Previous Article | Next Article 
Journal of Virology, February 2001, p. 1761-1769, Vol. 75, No. 4
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.4.1761-1769.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Characterization of Herpes Simplex Viruses Selected
in Culture for Resistance to Penciclovir or Acyclovir
Robert T.
Sarisky,1,*
Matthew R.
Quail,1
Philip E.
Clark,1
Tammy T.
Nguyen,1
Wendy S.
Halsey,2
Robert J.
Wittrock,1
Joan O'Leary
Bartus,1
Marion M.
Van
Horn,2
Ganesh M.
Sathe,2
Stephanie
Van
Horn,2
Michael D.
Kelly,3
Teresa H.
Bacon,4 and
Jeffry J.
Leary1
Molecular Virology and Host
Defense,1 Genetic
Technologies,2 and
BioInformatics,3 SmithKline
Beecham Pharmaceuticals, Collegeville, Pennsylvania, and SmithKline
Beecham Consumer Healthcare, Weybridge, United
Kingdom4
Received 30 August 2000/Accepted 16 November 2000
 |
ABSTRACT |
Penciclovir (PCV), an antiherpesvirus agent in the same class as
acyclovir (ACV), is phosphorylated in herpes simplex virus (HSV)-infected cells by the viral thymidine kinase (TK). Resistance to
ACV has been mapped to mutations within either the TK or the DNA
polymerase gene. An identical activation pathway, the similarity in
mode of action, and the invariant cross-resistance of TK-negative mutants argue that the mechanisms of resistance to PCV and ACV are
likely to be analogous. A total of 48 HSV type 1 (HSV-1) and HSV-2
isolates were selected after passage in the presence of increasing
concentrations of PCV or ACV in MRC-5 cells. Phenotypic analysis
suggested these isolates were deficient in TK activity. Moreover,
sequencing of the TK genes from ACV-selected mutants identified two
homopolymeric G-C nucleotide stretches as putative hot spots, thereby
confirming previous reports examining Acvr clinical
isolates. Surprisingly, mutations identified in PCV-selected mutants
were generally not in these regions but distributed throughout the TK
gene and at similar frequencies of occurrence within A-T or G-C
nucleotides, regardless of virus type. Furthermore, HSV-1 isolates
selected in the presence of ACV commonly included frameshift mutations,
while PCV-selected HSV-1 mutants contained mostly nonconservative amino
acid changes. Data from this panel of laboratory isolates show that
Pcvr mutants share cross-resistance and only limited
sequence similarity with HSV mutants identified following ACV
selection. Subtle differences between PCV and ACV in the interaction
with viral TK or polymerase may account for the different spectra of
genotypes observed for the two sets of mutants.
 |
INTRODUCTION |
The introduction of
penciclovir [PCV;9-(4-hydroxy-3-hydroxymethylbut-1-yl)guanine] and
its prodrug, famciclovir, (FCV), resulted in the use of
antivirals alternative to acyclovir (ACV) for treatment of herpes
simplex virus (HSV) infections. Biochemical studies have indicated that
PCV, like ACV, is phosphorylated by the viral thymidine kinase (TK) to
a monophosphate and subsequently converted by cellular enzymes to a
triphosphate, which inhibits the HSV DNA polymerase (Pol)
(44). Although PCV and ACV have identical activation
pathways and similar modes of action (14, 44), and the
frequencies with which resistance in HSV arises to PCV and ACV in cell
culture are identical (36), the affinities and therefore
the fine molecular interactions of PCV, ACV, and their triphosphates
with TK and Pol differ (14). The last point raises the
possibility that drug-resistant mutants selected by these antiviral
agents may differ.
Resistance to acyclovir typically arises by a single mutation in either
the TK or Pol gene (11, 23, 29). The viral TK, unlike DNA
polymerase, is not essential for virus replication in cell culture
(13), although in vivo analyses implicate it in HSV
virulence, pathogenicity, and reactivation from latency (9, 15,
20, 41). Mutations in HSV TK are the most common causes of
clinical resistance to ACV (7, 34), and the majority of
mutants completely lack TK activity (TK
).
TK
variants are invariably cross resistant to PCV and ACV
because these antivirals share a dependence upon the viral TK for
phosphorylation (3, 4). Missense point mutations and
single-base deletions or insertions which shift the translational
reading frame of the protein generally confer this phenotype (11,
23, 29).
HSV isolates, whether from patients or cell culture, are heterogeneous
populations and thus contain preexisting drug-resistant TK variants
(six to eight mutants per 104 plaque-forming viruses)
(12, 31, 36). The infidelity of the HSV DNA replication
process is directly responsible for this naturally occurring variation
(17, 24, 25, 28), with errors in the viral DNA introduced
spontaneously during DNA replication and not requiring the presence of
drug. However, exposure to a nucleoside analog may provide selective
pressure leading to the enrichment of such preexisting drug-resistant
viruses. Since ACV-selected mutants derived in cell culture have been
partially predictive of those which have emerged from the clinic, an in
vitro examination of PCV-selected HSV should further understanding of
the selection process for clinically PCV-resistant HSV.
To address whether viruses selected for resistance to PCV and ACV are
similar, a series of HSV type 1 (HSV-1) and HSV-2 mutants from a single
virus preparation (either HSV-1 SC16 or HSV-2 SB5) were selected in
vitro with PCV or ACV in MRC-5 cells. Classically, ACV-resistant HSV
mutants have been selected by serial passage in the presence of
increasing concentrations of antiviral (11), and this
approach was used in the present study. A comparison of the phenotypes,
genotypes, and biochemical properties of mutants selected in vitro for
PCV or ACV resistance is presented in this report.
 |
MATERIALS AND METHODS |
Cell lines and virus strains.
Vero (American Type Culture
Collection [ATCC]), an African green monkey kidney cell line; MRC-5
(ATCC), a diploid human embryonic lung cell line; and 143 TK
(ATCC), a human osteosarcoma cell line, were grown in
Dulbecco's modified Eagle's medium (DMEM) supplemented with 10%
heat-inactivated fetal calf serum (FCS) and incubated at 37°C and 5%
CO2. HSV-1 SC16, SC16-S1, and DM21 were generously provided
by S. Safrin (Gilead Sciences, Foster City, Calif.). HSV-2 SB5 (ATCC
VR-2546) is a plaque-purified derivative of HSV-2 strain 333. D21 cells, a line derived from BUHK-TK cells which
constitutively expresses an HSV TK gene, were a kind gift from H. Field
(University of Cambridge, Cambridge, United Kingdom). These transformed
cells were maintained in DMEM with 10% FCS and HAT supplement
(hypoxanthine, aminopterin, and thymidine).
Compounds.
PCV (BRL 39123) was synthesized at SmithKline
Beecham Pharmaceuticals. ACV, vidarabine (Ara-A),
bromovinyl-deoxyuridine (BVDU), iodo-deoxyuridine (IdU), and foscarnet
(FOS) were obtained from Sigma Chemical Co. (St. Louis, Mo.). Cidofovir
(CDU; GS-504) was generously provided by J. Smith (Gilead Sciences).
For cell culture assays, 5- to 40-mg/ml stock solutions were prepared
in dimethyl sulfoxide or sterile water and stored at
20°C.
Selection of resistant isolates.
Confluent MRC-5 cell
monolayers (seeded with 7 × 105 cells/well) prepared
in six-well dishes were infected with 0.1 PFU of SC16 or SB5/cell in
0.5 ml of Hanks balanced salt solution for 1 h at 37°C. The
inoculum was then removed, and 2 ml of medium containing 1 µg of PCV
or ACV per ml was added per well. When a culture demonstrated complete
cytopathic effect, typically after 3 days, it was freeze-thawed three
times (pass 1). Next, 0.5 ml of the resulting virus pool was passaged
in the presence of a threefold-higher concentration of antiviral (pass
2). The pass 2 virus samples were then passaged in the presence of an
approximately threefold-higher concentration of antiviral (10 µg/ml)
to produce the final pass 3 samples. The pass 3 virus pools were
titrated, and single plaque isolates were purified by limiting dilution from each pool. Virus from a single plaque was amplified in Vero cells.
Following three rounds of plaque purification to ensure homogeneity,
virus stocks were prepared in Vero cells which were infected at 0.01 PFU/cell. The stocks were titrated in Vero cells, and 50% inhibitory
concentrations (IC50s) were determined by plaque reduction
assay (PRA) in MRC-5 cells as described below.
PRA.
PRAs were performed according to the method detailed
previously (36). Briefly, fourfold dilutions of ACV, PCV,
CDV, and IdU were tested, ranging from 0.09 to 100 µg/ml for known
resistant control strains (SC16-S1) or from 0.02 to 25 µg/ml for
wild-type sensitive strains (SC16 and SB5). For all viruses, four-fold
dilutions of FOS and Ara-A were tested, ranging from 1.56 to 400 µg/ml, and for BVDU, concentrations ranged either from 0.05 to 50.0 µg/ml (HSV-2) or from 0.01 to 10.0 µg/ml (HSV-1). The cultures were incubated for 48 h, fixed with 10% formaldehyde, and finally
stained with crystal violet (0.5% [wt/vol] in 70% methanol). The
plaques were counted, and IC50s were calculated by the
Kärber method (21). The criterion used to define an
HSV-1 SC16 or HSV-2 SB5 variant as resistant was an IC50
greater than 10-fold above that for the parental wild-type virus tested
in the same assay (36). The mean IC50s from
duplicate tests are presented in the tables, and the relative
resistances of an isolate in different tests remained similar.
Viral DNA isolation and subcloning.
Confluent Vero cell
monolayers (seeded with 106 cells/100-mm-diameter dish)
were infected with HSV mutants at 5 PFU/cell. Approximately 20 h
after infection, the cells were washed gently with phosphate-buffered saline and then treated with 4.0 ml of lysis buffer (1% sodium dodecyl
sulfate-1% Sarkosyl in 10 mM Tris [pH 8.0], 2 mM EDTA). The cells
were scraped into the lysis buffer, and 200 µl of RNaseA (10-mg/ml
stock) was added. After 1 h at 37°C, 200 µl of proteinase K
(2-mg/ml stock) was added, and the mixture was incubated for an
additional 2 h at 42°C. Two phenol-chloroform extractions were performed prior to DNA precipitation. The infected cell DNA (20 µg)
was digested with BamHI (SC16 derivatives) or
HindIII/EcoRI (SB5 derivatives) to allow
subcloning of a fragment of viral DNA containing the TK open reading
frame into a modified derivative of pSG5 (Stratagene). For some
samples, the TK gene was amplified by PCR using Pfu DNA
polymerase (Stratagene), and the coding region was directly sequenced
in both directions.
Sequencing.
HSV-1 SC16 and HSV-2 SB5 subclones containing a
3.6- or 3.5-kb fragment, respectively, were evaluated by PCR to verify
that they contained the TK open reading frame. Positive clones were subjected to terminator cycle sequencing using an automated model 377 DNA sequencer (Perkin-Elmer Applied Biosystems). The primers utilized
for HSV-1 SC16 derivatives were as follows: SBA9188, GGCATAAGGCATGCCCATTG; SBA9189, CAATCGCGAACATCTACACC;
and SBA9190, GCTTGACCTGGCTATGCTG. The primers utilized
for HSV-2 SB5 derivatives were as follows: SBB1165,
GCGGTGGTAATGACCAGCGC; SBB1166, CCAACACGGTGCGGTACCTG; SBB1167, CAGGGAGGCGATAGGGTGCC; SBB1168,
GTCATGCTTCCCATGAGGTACC. The overlap between sequencing runs
was evaluated to allow for the identification of mutations within the
primer sequence.
Antibodies and Western analysis.
Rabbit polyclonal antiserum
raised to a glutathione S-transferase-HSV TK fusion protein
was generously provided by S. Albelda (University of Pennsylvania,
Philadelphia). This antiserum cross-reacts with both HSV-1 and HSV-2
TKs. Confluent MRC-5 cell monolayers in 12-well plates were infected at
5 PFU/cell in 500 µl of Hanks balanced salt solution at 37°C and
5% CO2 for 1 h. Following adsorption, the inoculum
was removed and replaced with 1.0 ml of medium (DMEM plus 5% FCS).
Eight hours postinfection, the medium was removed, the cell monolayers
were rinsed with phosphate buffered saline, and the viral proteins were
harvested in sodium dodecyl sulfate-polyacrylamide gel electrophoresis
loading buffer. Equal volumes of protein were loaded in all wells and
membranes were treated according to the manufacturer's recommendations
(ECL; Amersham Life Science).
TK assay.
Viral TK activity was determined by a modification
of the method described by Coen et al. (9) performed as
reported previously (36).
Plaque autoradiography.
Plaque autoradiography was performed
according to the method described by Tenser et al. (42).
The radiolabeled cells were fixed with 10% formaldehyde, stained with
crystal violet, air dried, and placed in contact with X-ray film for 5 days at room temperature.
 |
RESULTS |
Selection of antiviral-resistant HSV.
Drug-resistant mutants
were randomly selected from a parental virus preparation of two
wild-type laboratory HSV strains, HSV-1 SC16 and HSV-2 SB5, by
three serial passages of the virus in MRC-5 cells treated with
escalating concentrations of PCV or ACV as outlined in Fig.
1. From the resulting 56 virus pools, a
total of 48 viruses were plaque purified three times: 13 SC16 and 11 SB5 mutants were selected in the presence of increasing concentrations of PCV, and 15 SC16 and 9 SB5 mutants were selected with increasing concentrations of ACV. The naming convention used for plaque isolates is based on their derivation, that is, virus type, drug selection, and
plaque number (e.g., 1P1 is an HSV-1 isolate selected for resistance to
PCV, plaque isolate number 1; 2A1 is an HSV-2 isolate selected
for resistance to ACV, plaque isolate number 1). In three instances, two plaques were purified from the same well, and these viruses are designated with the letters A and B (e.g., 1P3-A and 1P3-B
represent two plaque isolates of HSV-1 selected for resistance to PCV
from the same experimental well).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Flow diagram illustrating methodology for selecting
drug-resistant HSV-1. A stock of wild-type HSV-1 (containing
approximately 5,000 total mutants [36]) was used to
initiate 32 individual infections. The infection represents an input of
approximately 40 mutant viruses per experimental well or 1,280 total
variants within the 32 infections to select drug-resistant virus. The
same methodology was followed using a stock of wild-type HSV-2
(containing approximately 2.1 × 106 total mutants
[36]) to initiate 24 individual infections, which
represents an input of approximately 490 mutant viruses per
experimental well or 11,760 total variants within the 24 infections to
select drug-resistant virus. CPE, cytopathic effect. Eleven
PCV-selected and 9 ACV-selected HSV-2 isolates were plaque purified.
|
|
Antiviral susceptibility of drug-selected HSV-1 isolates.
The
susceptibilities of the 28 drug-selected HSV-1 isolates and the
parental HSV-1 strain (SC16) to PCV and ACV were determined by PRA in
MRC-5 cells (Tables 1 and
2). PCV, ACV, and BVDU all rely on viral TK expression
for initial phosphorylation, although BVDU diphosphorylation is also
directed by the viral TK (3, 16, 44). Generally,
TK
strains are resistant to these compounds yet remain
sensitive to FOS, Ara-A, and CDV, which inhibit HSV replication
independent of the viral TK. The susceptibilities of the drug-selected
HSV-1 isolates to non-TK-dependent antivirals were determined to
identify potential DNA polymerase mutants or TK-polymerase double
mutants.
A single HSV-1 isolate purified after passage in the presence of
increasing PCV remained sensitive to PCV by PRA (Table
1,
isolate
1P11), whereas resistance to PCV was confirmed for the
remaining 12 isolates. Furthermore, one HSV-1 isolate (Table
2,
isolate 1A10)
selected after passage with increasing concentrations
of ACV
remained susceptible to ACV, although the other 14 isolates
were ACV
resistant. The criterion set to classify an isolate as
resistant when
using PCV or ACV was an IC
50 for it greater than
10-fold
above that for the parental wild-type virus tested in
the same assay
(hence, a PCV IC
50 of

3.0 µg/ml or an ACV
IC
50 of

2.0 µg/ml). The IC
50s for the two
susceptible HSV-1 isolates
(1P11 [PCV IC
50 = 0.40 and
ACV IC
50 = 0.11 µg/ml] and 1A10 [PCV
IC
50 = 0.40 and ACV IC
50 = 0.20 µg/ml])
were well below this criterion,
whereas the IC
50s for
the authentic PCV- or ACV-resistant viruses
were greater than 8 µg of
PCV/ml or 17 µg of ACV/ml (Tables
1 and
2,
respectively).
All confirmed resistant HSV-1 isolates selected in the presence of
either PCV or ACV were cross resistant to both PCV and
ACV. Although
cross-resistance occurred regardless of the antiviral
used in the
selection process, 0.5- to 5-fold differences in susceptibility
were
evident. For example, the IC
50 of PCV against isolate 1P5
was fivefold higher than the IC
50 of ACV; nonetheless,
isolate
1P5 is clearly resistant to both agents (Table
1).
Additionally,
these isolates were examined for susceptibility to BVDU.
BVDU
is a potent and selective inhibitor of HSV-1, although wild-type
HSV-2 strains are markedly less susceptible to it (
16).
All
PCV- or ACV-selected isolates which demonstrated resistance to
those agents were also cross resistant to BVDU (all BVDU
IC
50s
for HSV-1 were >8.0 µg/ml).
No DNA polymerase mutants or TK-Pol double mutants were identified
among the panel of resistant HSV-1 isolates, since all
were susceptible
to the non-TK-dependent antivirals FOS, CDV,
and Ara-A by PRA (Tables
1
and
2). However, since screening
with these compounds alone is not
sufficient to guarantee the
identification of such mutants, a second
test was used. As described
below, D
21 cells, a cell line
expressing the HSV TK, were used
to facilitate the identification of
Pol
mutants.
Antiviral susceptibility of drug-selected HSV-2 isolates.
The
susceptibilities of the 20 drug-selected HSV-2 isolates as well as the
parental HSV-2 strain (SB5) to PCV and ACV were determined by PRA in
MRC-5 cells (Tables 3 and
4). Although two HSV-2 isolates
purified after three serial passages in the presence of increasing PCV
retained sensitivity (Table 3, isolates 2P3-A and 2P3-B), resistance to
PCV was confirmed for the remaining 10 isolates. Additionally, a single
HSV-2 isolate (Table 4, isolate 2A1) selected after three serial
passages in MRC-5 cells remained susceptible to ACV, although the other
eight isolates were confirmed to be ACV resistant. The
IC50s for the three drug-susceptible HSV-2 isolates, 2P3-A,
2P3-B, and 2A1, were well below the criterion used to define resistance
(10 times the IC50 for the parental wild-type virus, i.e.,
a PCV IC50 of
7.5 µg/ml or an ACV IC50 of
5.0 µg/ml). The IC50s for all other HSV-2 isolates were
greater than 45 (PCV) or 26 (ACV) µg/ml. Isolate 2A6 remained a
potential mixture of two virus populations (the wild-type and a mutant
virus, expressing a full-length and truncated TK protein, respectively) even after three rounds of plaque purification and was not further characterized (Fig. 2).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
Western blot analysis of TK protein products from HSV
plaque isolates. The full-length TK protein product is approximately 43 kDa. Individual blots of HSV plaque isolates (A to C) are shown. The
name of the plaque isolate (described in Materials and Methods) is
indicated at the top of each lane. WT-1, wild-type HSV-1 SC16; WT-2,
wild-type HSV-2 SB5; Mock, mock infected.
|
|
All drug-resistant HSV-2 viruses selected with either PCV or ACV were
also cross resistant to both agents. Although cross-resistance
occurred
regardless of the antiviral used in the selection process,
differences
among the IC
50s were less marked (two- to threefold)
than
those among the IC
50s for HSV-1 isolates. The panel of
HSV-2
isolates selected for resistance to ACV (Table
4) were cross
resistant to PCV without marked differences among the IC
50s
(all
were >100 µg of PCV or ACV/ml). Resistance to BVDU was
apparent,
although less clearly defined than with the HSV-1 isolates,
and
was consistent with previous observations (
16).
Furthermore,
screening the panel of HSV-2 isolates against DNA
polymerase inhibitors
in a PRA resulted in the identification of an HSV
mutant which
may contain a DNA polymerase mutation. HSV-2 isolate 2P10
was
resistant to FOS, with an IC
50 greater than 400 µg/ml
(Table
3),
suggesting this isolate may be a double mutant in both the
TK
and DNA polymerase genes. Notably, this virus retained
susceptibility
to the other DNA polymerase inhibitors, Ara-A and
CDV.
Biochemical characterization of drug-selected HSV isolates.
The panel of resistant HSV-1 SC16 and HSV-2 SB5 progeny was examined by
Western blotting for viral TK gene expression. Total cell lysates
following HSV infection were probed with antiserum specific for the
viral TK polypeptide (Fig. 2A through C). SC16 and SB5, the wild-type
parental viruses, produced a full-length 43-kDa protein which reacted
with TK antiserum. Plaque isolates containing frameshift mutations
would be expected to express truncated TK or extended products,
although PCV and ACV resistance do not demand the synthesis of such TK proteins.
The majority of PCV-selected drug-resistant HSV-1 isolates (9 of 12)
generated full-length TK polypeptides (Fig.
2). However,
the
ACV-selected HSV-1 SC16 isolates in this assay generally expressed
a
truncated TK polypeptide (13 to 14). Conversely, among the HSV-2
SB5
isolates, PCV selection and ACV selection both resulted in
a more even
distribution of isolates expressing either full-length
or truncated TK
gene products. The exception was HSV-2 isolate
2P1, which did not
express a detectable TK product with the polyclonal
TK antiserum (Fig.
2B), although a comparable amount of the viral
DNA polymerase protein
relative to the wild-type parental control
virus was evident (data not
shown). The variation in the amount
of TK product detected among
samples (for example, Fig.
2B, isolates
2P6, 2P7, and 1A14) cannot be
attributed to differences in TK
expression. Parallel blots using
antiserum against the viral DNA
Pol illustrated similar differences
across isolates, suggesting
that the apparent variation in TK protein
between isolates is
the result of differences in total protein loaded
or a variation
in infection (data not
shown).
Since most Acv
r mutants characterized to date are
TK

the TK activities of the PCV- and ACV-selected
isolates were evaluated.
Mock-infected TK

human
osteosarcoma 143 cells or extracts of cells infected with
the known
TK

deletion mutant, HSV-1 DM21 (
15), were
below the limit of detection
of the TK assay (<0.3% TK activity).
Extracts of cells infected
with the parental wild-type HSV-1 SC16 or
HSV-2 SB5 exhibited
high TK activity, defined as 100%. All
drug-resistant HSV plaque
isolates produced little or no TK enzymatic
activity in this assay,
with values ranging from <0.3 to 7%. Isolate
HSV-1 SC16S1 (
10),
an Acv
r Pcv
r
strain of SC16 which expresses an altered TK, produced 13 to
20% TK
activity in this assay. Hence, all plaque isolates examined
in this
report are most likely TK

, consistent with the majority
of Acv
r viruses reported to date. However, the important
distinction
between TK

and TK-partial remains difficult
to distinguish from in vitro
TK assays
alone.
Lastly, the TK polypeptide expressed from mutant 2P10 was truncated
(~28 kDa) relative to the full-length product. This
multi-drug-resistant
virus therefore most likely accumulated
independent genetic lesions
within both the TK coding sequence and the
DNA polymerase coding
sequence to confer resistance to both FOS and the
TK-dependent
antiviral
agents.
Plaque autoradiography of drug-selected HSV
isolates.
Vero cell monolayers infected with the panel of
HSV isolates were exposed to [125I]iododeoxycytidine in
order to evaluate the phosphorylation of this substrate and its
subsequent incorporation into viral DNA. Autoradiographs of wild-type
virus (SC16 and SB5) yielded a black-rimmed plaque due to strong
incorporation of radiolabel into the replicating HSV DNA, whereas the
entire panel of drug-resistant viruses failed to incorporate the
substrate. Furthermore, all isolates were also severely impaired
relative to the parental virus in the ability to phosphorylate IdU, as
judged by the antiviral activity of IdU in a further PRA (data not
shown), since all IdU IC50s were greater than 30.0 µg/ml
(IdU IC50s for HSV-1 SC16 and HSV-2 SB5 were 1.9 and 3.4 µg/ml, respectively). These results further support the notion that
all of the mutants studied are TK
.
DNA sequence analysis of drug-selected HSV isolates.
The HSV
TK coding region is 1,128 nucleotides in length and encodes a protein
of 376 amino acids. The proposed ATP and nucleoside binding sites are
defined by amino acids 49 to 66 and 162 to 178, respectively
(22). The TK genes of the panel of antiviral-resistant HSV
isolates were sequenced, and comparisons of the nucleotide and amino
acid changes, as well as the predicted polypeptide sizes, are shown in
Tables 5 through
8.
The sequencing data are in complete agreement with results from Western
analysis.
Most HSV-1 isolates selected with ACV contained frameshift mutations,
thereby altering the coding sequence and termination
site of the TK
product. The majority of PCV-selected HSV-1 isolates
contained single
or double point mutations, resulting in an amino
acid change (Table
5).
Although TK sequence differences were
mostly unique to individual
isolates, for viruses selected with
PCV, two changes appeared more than
once (nucleotide 559, G to
A; nucleotide 860, C to T). Additionally, a
large number of mutations
were apparent more than once for HSV-1
isolates selected with
ACV (nucleotide 13, C to G; nucleotide 16, G to
T; nucleotide
437, plus G; nucleotide 860, C to T). Two identical
changes were
observed in both PCV- and ACV-selected isolates:
nucleotide 16,
G to T, and nucleotide 860, C to
T.
For PCV-selected HSV-2 isolates, the transition at nucleotide 863 (C to
T) was present in three isolates, and the change from
G to A at
nucleotide 116 was present in two isolates. The ACV-selected
HSV-2
isolates often (four out of seven) contained a frameshift
mutation at
nucleotide 556 (plus C), and a single isolate was
also observed to
contain the change at nucleotide 863 (C to
T).
Alignment of the mutations in the TK coding sequence for HSV-1 and
HSV-2 isolates illustrates that genetic lesions found in
ACV-selected
isolates generally accumulate in two distinct homopolymeric
nucleotide
stretches within the TK gene (Fig.
3, G
7 and C
6
stretches).
Surprisingly, mutations identified among isolates selected
with
PCV were generally not in these homopolymeric regions. Mutations
within PCV-selected isolates encoding nonfunctional TK
proteins
were randomly distributed throughout the TK gene and generally
equally associated with A-T nucleotides or G-C nucleotides (15
mutations at A-T nucleotides out of 37 total [A-T and G-C] changes),
whereas ACV-selected isolates contained 7 mutations at A-T nucleotides
out of 46 total changes. Lastly, although PCV-selected mutations
are
not concentrated in the homopolymeric Acv
r hot spots,
PCV-selected variants across virus types may be preferentially
located
within the predicted alpha-helical region immediately
upstream of the
ATP-nucleoside binding site (Fig.
3).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of mutations within TK coding sequence. The
schematic representations depict the HSV-1 (A) and HSV-2 (B) TK
polypeptides and three conserved domains, the nucleotide binding
pocket, the thymidine binding site, and the ATP binding site. The
homopolymeric hot-spot regions are indicated (G7 and
C6). Below the cartoon, the locations of base changes for
Pcvr (triangles) or Acvr (diamonds) HSV-1 or
HSV-2 are indicated. Each row represents a unique HSV drug-resistant
clone.
|
|
The HSV-2 mutant 2P10 carries a single-nucleotide deletion within the
TK gene, which results in expression of a truncated
TK polypeptide.
This incomplete TK gene product most likely is
responsible for
conferring resistance to PCV and ACV, although
a mutation within the TK
coding region is not likely to account
for FOS resistance. To address
this, the sequence of the 2P10
Pol coding region will need to be
determined and recombinant viruses
will have to be generated to assess
whether the change(s) compared
to wild-type HSV-2 SB5 further
contributes to PCV-ACV and/or FOS
resistance. However, a PRA in cells
constitutively expressing
the HSV TK polypeptide can provide an
immediate indication as
to whether the Pol contains a mutation(s) that
directly impacts
TK-dependent nucleoside analog
resistance.
Antiviral susceptibility of PCV-selected HSV isolates in
TK-transformed cells.
The entire panel of HSV mutants described
here has been tested in D21 cells, which constitutively
express the HSV TK product, for susceptibility to PCV. All PCV
IC50s, excluding that for HSV mutant 2P10, were below 0.11 µg/ml, inconsistent with the isolates having DNA polymerase mutations
which confer PCV resistance and consistent with rescue of their
TK
phenotype. Although the PCV IC50 for HSV-2
2P10 in D21 cells was only 0.5 µg/ml (compared to a PCV
IC50 of 60.7 µg/ml in MRC-5 cells), the PCV
IC50 remained significantly higher than the values attained
for the parental HSV-2 SB5 and the remaining HSV-2 mutant isolates. It
remains to be determined whether a single or multiple nucleotide
changes were responsible for the Fosr phenotype of 2P10.
 |
DISCUSSION |
Studies of drug resistance in laboratory herpesviruses have
furthered understanding of antiviral mechanisms, viral enzyme structure-function, and clinical drug resistance (8, 26). This report represents the largest laboratory collection of PCV- and
ACV-resistant HSV characterized to date, a total of 48 isolates. Resistance to ACV has been previously mapped to mutations within the TK
and DNA polymerase genes for both clinical and laboratory HSV isolates
(11, 23, 29). The mechanisms of HSV resistance to PCV and
ACV are expected to be analogous, given the similarity between the two
agents (4, 44), and indeed, all of the 48 plaque isolates
described here are deficient in TK activity.
Darby et al. (11) and Nugier et al. (29)
noted that mutations in the nucleoside binding site (amino acids 161 to
192) are frequently observed in response to selective pressure of ACV, and nine mutations in this study were found in that region. Other mutations identified within our drug-selected mutants were clustered near the nucleotide binding site (amino acids 50 to 63), as well as
upstream of the C-terminal ATP-nucleoside binding region (Fig. 3). The
highly conserved (2) glutamic acid at residue 226, which
the TK crystal structure implicates in the formation of the nucleoside
binding pocket (5), was found to be mutated in plaque
isolate 2P6. It is unclear whether the change at residue 226 or the
additional frameshift at residue 290 was initially responsible for the
resistance phenotype of 2P6. The majority of mutants examined in this
study contained more than one lesion within the TK gene, with few
instances of identical mutations shared between independent isolates.
Examples are isolates 1A4, 1A5, and 1A13 (selected by ACV), which all
contained a frameshift at amino acid 146 and other, nonidentical
changes adjacent to the nucleoside binding site. Given that these
plaque isolates were selected by sequential passage in the presence of
ACV, the exact mutation initially relevant to the establishment of the TK
phenotype cannot be identified with certainty.
HSV isolates selected in the presence of ACV (19 of 21) and HSV-2
isolates selected for PCV resistance (8 of 9) commonly included frameshift mutations which disrupted both the thymidine and ATP binding
pockets of TK. However, the PCV-selected HSV-1 mutants contained mostly
nonconservative amino acid changes (7 of 12) rather than frameshifts.
Sequences from the panel of ACV-resistant viruses identified two
homopolymeric nucleotide stretches (G7 and C6)
as putative hot spots within the HSV TK gene, confirming previous
reports on Acvr isolates (18, 38). Although we
identified HSV-1 and HSV-2 mutations in both G7 and
C6, the in vitro-selected HSV-1 isolates generally
contained mutations within the G7 string, whereas
alterations within the downstream C6 tract were typically
associated with HSV-2. This virus type-specific distribution may be
attributed to chance, although type-specific or strain-specific
responses to selective pressure cannot be ruled out. It unclear whether any type-specific differences are related to the higher incidence of
spontaneous mutations in HSV-2 than in HSV-1 (36).
Surprisingly, resistance mutations in the TK coding sequence after
selection with PCV were generally not in the G7 or
C6 hot spots associated with ACV resistance. Those PCV
mutations which did occur at a G or C nucleotide were generally at
single G or C bases evenly distributed throughout the TK gene.
Moreover, while ACV mutations were primarily within G or C nucleotides,
PCV mutations were present equally at A-T and G-C nucleotides.
The G7 and C6 elements represent the two
longest homopolymer stretches within the TK coding region of HSV and
directly flank the thymidine-TMP binding site. Regions containing
homopolymeric nucleotides in other genomes, such as T4 bacteriophage,
polyomavirus, and the mouse immunoglobulin heavy chain locus, have also
been shown to be especially susceptibile to mutations, and the
frequency of mutation may be proportional to the number of reiterated
nucleotides (30, 39, 45). The mechanism which gives rise
to the hot-spot nature of these nucleotide stretches most likely
involves a localized mispairing within the homopolymer
(39). Additionally, polymerases may preferentially slip or
stutter within such mispaired regions, contributing further errors. The
exact location of a homopolymeric element is also known to have an
impact on the recombination, deletion, or mutation frequency within a
given region of DNA (37). Since we observed clustering of
base changes within the C6 block as opposed to the
G7 string for ACV-selected HSV-2, local topology may also
influence the selection or mutation process involved in resistance to
PCV and ACV.
While a recent analysis of the Acvr Kawaguchi strain of
varicella-zoster virus (VZV) revealed TK-deficient variants similar to
the classical Acvr HSV mutants, with deletions which result
in frameshifts and premature termination (19), the VZV TK
gene lacks a G7 element, and the location of the single
C6 tract is not conserved relative to its HSV-1 and HSV-2
homologs. Most ACV-resistant VZV mutants reportedly lack frameshift
mutations and are more likely to express full-length TK than
Acvr HSV mutants (40). Furthermore,
Acvr VZV mutations are located throughout the coding region
of TK and are not highly localized to G-C-rich regions, such as the C6 string. Thus, the locations of Acvr VZV
mutations are generally similar to those we identified for Pcvr HSV-1 (40) and support the concept that
the context and relative proximity of identical homopolymeric regions
can influence whether they are mutational hot spots.
It was anticipated that many of the mutants resulting from selection
with PCV or ACV would carry identical mutations in TK, since all
isolates were selected in parallel, presumably from preexisting mutants
contained in the wild-type parental mixture. In fact, statistical
analyses of the differences in the distribution of mutations between
the PCV- and ACV-selected plaque isolates suggest that significant
drug-related differences exist (P = 0.028 for HSV-1 and
P = 0.082 for HSV-2). An alternative hypothesis to
drug-specific selection of different preexisting mutants is that PCV
and ACV or their triphosphates, rather than preferentially selecting a
subset of preexisting mutants, may play a more active role in the
introduction of specific errors into the HSV genome during replication.
Although unlikely, given their proven safety profiles in normal cells,
it is possible that in HSV-infected cells specific HSV polymerase
replication errors might be enhanced.
Sasadeusz et al. proposed that ACV triphosphate (ACV-TP) may be capable
of modifying the enzymatic or proofreading properties of the HSV DNA
Pol to enhance polymerase stuttering in G-C-rich regions
(38). However, it is difficult to rationalize how ACV-TP, an obligate chain terminator, could influence the viral DNA Pol without
being incorporated and terminating the newly synthesized DNA chain.
Nevertheless, the possibility remains open that ACV-TP, which unlike
PCV-TP lacks a 3' hydroxyl group, could promote an enhanced local
misalignment within homopolymer stretches and thereby provide multiple
sites for misaligned, although complementary, base pairing. While the
Ki of PCV-TP with the Pol is significantly higher than that of ACV-TP (PCV Ki, 8.5 µM;
ACV Ki, 0.07 µM), PCV-TP is actually a more
efficient and complete chain terminator under physiological conditions
(with competing natural nucleotides present) than is ACV-TP (14,
35). The more complete chain termination activity of PCV-TP, the
weaker interaction with the Pol compared to ACV-TP, and the lack of
hot-spot mutations in PCV-selected HSV-1 are all consistent with such a mechanism.
The observation that TK mutations in PCV-selected mutants were very
often different from those in ACV-selected mutants suggests that subtle
differences in the mechanisms of action of these two antiviral agents
may be pivotal in the genotypes of mutants that arise under PCV or ACV
pressure. Interestingly, antiviral studies of the nucleoside analogs
lamivudine (3TC) and PCV, two potent inhibitors of hepatitis B virus,
(HBV), also suggest that both the fine molecular interaction of these
inhibitors with viral polymerases and their base-pairing interactions
may directly influence the type of drug-resistant variants selected. A
substantial difference in the Ki for inhibition
of recombinant HBV polymerase by PCV-TP and 3TC-TP is apparent (4.8 and
0.25 µM, respectively), similar to the differences in the PCV-TP and
ACV-TP affinities for inhibition of the HSV polymerase (46,
47). Although mutations within the catalytic site of the HBV
reverse transcriptase have been found to occur following treatment of
chronic HBV infection with either 3TC or FCV, variants containing a
point mutation in the YMDD motif are most readily found after 3TC
treatment (27, 43). Other mutations within the catalytic
domain, aside from the YMDD motif, were identified following FCV
treatment (1). Certainly, the identification of a
Pcvr HBV mutant which retains sensitivity to 3TC reinforces
the idea that the interaction of each of these nucleoside analogs with the polymerase is unique (33). Hence, distinct structural
differences between PCV and 3TC, leading to differences in the kinetic
interaction of these agents with the polymerase, may directly influence
the selection or generation of particular mutants. Previous reports indicate that there are Acvr TK and DNA Pol mutants which
remain sensitive to PCV. Such variants reinforce the biochemical data
indicating that the interactions between TK and PCV or ACV, and
likewise between the HSV polymerase and the triphosphates of PCV or
ACV, are distinct and may have biological consequences (3, 6,
32).
In summary, we have confirmed earlier reports that HSV TK mutations
selected by ACV preferentially occur at the homopolymeric G7 and C6 stretches, or hot spots. Conversely,
HSV TK mutations selected by PCV generally were more uniformly
distributed throughout the TK gene. Although the differential
distribution of mutant sequences selected by PCV and ACV could result
from chance, our data suggest that there are subtle, yet distinct,
selection or mutation differences for PCV and ACV. A formal possibility
remains that the observed selection differential could be influenced by strain differences. Further experiments using virus strains other than
HSV-1 SC16 and HSV-2 SB5 could help address these issues. Nevertheless,
the overall phenotypic effect of both ACV- and PCV-selected mutations
was the loss of TK activity.
It remains to be seen whether the genotypic changes identified for HSV
mutants selected in cell culture with PCV will also be characteristic
of resistant isolates from patients treated with PCV or the oral
prodrug FCV. An examination of several clinical isolates resistant to
PCV during or after treatment with FCV or PCV will be required to
verify that the genotypes selected in vitro are characteristic of
resistance selection in treated populations.
 |
ACKNOWLEDGMENTS |
We thank S. Albelda, A. Awan, H. Field, J. Smith, S. Safrin, and
P. Shaffer for generous gifts of reagents; A. Hager for technical assistance with plaque purification; J. Mao for primer synthesis; B. Gagnon for statistical analyses; R. Boon for support from SmithKline Beecham Consumer Healthcare; and S. Dillon, F. Del Vecchio, D. Earnshaw, and K. Esser for scientific advice and critical review of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Virology and Host Defense, SmithKline Beecham
Pharmaceuticals, 1250 South Collegeville Rd., UP1450, Collegeville, PA
19426-0989. Phone: (610) 917-6724. Fax: (610) 917-4170. E-mail:
robert_t_sarisky{at}sbphrd.com.
 |
REFERENCES |
| 1.
|
Aye, T. T.,
M. M. Bartholomew,
T. Shaw,
D. S. Bowden,
A. M. Breschkin,
J. S. McMillan, and P. Angus.
1997.
Hepatitis B virus polymerase mutations during antiviral therapy in a patient following liver transplantation.
Hepatology
26:1148-1153[CrossRef].
|
| 2.
|
Balasubramaniam, N. K.,
V. Veerisetty, and G. A. Gentry.
1991.
Herpesviral deoxythymidine kinases contain a site analogous to the phosphoryl-binding arginine-rich region of porcine adenylate kinase; comparison of secondary structure predictions and conservation.
J. Gen. Virol.
71:2979-2987[Abstract/Free Full Text].
|
| 3.
|
Boyd, M. R.,
T. H. Bacon,
D. Sutton, and M. Cole.
1987.
Antiherpesvirus activity of 9-(4-hydroxy-3-hydroxymethylbut-1-yl) guanine (BRL 39123) in cell culture.
Antimicrob. Agents Chemother.
31:1238-1242[Abstract/Free Full Text].
|
| 4.
|
Boyd, M. R.,
S. Safrin, and E. R. Kern.
1993.
Penciclovir a review of its spectrum of activity, selectivity, and cross-resistance pattern.
Antivir. Chem. Chemother.
4:3-11.
|
| 5.
|
Brown, D. G.,
R. Visse,
G. Sandhu,
A. Davies,
P. J. Rizkallah,
C. Melitz,
W. C. Summers, and M. R. Sanderson.
1995.
Crystal structure of the thymidine kinase from herpes simplex virus type 1 in complex with deoxythymidine and ganciclovir.
Nat. Struct. Biol.
2:876-881[CrossRef][Medline].
|
| 6.
|
Chiou, H. C.,
K. Kumura,
A. Hu,
K. M. Kerns, and D. M. Coen.
1995.
Penciclovir-resistance mutations in the herpes simplex virus DNA polymerase gene.
Antivir. Chem. Chemother.
6:281-288.
|
| 7.
|
Christophers, J.,
J. Clayton,
J. Craske,
R. Ward,
P. Collins,
M. Trowbridge, and G. Darby.
1998.
Survey of resistance of herpes simplex virus to acyclovir in northwest England.
Antimicrob. Agents Chemother.
42:868-872[Abstract/Free Full Text].
|
| 8.
|
Coen, D. M.
1991.
The implications of resistance to antiviral agents for herpesvirus drug targets and drug therapy.
Antivir. Res.
15:287-300[CrossRef][Medline].
|
| 9.
|
Coen, D. M.,
M. Kosz-Vnenchak,
J. G. Jacobson,
D. A. Leib,
C. L. Bogard,
P. A. Schaffer,
K. L. Tyler, and D. M. Knipe.
1989.
Thymidine kinase-negative herpes simplex virus mutants establish latency in mouse trigeminal ganglia but do not reactivate.
Proc. Natl. Acad. Sci. USA
86:4736-4740[Abstract/Free Full Text].
|
| 10.
|
Darby, G., and H. J. Field.
1981.
Altered substrate specificity of herpes simplex virus thymidine kinase confers acyclovir resistance.
Nature
289:81-83[CrossRef][Medline].
|
| 11.
|
Darby, G.,
G. Lawrence, and M. M. Inglis.
1986.
Evidence that the `active centre' of the herpes simplex virus thymidine kinase involves an interaction between three distinct regions of the polypeptide.
J. Gen. Virol.
67:753-758[Abstract/Free Full Text].
|
| 12.
|
Dasgupta, U. B., and W. C. Summers.
1978.
Ultraviolet reactivation of herpes simplex virus is mutagenic and inducible in mammalian cells.
Proc. Natl. Acad. Sci. USA
75:2378-2381[Abstract/Free Full Text].
|
| 13.
|
Dubbs, D. R., and S. Kit.
1964.
Mutant strains of herpes simplex deficient in thymidine kinase-inducing activity.
Virology
22:493-502.
|
| 14.
|
Earnshaw, D. L.,
T. H. Bacon,
S. J. Darlison,
K. Edmonds,
R. M. Perkins, and H. R. Vere.
1992.
Mode of antiviral action of penciclovir in MRC-5 cells infected with herpes simplex virus type 1 (HSV-1), HSV-2, and varicella-zoster virus.
Antimicrob. Agents Chemother.
36:2747-2757[Abstract/Free Full Text].
|
| 15.
|
Efstathiou, S.,
S. Kemp,
G. Darby, and A. C. Minson.
1989.
The role of herpes simplex virus type 1 thymidine kinase in pathogenesis.
J. Gen. Virol.
70:869-879[Abstract/Free Full Text].
|
| 16.
|
Fyfe, J. A.
1982.
Differential phosphorylation of (E)-5-(2-bromovinyl)-2'-deoxyuridine monophosphate by thymidylate kinases from herpes simplex viruses types 1 and 2 and varicella zoster virus.
Mol. Pharmacol.
21:432-437[Abstract].
|
| 17.
|
Hall, J. D., and R. E. Almy.
1982.
Evidence for control of herpes simplex virus mutagenesis by the viral DNA polymerase.
Virology
116:535-543[CrossRef][Medline].
|
| 18.
|
Hwang, C. C., and H. H. Chen.
1995.
An altered spectrum of herpes simplex virus mutations mediated by an antimutator DNA polymerase.
Gene
152:191-193[CrossRef][Medline].
|
| 19.
|
Ida, M.,
S. Kageyama,
H. Sato,
T. Kamiyama,
J. Yamamura,
M. Kurokawa,
M. Morohashi, and K. Shiraki.
1999.
Emergence of resistance to acyclovir and penciclovir in varicella-zoster virus and genetic analysis of acyclovir-resistant variants.
Antivir. Res.
40:155-166[CrossRef][Medline].
|
| 20.
|
Jacobson, J. G.,
K. L. Ruffner,
M. Kosz-Vnenchak,
C. B. C. Hwang,
D. M. Knipe, and D. M. Coen.
1993.
Herpes simplex virus thymidine kinase and specific stages of latency in murine trigeminal ganglia.
J. Virol.
67:6903-6908[Abstract/Free Full Text].
|
| 21.
|
Karber, G.
1931.
Bertrag zur kollektiven behandlung pharmakologischer reihenversuche.
Arch. Exp. Pathol. Pharmakol.
162:480-483[CrossRef].
|
| 22.
|
Kit, S.
1985.
Thymidine kinase.
Microb. Sci.
2:369-375.
|
| 23.
|
Kit, S.,
M. Sheppard,
H. Ichimura,
S. Nusinoff-Lehrman,
N. M. Ellis,
J. A. Fyfe, and H. Otsuka.
1987.
Nucleotide sequence changes in the thymidine kinase gene of herpes simplex virus type 2 clones from a patient treated with acyclovir.
Antimicrob. Agents Chemother.
31:1483-1490[Abstract/Free Full Text].
|
| 24.
|
Knopf, C. W.
1979.
Properties of herpes simplex virus DNA polymerase and characterization of its associated exonuclease activity.
Eur. J. Biochem.
98:231-244[Medline].
|
| 25.
|
Knopf, C. W., and K. Weisshart.
1990.
Comparison of exonucleolytic activities of herpes simplex virus type-1 DNA polymerase and DNase.
Eur. J. Biochem.
191:263-273[Medline].
|
| 26.
|
Larder, B. A., and G. Darby.
1984.
Virus drug resistance: mechanisms and consequences.
Antivir. Res.
4:1-42[CrossRef][Medline].
|
| 27.
|
Ling, R. D.,
D. Mutimer,
M. Ahmed,
E. H. Boxall,
E. Elias,
G. M. Dusheiko, and T. J. Harrison.
1996.
Selection of mutations in the hepatitis B virus polymerase during therapy of transplanted recipients with lamivudine.
Hepatology
24:711-713[CrossRef][Medline].
|
| 28.
|
Marcy, A. I.,
P. D. Olivo,
M. D. Challberg, and D. M. Coen.
1990.
Enzymatic activities of overexpressed herpes simplex virus DNA polymerase purified from recombinant baculovirus-infected insect cells.
Nucleic Acids Res.
18:1207-1215[Abstract/Free Full Text].
|
| 29.
|
Nugier, F.,
P. Collins,
B. A. Larder,
M. Langlois,
M. Aymard, and G. Darby.
1991.
Herpes simplex virus isolates from an immunocompromised patient who failed to respond to acyclovir treatment express thymidine kinase with altered substrate specificity.
Antivir. Chem. Chemother.
2:295-302.
|
| 30.
|
Okada, Y.,
G. Streisinger,
J. Owen,
J. Newton,
A. Tsugita, and M. Inouye.
1972.
Molecular basis of a mutational hot spot in the lysozyme gene of bacteriophage T4.
Nature
236:338-341[CrossRef][Medline].
|
| 31.
|
Parris, D. S., and J. E. Harrington.
1982.
Herpes simplex virus variants resistant to high concentrations of acyclovir exist in clinical isolates.
Antimicrob. Agents Chemother.
22:71-77[Abstract/Free Full Text].
|
| 32.
|
Pelosi, E.,
G. B. Mulamba, and D. M. Coen.
1998.
Penciclovir and pathogenesis phenotypes of drug-resistant herpes simplex virus mutants.
Antivir. Res.
37:17-28[CrossRef][Medline].
|
| 33.
|
Pichoud, C.,
B. Seigneres,
Z. Wang,
C. Trepo, and F. Zoulin.
1999.
Transient selection of a hepatitis B virus polymerase gene mutant associated with a decreased replication capacity and famciclovir resistance.
Hepatology
29:230-237[CrossRef][Medline].
|
| 34.
|
Pottage, J. C., and H. A. Kessler.
1995.
Herpes simplex virus resistance to acyclovir: clinical relevance.
Infect. Agents Dis.
4:115-124[Medline].
|
| 35.
|
Reardon, J. E., and T. Spector.
1989.
Herpes simplex virus type 1 DNA polymerase. Mechanism of inhibition by acyclovir triphosphate.
J. Biol. Chem.
264:7405-7411[Abstract/Free Full Text].
|
| 36.
|
Sarisky, R. T.,
T. T. Nguyen,
K. E. Duffy,
R. J. Wittrock, and J. J. Leary.
2000.
Difference in incidence of spontaneous mutations distinct between herpes simplex virus types 1 and 2.
Antivir. Agents Chemother.
44:1524-1529.
|
| 37.
|
Sarisky, R. T., and P. C. Weber.
1994.
Role of anisomorphic DNA conformations in the negative regulation of a herpes simplex virus type 1 promoter.
Virology
204:569-579[CrossRef][Medline].
|
| 38.
|
Sasadeusz, J. J.,
F. Tufaro,
S. Safrin,
K. Schubert,
M. M. Hubinette,
P. K. Cheung, and S. L. Sacks.
1997.
Homopolymer mutational hot spots mediate herpes simplex virus resistance to acyclovir.
J. Virol.
71:3872-3878[Abstract].
|
| 39.
|
Streisinger, G., and J. Owen.
1985.
Mechanism of spontaneous and induced frameshift mutation in bacteriophage T4.
Genetics
109:633-659[Abstract/Free Full Text].
|
| 40.
|
Talarico, C. L.,
W. C. Phelps, and K. K. Biron.
1993.
Analysis of the thymidine kinase genes from acyclovir-resistant mutants of varicella-zoster virus isolated from patients with AIDS.
J. Virol.
67:1024-1033[Abstract/Free Full Text].
|
| 41.
|
Tenser, R. B., and W. A. Edris.
1987.
Trigeminal ganglion infection by thymidine kinase-negative mutants of herpes simplex virus after in vivo complementation.
J. Virol.
61:2171-2174[Abstract/Free Full Text].
|
| 42.
|
Tenser, R. B.,
C. J. Jones,
S. J. Ressel, and F. A. Fralish.
1983.
Thymidine plaque autoradiography of thymidine kinase-positive and thymidine kinase-negative herpesviruses.
J. Clin. Microbiol.
17:122[Abstract/Free Full Text].
|
| 43.
|
Tipples, G. A.,
M. M. Ma,
K. P. Fischer,
V. G. Bain,
N. M. Kneteman, and D. L. J. Tyrrell.
1996.
Mutation in the HBV RNA-dependent DNA polymerase confers resistance to lamivudine in vivo.
Hepatology
24:714-717[Medline].
|
| 44.
|
Vere Hodge, R. A., and Y. C. Cheng.
1993.
The mode of action of penciclovir.
Antivir. Chem. Chemother.
4:13-24.
|
| 45.
|
Wilson, J. B.,
A. Hayday,
S. Courtneidge, and M. Fried.
1986.
A frameshift at a mutational hot spot in the polyoma virus early region generates two new proteins that define T-antigen functional domains.
Cell
44:477-487[CrossRef][Medline].
|
| 46.
|
Xiong, X.,
C. Y. H. Flores,
J. J. Toole, and C. S. Gibbs.
1998.
Mutations in hepatitis B DNA polymerase associated with resistance to lamivudine do not confer resistance to adefovir in vitro.
Hepatology
28:1669-1673[CrossRef][Medline].
|
| 47.
|
Xiong, X.,
H. Yang,
C. E. Westland,
R. Zou, and C. S. Gibbs.
2000.
In vitro evaluation of hepatitis B virus polymerase mutations associated with famciclovir resistance.
Hepatology
31:219-224[CrossRef][Medline].
|
Journal of Virology, February 2001, p. 1761-1769, Vol. 75, No. 4
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.4.1761-1769.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Andrei, G., Balzarini, J., Fiten, P., De Clercq, E., Opdenakker, G., Snoeck, R.
(2005). Characterization of Herpes Simplex Virus Type 1 Thymidine Kinase Mutants Selected under a Single Round of High-Dose Brivudin. J. Virol.
79: 5863-5869
[Abstract]
[Full Text]
-
Suzutani, T., Ishioka, K., De Clercq, E., Ishibashi, K., Kaneko, H., Kira, T., Hashimoto, K.-i., Ogasawara, M., Ohtani, K., Wakamiya, N., Saijo, M.
(2003). Differential Mutation Patterns in Thymidine Kinase and DNA Polymerase Genes of Herpes Simplex Virus Type 1 Clones Passaged in the Presence of Acyclovir or Penciclovir. Antimicrob. Agents Chemother.
47: 1707-1713
[Abstract]
[Full Text]
-
Griffiths, A., Chen, S.-H., Horsburgh, B. C., Coen, D. M.
(2003). Translational Compensation of a Frameshift Mutation Affecting Herpes Simplex Virus Thymidine Kinase Is Sufficient To Permit Reactivation from Latency. J. Virol.
77: 4703-4709
[Abstract]
[Full Text]
-
Bacon, T. H., Levin, M. J., Leary, J. J., Sarisky, R. T., Sutton, D.
(2003). Herpes Simplex Virus Resistance to Acyclovir and Penciclovir after Two Decades of Antiviral Therapy. Clin. Microbiol. Rev.
16: 114-128
[Abstract]
[Full Text]
-
Sarisky, R. T., Bacon, T., Boon, R., Locke, L., Nguyen, T. T., Leary, J., Esser, K., Saltzman, R.
(2002). Penciclovir Susceptibilities of Herpes Simplex Virus Isolates from Patients Using Penciclovir Cream for Treatment of Recurrent Herpes Labialis. Antimicrob. Agents Chemother.
46: 2848-2853
[Abstract]
[Full Text]
-
Leary, J. J., Wittrock, R., Sarisky, R. T., Weinberg, A., Levin, M. J.
(2002). Susceptibilities of Herpes Simplex Viruses to Penciclovir and Acyclovir in Eight Cell Lines. Antimicrob. Agents Chemother.
46: 762-768
[Abstract]
[Full Text]