'
primer in the NTR upstream
of the LANA coding region, while the
3' primer was located within
v-FLIP coding sequences (Fig.
4, top). Utilization of the known
splice
sites of this transcription unit could generate a monocistronic
v-FLIP
RNA in two ways: (i) a single splice from the donor in
the LANA
5'-NTR to the acceptor upstream of the v-FLIP AUG (generating
a
290-nt PCR product) or (ii) a splice from the LANA 5'-NTR donor
to the
known acceptor 5' to ORF 72, followed by removal of the
cyclin AUGs by
a second splicing event identical to that seen
in our luciferase
constructs (generating a 470-bp PCR product).
In the latter case, the
doubly spliced v-FLIP RNA would be derived
from the same pre-RNA that
generates singly spliced v-cyclin transcripts
(Fig.
4, top). Figure
4
(bottom) shows that only doubly spliced
monocistronic v-FLIP
transcripts are detected by this analysis.
Interestingly, these RNAs
are barely detectable prior to TPA treatment
but become somewhat
more abundant following TPA exposure. Since
5' primers located upstream
of the LANA promoter did not detect
these species, they do not
emanate from read-through from upstream
lytic promoters (not
shown). The increase in their abundance may
reflect stabilization of
the RNA in the environment of lytic replication
or use of a previously
unrecognized cryptic lytic promoter in
the region. The very low
abundance of the RNA, however, precluded
mapping of its start site.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 4.
A monocistronic ORF 71 transcript is generated in vivo
in PEL cells. Top, location of hybridization sites of RT-PCR
primers (indicated by arrows) specific for nt 122566 to 122541 (within ORF 71) and 127871 to 127849 (upstream of ORF 73) of the KSHV
genome. The expected size of products amplified from the 1.8-kb
bicistronic ORF 72/71 mRNA (1,200 bp) or a putative 1.1-kb
monocistronic ORF 71 mRNA (470 bp) is indicated to the right of the
transcripts. Bottom, RT-PCR from KSHV-positive and -negative cells
using the primers described above. The KSHV-positive PEL cell lines
BCBL-1 and BC-3 and the KSHV-negative Burkitt's lymphoma cell line
BJAB were treated with TPA to induce lytic replication. Total RNA was
isolated from uninduced or induced cells and subjected to RT-PCR as
described in Materials and Methods. Aliquots of the samples were
analyzed by Southern blotting using a probe encompassing nt 122645 to
122859 of the KSHV genome. The positions of amplification products
derived from the bicistronic ORF 72/71 and the monocistronic ORF 71 transcripts are marked by arrows. Sequencing confirmed that the 470-bp
product was amplified from a monocistronic RNA resulting from a double
splice as illustrated. A product of 290 bp indicative of an ORF 71 transcript generated by a single splice removing nucleotides 122860 to
127812 (see the text) was not detected.
|
|
An IRES in the bicistronic ORF 72/71 mRNA.
The presence of
a low-abundance monocistronic ORF 71 RNA as well as a high-abundance
bicistronic ORF 72/71 RNA raises the question of which one contributes
more to the translation of v-FLIP in KSHV infection. Our analysis of
luciferase expression in reporter constructs (Fig. 1) was fully
compatible with expression from the v-FLIP AUG via an IRES-mediated
mechanism from the bicistronic ORF 72/71 RNA, but in transfected SLK
cells the high abundance of the monocistronic transcript could have
obscured a contribution from this mechanism. To search directly for an
IRES within the 72/71 mRNA, we carried out additional experiments.
First, we replaced the intergenic region in pCMV 72/LUC with a foreign
sequence of comparable length. As shown in Fig. 1B (line 4), this
substitution did not affect LUC expression, indicating that an IRES, if
present, is likely to be upstream of these sequences.
We then cloned fragments from the ORF 72 coding region into the
intergenic region of a bicistronic transcription unit composed
of two
luciferase coding regions (Fig.
5A). The
5' LUC gene is
derived from
Renilla, while the 3' LUC is
from
Photinus. The two
enzymes have different cofactor
requirements and therefore can
be readily differentiated from one
another. All potential splice
donor sites were removed from the 5'-NTR
of this vector, to avoid
problems with splicing to the acceptor site
within ORF 72. Fragments
of 232, 474, 658, or 856 bp from the region
upstream of the ORF
71 AUG were inserted between the two LUC genes, and
each construct
was transfected into SLK cells. Analysis of the
resulting RNAs
by Northern blotting confirmed that only a single,
bicistronic
transcript was being produced in each case (Fig.
5B). We
then
measured the activities of the 5' and 3' luciferase proteins
produced
in such transfectants; the ratio of
Photinus to
Renilla activities
(P:R) provides an index of the efficiency
of internal initiation
at the AUG codon of the 3' reporter. The P:R
ratio generated by
the parental (IRES-negative) vector was set to 1.0. As shown in
Fig.
5C, all four fragments of ORF 72 DNA cloned in the
sense
orientation allowed substantial expression of the downstream
reporter,
while a control fragment cloned in the antisense orientation
did
not. (Although the transcripts from this antisense control were
expressed less efficiently [Fig.
5B], expressing the results as
the
P:R ratio normalizes for this effect and affirms the absence
of IRES
activity in this construct.) These findings indicate that
an IRES
element is indeed present within these ORF 72 sequences.
The P:R
activity ratios generated by these constructs were 30
to 50% of those
produced by the strong IRES elements from EMCV
and poliovirus
(
5), and a fragment as small as 232 nt was sufficient
to
allow efficient internal initiation.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
An IRES is located upstream of ORF 71. (A) Basic
bicistronic Renilla/Photinus (RP) luciferase
reporter construct used to detect IRES activity. The construct pCDNA3.1
RP contains the coding region of the Photinus luciferase
downstream of the gene for the Renilla luciferase.
Expression is driven by the CMV promoter in transfection experiments; a
T7 promoter is also available for in vitro transcription (see Fig. 6).
Fragments of 232, 474, 658, or 856 bp (the largest fragment contains
the complete ORF 72 coding region) upstream of the ORF 71 start
codon were inserted in the EcoRI and NcoI
sites located in the intercistronic region of the vectors. The
authentic ORF 71 start codon was fused to the Photinus
luciferase ORF. The 856-bp fragment was also inserted in an antisense
orientation (pCMV:RP 856as). The IRES elements from the poliovirus
and EMCV served as positive controls. (B) Analysis of transcripts
expressed by bicistronic Renilla/Photinus
luciferase constructs. Total RNA was isolated from SLK cells 36 h
after transfection with the indicated constructs and analyzed by
Northern blotting using a probe specific for the Photinus
luciferase. Staining of the gel with ethidium bromide showed equal
amounts of total RNA loaded in each lane (not shown). (C) IRES activity
mediated by the region upstream of ORF 71. SLK cells transfected with
the bicistronic constructs were harvested 36 h posttransfection,
and Renilla and Photinus luciferase activities
were quantitated. The relative luciferase activity (ratio of
Photinus to Renilla luciferase activity [P:R])
was calculated and normalized against the activity of the construct
pCDNA3.1 RP, whose P:R ratio was set to 1. Each transfection was
performed in triplicate.
|
|
To further substantiate these findings, we transcribed these same
constructs in vitro with T7 RNA polymerase and examined
the in vivo
translatability of the resulting RNAs (after degrading
the DNA template
with DNase) by transfecting them into SLK cells;
1.5 to 4.5 h
later, cell extracts were assayed for both luciferase
activities and
the P:R activity ratio was calculated as before.
The presence of KSHV
sequences significantly increased the expression
of the downstream
Photinus luciferase relative to that of the
upstream
Renilla enzyme; in this assay, the P:R ratios mediated
by
the KSHV IRES were between 16 and 49% of those mediated by
the
poliovirus IRES (Fig.
6). Interestingly,
the individual fragments
did not all behave identically (relative to
one another) in the
two assays

for example, the 232-nt insert
typically displayed
more activity relative to the 474-nt insert in the
RNA-based transfection
(Fig.
6) than in the conventional DNA
transfection experiment
(Fig.
5C). While we do not know the reasons for
this modest dichotomy,
we speculate that the secondary structures
adopted in vitro differ
from those generated in vivo and may influence
the accessibility
of the ribosome to the IRES. But in any case, all
fragments that
were active in one assay were active in the second, and
the parental
vector and antisense control constructs were similarly
negative
in both assays.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
Expression of Renilla/Photinus
luciferase in SLK cells transfected with RNA transcribed in vitro from
bicistronic RP constructs. RNA was transcribed in vitro as described in
Materials and Methods and introduced into 293 cells by electroporation.
Aliquots of the cells were harvested at 1.5, 2.5, 3.5, and 4.5 h after
electroporation and analyzed for Renilla and
Photinus luciferase activity. Shown are the mean values of
normalized, relative luciferase activity (see the legend to Fig. 5C)
over the total time period of 4.5 h.
|
|
The experiments described above utilized reporter constructs in which
ORF 71 was replaced by the luciferase coding region.
To investigate
v-FLIP expression from the intact bicistronic RNA,
we subjected
constructs encoding ORF 72/71 transcripts to in vitro
transcription and
translation. As shown in Fig.
7, lane 1, the
v-FLIP protein was indeed translated from a bicistronic transcript.
Furthermore, in accordance with the assumption that v-cyclin
translation
is initiated by ribosomal scanning, deletion of the 5' uORF
(Fig.
7, lane 2) led to an at least 10- to 20-fold increase in the
levels
of v-cyclin. In contrast, v-FLIP levels were virtually
unaffected,
as expected for internal initiation of v-FLIP translation
mediated
by an IRES present within the bicistronic transcript.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
v-FLIP is translated from a bicistronic ORF 72/71 RNA in
vitro. Constructs encoding either the complete second exon of the
bicistronic ORF 72/71 RNA (pCMV 72/71; lane 1) or the second exon with
a deletion of the 5' uORF (pCMV 72/71 uORF; lane 2) were in vitro
transcribed and translated. [35S]methionine-labeled
translation products were subsequently analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and autoradiography. The
positions of the v-cyclin and the v-FLIP proteins are indicated by
arrows. The identity of the lower band (v-FLIP) was verified by in
vitro transcription and translation of constructs in which ORF 71 was
deleted or replaced by luciferase (data not shown).
|
|
These data demonstrate that cells infected with KSHV can employ two
different strategies for v-FLIP expression. We believe
that the use of
the IRES within the bicistronic ORF 72/71 mRNA
represents the
dominant strategy for v-FLIP expression in latency.
We note that the
levels of luciferase produced by a model bicistronic
construct (Fig.
1B, line 5) are ca. 10% of those generated from
a monocistronic
construct. Since the bicistronic ORF 72/71 RNA
is at least 100- to
500-fold more abundant than the monocistronic
ORF 71 RNA in latent PEL
cells, translation of the latter RNA
is predicted to make only a small
contribution to the intracellular
pool of v-FLIP in latency. (This
assumes that the translational
efficiencies of our reporters
approximate those of the authentic
messages

a reasonable assumption
since they preserve the authentic
v-FLIP AUG and IRES elements.) The
function of the monocistronic
transcript is unclear. It might be a
device for assuring continued
expression of v-FLIP in lytic infection,
or it might be merely
an incidental finding resulting from alternative
processing of
the bicistronic (or tricistronic) pre-mRNA. (If the
latter, the
alternatively processed RNAs must be stabilized by TPA
treatment).
The low efficiency of this processing in PEL cells in vivo
is
of interest, since the identical splice sites were efficiently
utilized in the context of the ORF 72/LUC reporter in transiently
transfected cells (Fig.
2). When this LUC gene was replaced by
ORF 71 sequences, splicing of this transcript in transiently transfected
SLK
cells was suppressed (A. Grundhoff and D. Ganem, unpublished
results),
suggesting that
cis-acting features of the ORF 72/71
RNA
impair its efficient splicing. This is the presumed explanation
for the
low abundance of monocistronic v-FLIP RNA and almost certainly
accounts
for why it eluded earlier searches based largely on Northern
blotting.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, University of California Medical Center, 513 Parnassus Ave., HSE 405, San Francisco, CA 94143-0414. Phone: (415) 476-2826. Fax: (415) 476-0939. E-mail:
ganem{at}cgl.ucsf.edu.
 |
REFERENCES |
| 1.
|
Arvanitakis, L.,
E. A. Mesri,
R. G. Nador,
J. W. Said,
A. S. Asch,
D. M. Knowles, and E. Cesarman.
1996.
Establishment and characterization of a primary effusion (body cavity-based) lymphoma cell line (BC-3) harboring Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) in the absence of Epstein-Barr virus.
Blood
88:2648-2654[Abstract/Free Full Text].
|
| 2.
|
Ballestas, M. E.,
P. A. Chatis, and K. M. Kaye.
1999.
Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen.
Science
284:641-644[Abstract/Free Full Text].
|
| 3.
|
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191[Abstract/Free Full Text].
|
| 4.
|
Chang, Y.,
E. Cesarman,
M. S. Pessin,
F. Lee,
J. Culpepper,
D. M. Knowles, and P. S. Moore.
1994.
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865-1869[Abstract/Free Full Text].
|
| 5.
|
Chappell, S. A.,
G. M. Edelman, and V. P. Mauro.
2000.
A 9-nt segment of a cellular mRNA can function as an internal ribosome entry site (IRES) and when present in linked multiple copies greatly enhances IRES activity.
Proc. Natl. Acad. Sci. USA
97:1536-1541[Abstract/Free Full Text].
|
| 6.
|
Cotter, M. A., II, and E. S. Robertson.
1999.
The latency-associated nuclear antigen tethers the Kaposi's sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells.
Virology
264:254-264[CrossRef][Medline].
|
| 7.
|
Dittmer, D.,
M. Lagunoff,
R. Renne,
K. Staskus,
A. Haase, and D. Ganem.
1998.
A cluster of latently expressed genes in Kaposi's sarcoma-associated herpesvirus.
J. Virol.
72:8309-8315[Abstract/Free Full Text].
|
| 8.
|
Djerbi, M.,
V. Screpanti,
A. I. Catrina,
B. Bogen,
P. Biberfeld, and A. Grandien.
1999.
The inhibitor of death receptor signaling, FLICE-inhibitory protein defines a new class of tumor progression factors.
J. Exp. Med.
190:1025-1032[Abstract/Free Full Text].
|
| 9.
|
Friborg, J., Jr.,
W. Kong,
M. O. Hottiger, and G. J. Nabel.
1999.
p53 inhibition by the LANA protein of KSHV protects against cell death.
Nature
402:889-894[Medline].
|
| 10.
|
Herndier, B. G.,
A. Werner,
P. Arnstein,
N. W. Abbey,
F. Demartis,
R. L. Cohen,
M. A. Shuman, and J. A. Levy.
1994.
Characterization of a human Kaposi's sarcoma cell line that induces angiogenic tumors in animals.
AIDS
8:575-581[Medline].
|
| 11.
|
Kirshner, J. R.,
D. M. Lukac,
J. Chang, and D. Ganem.
2000.
Kaposi's sarcoma-associated herpesvirus open reading frame 57 encodes a posttranscriptional regulator with multiple distinct activities.
J. Virol.
74:3586-3597[Abstract/Free Full Text].
|
| 12.
|
Kozak, M.
1986.
Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.
Cell
44:283-292[CrossRef][Medline].
|
| 13.
|
Li, M.,
H. Lee,
D. W. Yoon,
J. C. Albrecht,
B. Fleckenstein,
F. Neipel, and J. U. Jung.
1997.
Kaposi's sarcoma-associated herpesvirus encodes a functional cyclin.
J. Virol.
71:1984-1991[Abstract].
|
| 14.
|
Radkov, S. A.,
P. Kellam, and C. Boshoff.
2000.
The latent nuclear antigen of Kaposi sarcoma-associated herpesvirus targets the retinoblastoma-E2F pathway and with the oncogene hras transforms primary rat cells.
Nat. Med.
6:1121-1127[CrossRef][Medline].
|
| 15.
|
Renne, R.,
D. Blackbourn,
D. Whitby,
J. Levy, and D. Ganem.
1998.
Limited transmission of Kaposi's sarcoma-associated herpesvirus in cultured cells.
J. Virol.
72:5182-5188[Abstract/Free Full Text].
|
| 16.
|
Renne, R.,
M. Lagunoff,
W. Zhong, and D. Ganem.
1996.
The size and conformation of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) DNA in infected cells and virions.
J. Virol.
70:8151-8154[Abstract].
|
| 17.
|
Renne, R.,
W. Zhong,
B. Herndier,
M. McGrath,
N. Abbey,
D. Kedes, and D. Ganem.
1996.
Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture.
Nat. Med.
2:342-346[CrossRef][Medline].
|
| 18.
|
Russo, J. J.,
R. A. Bohenzky,
M. C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 19.
|
Sarid, R.,
O. Flore,
R. A. Bohenzky,
Y. Chang, and P. S. Moore.
1998.
Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1).
J. Virol.
72:1005-1012[Abstract/Free Full Text].
|
| 20.
|
Sarid, R.,
J. S. Wiezorek,
P. S. Moore, and Y. Chang.
1999.
Characterization and cell cycle regulation of the major Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) latent genes and their promoter.
J. Virol.
73:1438-1446[Abstract/Free Full Text].
|
| 21.
|
Soulier, J.,
L. Grollet,
E. Oksenhendler,
P. Cacoub,
D. Cazals-Hatem,
P. Babinet,
M. F. d'Agay,
J. P. Clauvel,
M. Raphael,
L. Degos, et al.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276-1280[Abstract/Free Full Text].
|
| 22.
|
Staskus, K. A.,
W. Zhong,
K. Gebhard,
B. Herndier,
H. Wang,
R. Renne,
J. Beneke,
J. Pudney,
D. J. Anderson,
D. Ganem, and A. T. Haase.
1997.
Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells.
J. Virol.
71:715-719[Abstract].
|
| 23.
|
Stoneley, M.,
F. E. Paulin,
J. P. Le Quesne,
S. A. Chappell, and A. E. Willis.
1998.
C-Myc 5' untranslated region contains an internal ribosome entry segment.
Oncogene
16:423-428[CrossRef][Medline].
|
| 24.
|
Talbot, S. J.,
R. A. Weiss,
P. Kellam, and C. Boshoff.
1999.
Transcriptional analysis of human herpesvirus-8 open reading frames 71, 72, 73, K14, and 74 in a primary effusion lymphoma cell line.
Virology
257:84-94[CrossRef][Medline].
|
| 25.
|
Thome, M.,
P. Schneider,
K. Hofmann,
H. Fickenscher,
E. Meinl,
F. Neipel,
C. Mattmann,
K. Burns,
J. L. Bodmer,
M. Schroter,
C. Scaffidi,
P. H. Krammer,
M. E. Peter, and J. Tschopp.
1997.
Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors.
Nature
386:517-521[CrossRef][Medline].
|
| 26.
|
Whitby, D., and C. Boshoff.
1998.
Kaposi's sarcoma herpesvirus as a new paradigm for virus-induced oncogenesis.
Curr. Opin. Oncol.
10:405-412[Medline].
|
Journal of Virology, February 2001, p. 1857-1863, Vol. 75, No. 4
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.4.1857-1863.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wen, K. W., Dittmer, D. P., Damania, B.
(2009). Disruption of LANA in Rhesus Rhadinovirus Generates a Highly Lytic Recombinant Virus. J. Virol.
83: 9786-9802
[Abstract]
[Full Text]
-
Tahiri-Alaoui, A., Smith, L. P., Baigent, S., Kgosana, L., Petherbridge, L. J., Lambeth, L. S., James, W., Nair, V.
(2009). Identification of an Intercistronic Internal Ribosome Entry Site in a Marek's Disease Virus Immediate-Early Gene. J. Virol.
83: 5846-5853
[Abstract]
[Full Text]
-
Deniz, N., Lenarcic, E. M., Landry, D. M., Thompson, S. R.
(2009). Translation initiation factors are not required for Dicistroviridae IRES function in vivo. RNA
15: 932-946
[Abstract]
[Full Text]
-
Konrad, A., Wies, E., Thurau, M., Marquardt, G., Naschberger, E., Hentschel, S., Jochmann, R., Schulz, T. F., Erfle, H., Brors, B., Lausen, B., Neipel, F., Sturzl, M.
(2009). A Systems Biology Approach To Identify the Combination Effects of Human Herpesvirus 8 Genes on NF-{kappa}B Activation. J. Virol.
83: 2563-2574
[Abstract]
[Full Text]
-
Carter, J. R., Fraser, T. S., Fraser, M. J. Jr
(2008). Examining the relative activity of several dicistrovirus intergenic internal ribosome entry site elements in uninfected insect and mammalian cell lines. J. Gen. Virol.
89: 3150-3155
[Abstract]
[Full Text]
-
Beaudoin, M. E., Poirel, V.-J., Krushel, L. A.
(2008). Regulating amyloid precursor protein synthesis through an internal ribosomal entry site. Nucleic Acids Res
36: 6835-6847
[Abstract]
[Full Text]
-
Majerciak, V., Yamanegi, K., Zheng, Z.-M.
(2006). Gene Structure and Expression of Kaposi's Sarcoma-Associated Herpesvirus ORF56, ORF57, ORF58, and ORF59. J. Virol.
80: 11968-11981
[Abstract]
[Full Text]
-
Cai, X., Li, G., Laimins, L. A., Cullen, B. R.
(2006). Human Papillomavirus Genotype 31 Does Not Express Detectable MicroRNA Levels during Latent or Productive Virus Replication.. J. Virol.
80: 10890-10893
[Abstract]
[Full Text]
-
Baird, S. D., Turcotte, M., Korneluk, R. G., Holcik, M.
(2006). Searching for IRES. RNA
12: 1755-1785
[Abstract]
[Full Text]
-
Haque, M., Wang, V., Davis, D. A., Zheng, Z.-M., Yarchoan, R.
(2006). Genetic Organization and Hypoxic Activation of the Kaposi's Sarcoma-Associated Herpesvirus ORF34-37 Gene Cluster. J. Virol.
80: 7037-7051
[Abstract]
[Full Text]
-
Yu, Y., Alwine, J. C.
(2006). 19S Late mRNAs of Simian Virus 40 Have an Internal Ribosome Entry Site Upstream of the Virion Structural Protein 3 Coding Sequence.. J. Virol.
80: 6553-6558
[Abstract]
[Full Text]
-
Cai, X., Cullen, B. R.
(2006). Transcriptional Origin of Kaposi's Sarcoma-Associated Herpesvirus MicroRNAs. J. Virol.
80: 2234-2242
[Abstract]
[Full Text]
-
Allen, R. D. III, Dickerson, S., Speck, S. H.
(2006). Identification of Spliced Gammaherpesvirus 68 LANA and v-Cyclin Transcripts and Analysis of Their Expression In Vivo during Latent Infection. J. Virol.
80: 2055-2062
[Abstract]
[Full Text]
-
Pearce, M., Matsumura, S., Wilson, A. C.
(2005). Transcripts Encoding K12, v-FLIP, v-Cyclin, and the MicroRNA Cluster of Kaposi's Sarcoma-Associated Herpesvirus Originate from a Common Promoter. J. Virol.
79: 14457-14464
[Abstract]
[Full Text]
-
Matsumura, S., Fujita, Y., Gomez, E., Tanese, N., Wilson, A. C.
(2005). Activation of the Kaposi's Sarcoma-Associated Herpesvirus Major Latency Locus by the Lytic Switch Protein RTA (ORF50). J. Virol.
79: 8493-8505
[Abstract]
[Full Text]
-
Coleman, H. M., Efstathiou, S., Stevenson, P. G.
(2005). Transcription of the murine gammaherpesvirus 68 ORF73 from promoters in the viral terminal repeats. J. Gen. Virol.
86: 561-574
[Abstract]
[Full Text]
-
Jang, G. M., Leong, L. E.-C., Hoang, L. T., Wang, P. H., Gutman, G. A., Semler, B. L.
(2004). Structurally Distinct Elements Mediate Internal Ribosome Entry within the 5'-Noncoding Region of a Voltage-gated Potassium Channel mRNA. J. Biol. Chem.
279: 47419-47430
[Abstract]
[Full Text]
-
Sakakibara, S., Ueda, K., Nishimura, K., Do, E., Ohsaki, E., Okuno, T., Yamanishi, K.
(2004). Accumulation of Heterochromatin Components on the Terminal Repeat Sequence of Kaposi's Sarcoma-Associated Herpesvirus Mediated by the Latency-Associated Nuclear Antigen. J. Virol.
78: 7299-7310
[Abstract]
[Full Text]
-
Bieleski, L., Hindley, C., Talbot, S. J.
(2004). A polypyrimidine tract facilitates the expression of Kaposi's sarcoma-associated herpesvirus vFLIP through an internal ribosome entry site. J. Gen. Virol.
85: 615-620
[Abstract]
[Full Text]
-
An, J., Sun, Y., Rettig, M. B.
(2004). Transcriptional coactivation of c-Jun by the KSHV-encoded LANA. Blood
103: 222-228
[Abstract]
[Full Text]
-
Coleman, H. M., Brierley, I., Stevenson, P. G.
(2003). An Internal Ribosome Entry Site Directs Translation of the Murine Gammaherpesvirus 68 MK3 Open Reading Frame. J. Virol.
77: 13093-13105
[Abstract]
[Full Text]
-
Vassilaki, N., Mavromara, P.
(2003). Two Alternative Translation Mechanisms Are Responsible for the Expression of the HCV ARFP/F/Core+1 Coding Open Reading Frame. J. Biol. Chem.
278: 40503-40513
[Abstract]
[Full Text]
-
Field, N., Low, W., Daniels, M., Howell, S., Daviet, L., Boshoff, C., Collins, M.
(2003). KSHV vFLIP binds to IKK-{gamma} to activate IKK. J. Cell Sci.
116: 3721-3728
[Abstract]
[Full Text]
-
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract]
[Full Text]
-
Beales, L. P., Holzenburg, A., Rowlands, D. J.
(2003). Viral Internal Ribosome Entry Site Structures Segregate into Two Distinct Morphologies. J. Virol.
77: 6574-6579
[Abstract]
[Full Text]
-
Sarnow, P.
(2003). Viral Internal Ribosome Entry Site Elements: Novel Ribosome-RNA Complexes and Roles in Viral Pathogenesis. J. Virol.
77: 2801-2806
[Full Text]
-
Tang, S., Zheng, Z.-M.
(2002). Kaposi's Sarcoma-associated Herpesvirus K8 Exon 3 Contains Three 5'-Splice Sites and Harbors a K8.1 Transcription Start Site. J. Biol. Chem.
277: 14547-14556
[Abstract]
[Full Text]
-
Krueger, A., Baumann, S., Krammer, P. H., Kirchhoff, S.
(2001). FLICE-Inhibitory Proteins: Regulators of Death Receptor-Mediated Apoptosis. Mol. Cell. Biol.
21: 8247-8254
[Full Text]
-
Schneider, R., Kozak, M.
(2001). New Ways of Initiating Translation in Eukaryotes?. Mol. Cell. Biol.
21: 8238-8246
[Full Text]
-
Hellen, C. U.T., Sarnow, P.
(2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev.
15: 1593-1612
[Full Text]