Laboratory of Viral Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes of
Health, Bethesda, Maryland 20892
Previous analyses of randomly generated, temperature-sensitive
vaccinia virus mutants led to the mapping of DNA synthesis negative
complementation groups to the B1R, D4R, D5R, and E9L genes. Evidence
from the yeast two-hybrid system that the D4R and D5R proteins can
interact with the A20R protein suggested that A20R was also involved in
DNA replication. We found that the A20R gene was transcribed early
after infection, consistent with such a role. To investigate the
function of the A20R protein, targeted mutations were made by
substituting alanines for charged amino acids occurring in 11 different
clusters. Four mutants were not isolated, suggesting that they were
lethal, two mutants exhibited no temperature sensitivity, two mutants
exhibited partial temperature sensitivity, and two mutants formed no
plaques or infectious virus at 39°C. The two mutants with stringent
phenotypes were further characterized. Temperature shift-up experiments
indicated that the crucial period was between 6 and 12 h after
infection, making it unlikely that the defect was in virus entry, early
gene expression, or a late stage of virus assembly. Similar patterns of
metabolically labeled viral early proteins were detected at permissive
and nonpermissive temperatures, but one mutant showed an absence of
late proteins under the latter conditions. Moreover, no viral DNA
synthesis was detected when cells were infected with either stringent
mutant at 39°C. The previous yeast two-hybrid analysis together with the present characterization of A20R temperature-sensitive mutants suggested that the A20R, D4R, and D5R proteins are components of a
multiprotein DNA replication complex.
 |
INTRODUCTION |
Poxviruses, of which vaccinia virus
is the prototype, are unique among DNA viruses in that they reproduce
exclusively in the cytoplasm of host cells and consequently encode most
of the enzymes and factors for transcription, genome replication, and
virion assembly (19). Biochemical and genetic approaches
have provided information regarding the roles of approximately half of
the 200 proteins thought to be encoded within the 192-kbp
double-stranded DNA genome of vaccinia virus. Insights regarding the
roles of additional viral proteins could be obtained by determining
their interactions with proteins of known function. With this
objective, a genome-wide yeast two-hybrid analysis of vaccinia virus
open reading frames (ORFs) was performed (16). Of the
approximately 70,000 pairwise interactions assayed, 37 scored positive.
An intriguing finding was that the protein encoded by the A20R ORF
interacted with the proteins encoded by three other ORFs: D4R, D5R, and
H5R. D4R and D5R, both of which are required for DNA replication,
encode a uracil DNA glycosylase (5, 18, 22, 25) and a
nucleic acid-independent nucleoside triphosphatase (6, 7),
respectively. The third A20R-interacting protein, encoded by the H5R
ORF, has been implicated in transcription (1, 15) and
virus assembly (4). Based on its interaction with two
known DNA replication proteins, a related role was suggested for the
A20R protein (16). In addition, Traktman (23)
cited unpublished data showing that the A20R protein enhanced the
processivity of DNA polymerase in vitro. Although the A20R gene is
conserved among poxviruses, no homologs were found in other virus
families or organisms. Furthermore, no temperature-sensitive
(ts) or other mutants that map to A20R have been reported.
To gain insight into the role of the A20R gene in vivo, we determined
the time of its expression and generated conditional lethal
ts mutants by "clustered charge-to-alanine" mutagenesis (27). In this approach, amino acids constituting a cluster
of three or four positively or negatively charged residues are changed to alanines. Because charged amino acids are likely to be located on
the surfaces of proteins, their substitution could contribute to
temperature-dependent instability. Originally used in yeast (27), clustered charge-to-alanine mutagenesis has been
effectively applied to animal viruses, including vaccinia virus
(4, 12, 13). In this report, we describe the isolation of
A20R ts mutants that are blocked in viral DNA replication at
the nonpermissive temperature.
 |
MATERIALS AND METHODS |
Materials.
Restriction endonucleases and
polynucleotide kinase were purchased from New England Biolabs, Inc.
(Beverly, Mass.). DNA blunting and ligation kits were from Panvera
(Madison, Wis.). 32P-labeled nucleoside triphosphates and
[35S]methionine were purchased from Dupont, New England
Nuclear Corp. (Boston, Mass.). Cycloheximide, mycophenolic acid (MPA),
xanthine, and hypoxanthine were purchased from Sigma (St. Louis, Mo).
5-Bromo-4-chloro-3-indolyl-
-D-glucuronic acid (X-Gluc)
was from Clontech Laboratories, Inc. (Palo Alto, Calif.).
Cells and virus.
Monolayer cultures of BS-C-1 were
maintained in Eagle's minimal essential medium (EMEM; Quality
Biologicals, Inc. Gaithersburg, Md.) containing 10% fetal bovine
serum. Wild-type (strain) (WR) and mutant vaccinia viruses were
amplified in monolayer cultures of BS-C-1 cells. Titers of virus stocks
were determined by plaque assay on BS-C-1 monolayers. For ts
mutants, 31 and 39°C were used as the permissive and nonpermissive
temperatures, respectively.
Northern blot analysis.
Confluent monolayers of BS-C-1
cells in 35-mm-diameter dishes were infected with 15 PFU of vaccinia
virus per cell and incubated at 37°C. Total RNA was extracted with
TRIzol (Life Technologies, Rockville, Md.), separated on a 1%
agarose-formamide gel, and transferred to an Immobilon-Ny+ transfer
membrane (Millipore, Bedford, Mass.) by using the NorthernMax (Ambion,
Austin, Tex.) complete Northern blotting kit. The membrane was air
dried, and viral RNA was detected by hybridization using a
32P-labeled nick-translated probe representing the vaccinia
virus A20R gene.
Mutagenesis and cloning of the vaccinia virus A20R gene.
The
Escherichia coli xanthine-guanine phosphoribosyltransferase
(gpt) gene with an adjacent vaccinia virus P7.5 promoter was excised by NheI digestion of a plasmid provided by A. Garcia. After blunting of the staggered ends and EcoRI
digestion, the DNA was ligated to pBluescript KS+, which had been
previously digested with SmaI and EcoRI, yielding
pBSgpt. The
-glucuronidase (gus) gene with a modified
vaccinia virus H5R promoter was excised by BamHI and
NotI digestions of the plasmid pZippy-neo/gus provided by
Teri Shors and ligated to the same sites of cleaved pBSgpt, yielding pBSgptgus.
The A20R gene was amplified by PCR using the following upstream (U) and
downstream (D) primers, in which the BglII sites are shown
in italics. D-A20R; 5' AGAAGATCTAACTCGCAAAATCGTTAAGAA
3'; and U-A20R, 5'
AAAGATCTAATTTGCATTAGTGCCTCCATGAAC 3'.
Overlapping PCR was used to mutate charged amino acids in the A20R ORF
to alanines. A first PCR product was made with the U primer shown above
and a primer that contained the mutations D-A20-x), in which x is the
first charged amino acid in a cluster. A second PCR product was made
with the D primer shown above and a primer that contained the
complementary strand mutations (U-A20R-x). D-A20-x and U-A20-x also
contained silent mutations to create restriction sites that allowed us
to distinguish mutant and wild-type viruses. The primers are shown
below, with the mutated nucleotides in boldface, the restriction sites
in italics, and the names of the corresponding restriction
endonucleases in parentheses. D-A20R-62, 5'
GACGTCAATATCTGATTATTATGCGGCCGTAGCAAATGCACCGTTTAATATTGATCCGGGC 3' (EagI); U-A20R-62, 5'
GCCCGGATCAATATTAAACGGTGCATTTGCTACGGCCGCATAATAATCAGATATTGACGTC 3';
D-A20R-108, 5'
GGAAACTCTTTTCAAATACCAGCTGCCATGGCAAGTGCGTGTAACAAAG 3' (NcoI); U-A20R-108, 5'
CTTTGTTACACGCACTTGCCATGGCAGCTGGTATTTGAAAAGAGTTTCC 3';
D-A20R-167, 5'
GTACGGATTAAACATACCCAAATATTTAGCAA TTGCAATAGCGGCCGCCACATTATTTGACGACGAGTTATACTCTATT ATAGAACGC
3' (NotI); U-A20R-167, 5'
GCGTTCTATAATAGAGTATAACTCGTCGTCAAATAATGTGGCGGCCGCTATTGCAATTGCTAAATATTTGGGTATGTTTAATCCGTAC 3'; D-A20R-177, 5'
GAAGACACATTATTTGCGGCCGCGTTATACTCTATTATAG 3' (NotI); U-A20R-177, 5'
CTATAATAGAGTATAACGCGGCCGCAAATAATGTGTCTTC 3'; D-A20R-185, 5'
GTTATACTCTATTATAGCAGCCTCTTTTGCAGCTGCATTTCCAAAAATATCC 3' (PvuII); U-A20R-185, 5'
GGATATTTTTGGAAATGCAGCTGCAAAAGAGGCTGCTATAATAGAGTATAAC 3';
D-A20R-204, 5'
CCATATCGTATATTAAGTTGGGTGCACTTGCGGCGCAAGTTGTAGACTT T T TC
3' (ApaLI); U-A20R-204, 5'
GAAAAAGTCTACAACTTGCGCCGCAAGTGCACCCAACTTAATATACGATATGG 3';
D-A20R-224, 5'
CTCGTTCATGTATATTGAGTCCATCGCGGTAGCTGCGATCGGAGATAATATTTTTATTCCTAGCG 3' (PvuI); U-A20R-224, 5'
CGCTAGGAATAAAAATATTATCT CCGATCGCAGCTACCGCGATGGACTCAATATACATGAACGAG 3'; D-A20R-248, 5'
GGAAAAAAGATATTAGTAGCAGCTGTAGCCGCTTTAATACGATCTAAGG 3' (PvuII); U-A20R-248, 5'
CCTTAGATCGTATTAAAGCGGCTACAGCTGCTACTAATATCTTTTTTCC 3'; D-A20R-255,
5'
GTA AAAGATGTAGACCATTTAATAGCATCTGCGGTTGCAGCTGCTACATT TGTAAAAGTGAAAGAGGAAAACAC
3' (PvuII); U-A20R-255, 5'
GTG TTTTCCTCTTTCACTTTTACAAATGTAGCAGCTGCAACCGCAGATGCTATTAAATGGTCTACATCTTTTAC 3'; D-A20R-265, 5'
GAACATACATTTGTAGCAGTGGCAGCTGCAAACACATTTTCCATTTTATAC 3' (PvuII); U-A20R-265, 5'
GTATAAAATGGAAAATGTGTTTGCAGCTGCCACTGC TACAAATGTATGTTC 3';
D-A20R-345, 5'
GTTGATGAGATTAATAAATCCGGAACTGTAGCTGCAGCAATAGCAAACCAATCAGCATTTGATTTAAG 3' (PstI); and U-A20R-345, 5'
CTTAAATCAAATGCTGATTGGTTTGCTATTGCTGCAGCTACAGTTCCGGATTTATTAATCTCATCAAC 3'.
A mixture of the two purified PCR products served as the template for a
third PCR, which was performed with the A20R U and D primers. This
final product was gel purified, digested with BglII, and
cloned into the BamHI site of pBSgptgus to form
pBSgptgus-A20Rx, in which the A20R ORF has mutations. The plasmids were
sequenced to confirm the desired mutation and the absence of spurious changes.
Transient dominant selection and isolation of mutants.
Replacement of the wild-type A20R allele with mutant alleles was
performed by the strategy of transient dominant selection (9). Semiconfluent BS-C-1 cells in 35-mm-diameter dishes
were infected with 0.05 PFU of vaccinia virus strain WR per cell at 37°C. After 2 h, 1.0 µg of the appropriate pBSgptgus-A20Rx
plasmid was mixed with Lipofectamine (Life Technologies) and
transfected into the infected cells. After 48 h, the cells were
harvested, frozen and thawed three times, and sonicated twice for
30 s, and the virus was plaqued on BS-C-1 cells in the presence of
MPA, xanthine, and hypoxanthine at concentrations of 25, 250, and 15 µg per ml, respectively. Expression of the gpt and
gus genes, which were integrated into the viral genome by a
single-crossover recombination event, provided resistance to MPA and
staining with X-Gluc, respectively. After picking recombinant viruses
that expressed Gpt and Gus, the virus was sequentially plaque purified
in the absence of MPA, xanthine, and hypoxanthine. The loss of the
gpt and gus genes was confirmed by staining
plaques with X-Gluc. PCR amplification of the A20R region followed by
specific restriction enzyme digestion and gel electrophoresis was
performed to distinguish plaques that had the mutant A20R allele from
those that had retained the wild-type A20R allele. DNA sequencing was
then used to confirm the genotype. Viruses containing the mutated
alleles were propagated in BS-C-1 cells at 31°C.
One-step virus growth.
Confluent BS-C-1 cells in
35-mm-diameter dishes were infected with 15 PFU of wild-type or mutant
virus per cell and maintained at 31 or 39°C. The cells were harvested
at 1, 4, 9, 24, 48, and 72 h after infection, collected by
centrifugation, and resuspended in EMEM containing 2% fetal calf
serum. The cells were disrupted by three cycles of freezing and thawing
and two 30-s bursts of sonication. Virus yields were determined by
titration on BS-C-1 cells at 31°C.
Pulsed-field gel electrophoresis.
Monolayers of BS-C-1 cells
were infected with 15 PFU of virus per cell, harvested after 18 h,
and embedded in 1% low-melting-point agarose plugs. The plugs were
embedded in a 1% agarose gel in 0.5× TBE (0.0445 M Tris-borate,
0.0445 M boric acid, 1.0 mM EDTA) that was subjected to 5.5 V/cm for
18 h at 50- to 90-s intervals in an apparatus with hexagonal
electrodes (Bio-Rad, Hercules, Calif.). Following electrophoresis, the
DNA was transferred to an Immobilon-Ny+ transfer membrane and detected
by hybridization using a radiolabeled nick-translated probe
representing the vaccinia virus E9L gene.
Analysis of viral DNA synthesis by slot blot hybridization.
Confluent BS-C-1 cells in 35-mm-diameter dishes were infected with 15 PFU of wild-type or mutant virus per cell and incubated at 31 or
39°C. The cells were harvested by scraping the dishes with a rubber
policeman. The cells were collected by centrifugation, washed once with
phosphate-buffered saline (140 mM NaCl, 2 mM KCl, 10 mM
Na2HPO4, 1 mM KH2PO4
[pH 7.4]), and resuspended in 0.2 ml of 1.5 M NaCl-0.15 M sodium
citrate (pH 7.0)-1 M ammonium acetate. The cells were disrupted by
three cycles of freezing and thawing, and an additional 0.2 ml of
ammonium acetate buffer was added. After being vortexed, 50 µl of
each sample was spotted in triplicate onto an Immobilon-Ny+ transfer
membrane in a slot blot apparatus. The membrane was treated
sequentially with 0.5 M NaOH-1 M Tris-HCl (pH 7.5) and 0.3 M
NaCl-0.03 M sodium citrate (pH 7.0) and cross-linked by UV
irradiation. The membrane was air dried, and viral DNA was detected by
hybridization using a radiolabeled nick-translated probe representing
the vaccinia virus E9L gene. The blot was exposed to a phosphor screen,
and data were acquired on a Storm PhosphorImager (Molecular Dynamics,
Sunnyvale, Calif.), quantified with ImageQuant software (Molecular
Dynamics), and plotted with SigmaPlot (SSPS, Chicago, Ill.).
Analysis of viral protein synthesis by metabolic labeling.
Confluent BS-C-1 cells in 35-mm-diameter dishes were infected with 15 PFU of wild-type or mutant vaccinia virus per cell and maintained at 31 or 39°C. Individual plates of cells were washed and incubated with
prewarmed methionine-free EMEM for 30 min and then with methionine-free
EMEM supplemented with 100 µCi of [35S]methionine per
ml for 30 min. The cells were then dislodged by scraping, collected by
centrifugation, resuspended in phosphate-buffered saline, and lysed by
the addition of sodium dodecyl sulfate (SDS) sample buffer (1% SDS,
1% 2-mercaptoethanol, 10% glycerol, 25 mM Tris [pH 6.8]). Samples
were heated to 100°C for 10 min and analyzed by electrophoresis on a
5 to 20% polyacrylamide SDS gel. After electrophoresis, the gel was
dried and exposed to Kodak MR film for autoradiography.
 |
RESULTS |
Early transcription of the A20R gene.
The proteins known to be
required for vaccinia virus DNA replication are expressed early in
infection. Inspection of the DNA preceding the A20R ORF revealed a
typical early promoter consensus sequence as defined by Davison and
Moss (3). In addition, a TTTTTNT early transcription
termination signal (28) was located approximately 200 nucleotides downstream of the A20R ORF. Using a 32P-labeled
A20R probe, a discrete band consistent with the expected size of 1,600 nucleotides was detected by Northern blotting at 2 to 4 h after
infection, and it decreased in intensity at later times (Fig.
1).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 1.
Transcription of the A20R gene. BS-C-1 cells were mock
infected (ui) or infected with vaccinia virus and harvested at the
indicated times. Total RNA was analyzed by gel electrophoresis and
Northern blotting using a 32P-labeled probe derived from
the A20R gene. The positions and nucleotide lengths of rRNAs,
visualized by ethidium bromide staining, and the A20R transcript are
indicated by arrows.
|
|
Construction of vaccinia virus A20R clustered charge-to-alanine
mutants.
Recombinant vaccinia viruses are readily formed by
transfecting a plasmid with homologous sequences into cells infected
with vaccinia virus (26). The development of transient
dominant selection, based on the formation of unstable, drug-resistant,
single-crossover recombinants, provided a general way of isolating
vaccinia viruses with targeted mutations (9). By combining
this selection procedure with charge-to-alanine scanning mutagenesis,
Hassett and Condit (12) isolated ts mutants of
vaccinia virus. The following modification of that scheme was used for
the present study. (i) Alleles of the A20R ORF with three to five
alanines substituted for a cluster of charged amino acids were formed
by overlap PCR. (ii) The mutated A20R ORFs were then cloned into
pBSgptgus, a plasmid containing the gpt and gus
genes under the control of vaccinia virus promoters. (iii) Cells were
infected with vaccinia virus and transfected with a pBSgptgusA20Rx
plasmid to form a single-crossover, MPA-resistant recombinant virus
containing the gpt and gus genes flanked on either side by a wild-type and a mutant copy of A20R. (iv) Enrichment of the MPA-resistant virus was achieved by plaque purification in the
presence of selection medium. (v) Stable viruses that lost the
gpt and gus genes and contained a single
wild-type or mutated A20R ORF formed plaques at a permissive
temperature in the absence of the selection drugs. (vi) Finally, mutant
viruses were identified by the absence of Gus expression, by
restriction endonuclease analysis, and by DNA sequencing.
The amino acid sequence of the A20R ORF of vaccinia virus strain WR is
shown in Fig. 2 with charged amino acids
indicated. The charged amino acids in each of the 12 clusters, except
for the one starting with amino acid 265, are conserved in the
Copenhagen strain of vaccinia virus (11). In cluster 265, KK replaces EE in the Copenhagen strain. Because the last (unnumbered)
cluster (Fig. 2) overlaps the A22R ORF, which encodes a Holliday
junction endonuclease (10), this mutation was not included
in the series.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 2.
Clusters of charged amino acids in the vaccinia virus
A20R ORF. The translated sequence of the A20R ORF is presented, with
charged amino acids in boldface. Groups of amino acids containing
clusters of charged amino acids are underlined. The number above each
group represents the first charged amino acid in the cluster.
|
|
Ten individual MPA-resistant plaques from each of the 11 transfections
were replaqued three times in the presence of MPA, and the insertion of
the plasmid into the viral genome was confirmed by staining the plaques
with X-Gluc. Further plaque purifications were carried out at 31°C in
the absence of drugs to isolate individual viruses that had lost the
gpt and gus genes. For each original transfection, a total of 60 plaques were screened by X-Gluc staining and PCR amplification to determine the presence of the wild-type or
mutated A20R ORF. DNA sequencing indicated that we had obtained 7 of
the desired 11 mutants. For simplicity, the mutants were named
according to the number of the first amino acid mutated: mut62, mut108,
mut177, mut185, mut248, mut265, and mut345 (Fig. 2). Repeated efforts
to isolate viruses containing the remaining four mutations failed,
implying that they have lethal phenotypes.
Plaque phenotypes of A20R mutant viruses.
The seven mutant
viruses were propagated at 31°C and tested for a ts
phenotype by plaque formation at 31 and 39°C. The parental vaccinia
virus strain WR formed similar-size round plaques at the two
temperatures (Fig. 3). The plaque
phenotypes of the mutant viruses fell into three classes (Fig. 3).
mut62 and mut108 produced plaques that were similar to those of the
wild-type virus with no discernible temperature sensitivity. mut177,
mut265, and mut345 produced fewer and smaller plaques at 39 than at
31°C. mut185 and mut248 had the most stringent ts
phenotypes, and neither formed plaques at 39°C. At 31°C, plaque
formation by mut185 appeared to be normal whereas mut248 produced
plaques that were slightly smaller than those of the wild type. Thus,
five of the seven mutants exhibited some degree of temperature
sensitivity, and two of these exhibited stringent phenotypes.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Plaque formation by wild-type and A20R mutant viruses at
31 and 39°C. Confluent BS-C-1 cells were infected with similar PFU of
wild-type or mutant virus and maintained at the indicated temperature.
After 2 days, the medium was removed and the cells were stained with
crystal violet. WR refers to the wild-type WR strain of vaccinia virus.
The number on the left of each set of plaque assays corresponds to the
first charged amino acid of the cluster that was mutated (Fig. 2).
|
|
One-step yields of A20R mutant viruses.
Temperature
sensitivity was also determined by measuring one-step virus growth at
31 and 39°C. At the indicated times, the cells were harvested, and
the virus yields were determined by plaque titration at 31°C (Fig.
4). The 72-h yields of wild-type vaccinia
virus, mut62, mut108, and mut265 were similar at the two temperatures.
The 24-h yield from cells infected with mut177 or mut345 was about 1 log unit less at 39 than at 31°C, but this difference narrowed after
longer times. Replication of mut248 and mut185 was completely
suppressed at 39°C, even after 72 h. At 31°C, mut185 produced
a yield comparable to that of wild-type virus, whereas the yield of
mut248 was lower by a log unit (Fig. 4). Thus, the two viruses with the
most stringent plaque phenotypes, mut185 and mut248, also were blocked
in virus reproduction under one-step growth conditions.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
One-step growth of wild type and A20R mutant viruses.
Confluent BS-C-1 cells were infected with 5 PFU of wild-type or mutant
virus per cell and maintained at the indicated temperature. The
infected cells were harvested at various times and disrupted, and their
titers were determined on BS-C-1 cells at 31°C. The virus yields are
presented as PFU per cell. Wild-type (WR) and mutant virus numbers are
indicated.
|
|
Temperature shift-up and shift-down and mixed infections.
Additional virus yield experiments were carried out with mut185, which
displayed the lowest ratio of virus replication at 39 versus 31°C.
When cells infected with mut185 were maintained at 31°C for 2 or
6 h and then shifted to 39°C for the remaining 22 or 18 h,
the resulting virus yields were comparable to those obtained when the
cells were at the higher temperature from the start of infection, i.e.,
2 orders of magnitude below that of an infection at the permissive
temperature (Fig. 5). This timing indicated that the ts defect was unlikely to involve virus
entry or early gene expression, which could occur during the first 2 to
6 h at the permissive temperature. However, when the temperature was shifted up at 12 h (at which time little infectious virus had
formed, as shown in Fig. 4), the virus yield increased by nearly a log
unit during the next 12 h (Fig. 5). These results suggested that the
period from 6 to 12 h after infection was crucial for the activity
of the A20R protein.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Temperature shift-up experiment. BS-C-1 cells were
infected with 2 PFU of wild-type or mut185 virus per cell and incubated
at 31°C. The temperature of the cells was either maintained for
24 h or shifted from 31 to 39°C at 2, 6, or 12 h after
infection. At 24 h after infection, the cells were harvested, and
the virus yields were determined by plaque assay on BS-C-1 cells at
31°C. The experimental protocol and the virus yields are depicted on
the left and right, respectively.
|
|
When the infected cells were shifted down from 39 to 31°C at 2, 6, or
12 h after infection, virus yields were 1 to 2 orders of magnitude
greater than those obtained when the cells were maintained at the high
temperature (Fig. 6). After 12 h at
39°C, an increase in virus yield was detected within 4 h after
the temperature downshift (Fig. 7). This
increase was dependent on protein synthesis, as it was blocked with
cycloheximide (Fig. 7). Thus, the events of the first 12 h were
reversibly inhibited at the nonpermissive temperature. The virus
replication following the temperature downshift could be due to either
reactivation of previously synthesized A20R protein or de novo
synthesis of the A20R protein.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Temperature shift-down experiment. BS-C-1 cells were
infected with 2 PFU of either wild-type or mut185 virus per cell and
incubated at 39°C. The temperature of the cells was either maintained
for 24 h or shifted from 39 to 31°C at 2, 6, or 12 h after
infection. At 24 h after infection, the cells were harvested, and the
virus yields were determined by plaque assay on BS-C-1 cells at 31°C.
The experimental protocol and the virus yields are depicted on the left
and right, respectively.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 7.
Time course of virus replication following temperature
downshift. BS-C-1 cells were infected with 2 PFU of mut185 per cell and
incubated at 39°C. The cells were either harvested at 12 h after
infection or shifted from 39 to 31°C and harvested at 1, 3, 6, and 12 h after the temperature shift. Where indicated, the cells were treated
with 100 µg of cycloheximide per ml prior to the shift in
temperature. The virus yields were determined by plaque assay on BS-C-1
cells at 31°C.
|
|
To investigate whether the mut185 protein was dominant over the
wild-type protein, BS-C-1 cells were coinfected with various ratios of
the wild-type and mut185 viruses at permissive or nonpermissive temperatures. At 24 h after infection, the cells were harvested, and the virus titers were determined at the permissive temperature. When cells were infected with 10 PFU of each virus, mut185 had no
effect on the virus yield at 39°C (Fig.
8). Even when the cells were infected
with 10 PFU of mut185 and 1 PFU of wild-type virus, replication at
39°C was only partially reduced (Fig. 8). Thus, the mut185 protein
did not exert a potent dominant-inhibitory effect.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 8.
Coinfection experiment with wild-type (WR) and mut185
viruses. Confluent BS-C-1 cells were infected with wild-type and mut185
viruses at the indicated PFU per cell and maintained at either 31 or
39°C. At 24 h after infection, the cells were harvested, and
virus yields were determined by plaque assay on BS-C-1 cells at
31°C.
|
|
Effect of ts mutations on viral protein synthesis.
The synthesis of viral proteins is temporally regulated at the
transcriptional level. The DNA packaged within the virus core is
transcribed immediately after infection to produce early mRNAs. The
synthesis of intermediate- and late-stage mRNAs, however, is dependent
on viral DNA replication. Therefore, the types of viral proteins
synthesized can provide information regarding the stage at which virus
replication is blocked. Cells were infected with either wild-type or
mutant viruses and metabolically labeled with
[35S]methionine at various times. Cell lysates were
analyzed by SDS-polyacrylamide gel electrophoresis and autoradiography.
At 31°C, the patterns of protein synthesis were similar in cells
infected with all three viruses: distinct early protein bands were
detected at 2 to 6 h after infection, and late protein bands were
prominent at 12 to 18 h (Fig. 9).
Although the early patterns of viral proteins were similar in cells
infected with wild-type and mutant viruses at 39°C, differences were
noted at the later times. Whereas the late pattern was established at
6 h after infection with wild-type virus, the viral late pattern
had not occurred by 18 h after infection with mut248 at 39°C
(Fig. 9). With mut185, the late protein pattern was visible, although
the intensities of the bands were less at 39 than at 31°C (Fig. 9).
The diffuse "background" labeling at late times in cells infected
with mut248 and mut185 at 39°C (Fig. 9) is probably due to failure to
completely inhibit host protein synthesis.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 9.
Analysis of viral protein synthesis by metabolic
labeling. Monolayers of BS-C-1 cells were infected with 15 PFU of
wild-type (WR) or mut185 or mut248 virus per cell and maintained at 31 or 39°C. Individual plates of cells were incubated with
methionine-free EMEM for 30 min and then with methionine-free EMEM plus
[35S]methionine for 30 min prior to being harvested.
Samples were dissociated with SDS and analyzed by electrophoresis on a
5 to 20% polyacrylamide gel. The numbers above the lanes refer to the
hours after infection at which labeling was carried out. The arrows on
the right point to representative viral late proteins. The
electrophoretic mobilities of marker proteins of the indicated masses
are shown on the left.
|
|
Protein synthesis time course experiments were also carried out by
Western blotting using antiserum prepared by infecting rabbits with
vaccinia virus. Again, early and late proteins were detected in lysates
of cells infected by all viruses at 31°C and those of cells infected
by wild-type virus and mut185 at 39°C (data not shown). However, only
early viral proteins were detected in lysates of cells infected with
mut248 at 39°C (data not shown).
Effect of ts mutations on viral DNA replication.
The ts effect on viral late protein synthesis suggested that
DNA replication would be reduced at the nonpermissive temperature. Initial experiments, carried out by pulsed-field gel electrophoresis, indicated small amounts of viral-genome-length DNA at 24 h in cells infected with several of the ts mutants at the
nonpermissive temperature compared to those in cells infected at the
permissive temperature or to those in cells infected with wild-type
virus (data not shown). The degree of inhibition was quantified by dot blot hybridization using 32P-labeled viral DNA as the
probe. In cells infected with wild-type vaccinia virus, viral DNA
synthesis was accelerated at 39°C compared to that at 31°C, but the
24-h yields of viral DNA were similar (Fig.
10). This accelerated synthesis of
viral DNA at 39°C correlated with the detection of late proteins at
6 h after infection (Fig. 9). In contrast, when cells were
infected with either mut185 or mut248, viral DNA synthesis was detected
at 31 but not at 39°C (Fig. 10). In addition, there was some
impairment of viral DNA synthesis, particularly with mut248, even at
the permissive temperature (Fig. 10). These data suggested an important
role for the A20R protein in viral DNA replication.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 10.
Replication of wild-type (WR) and mutant viral DNA.
BS-C-1 cells were infected with 15 PFU of either wild-type, mut185, or
mut248 virus per cell and maintained at 31 or 39°C. The cells were
harvested at 2, 6, 9, or 24 h after infection, washed, and
resuspended. Uninfected cells were harvested and used for the zero time
point. Lysates were spotted onto an Immobilon-Ny+ transfer membrane.
Viral DNA was detected by hybridization to 32P-labeled
vaccinia virus DNA. The blot was exposed to a phosphor screen, and data
were acquired on a Storm PhosphorImager and quantified using ImageQuant
software. All samples were processed in triplicate and are shown as
means ± standard deviations. DPM, disintegrations per minute.
|
|
 |
DISCUSSION |
Our interest in the A20R gene was stimulated by a vaccinia virus
genome-wide yeast two-hybrid analysis that demonstrated interactions of
the A20R protein with two other viral proteins known to be involved in
DNA replication (16). Inspection of the A20R gene suggested that it has an early promoter, consistent with such a role,
but no other distinguishing features were discerned. A transcriptional
analysis confirmed the early expression of the A20R gene. To determine
the role of the protein, we decided to make conditional lethal mutants.
Three general approaches have been used to make targeted mutations in
essential vaccinia virus genes. The one most extensively used employs
the E. coli lac repressor-operator system to regulate
expression of the viral ORF and thus create a null mutation
(29). However, this method has not been successfully applied to viral genes with early promoters. One essential early gene
was deleted, however, by using a complementing cell line (14). In the third approach, charged amino acids in a
cluster were mutated to alanines and the mutant viruses were screened for temperature sensitivity (12). Prior to this study,
charge-to-alanine mutagenesis had been used to isolate ts
mutants of vaccinia virus with lesions in the G2R (12),
mRNA capping enzyme (13), and H5R (4) genes.
Inspection of the A20R ORF revealed small clusters of charged amino
acids throughout the sequence. We attempted to make 11 mutants for this
study, but 4 (mut167, mut204, mut224, and mut255) were not isolated,
suggesting that they were lethal. Of the seven mutants isolated, two
(mut62 and mut108) exhibited little or no temperature sensitivity. The
remaining mutants exhibited some temperature sensitivity indicated by
either reduced plaque size or virus yield. Two mutants, mut185 and
mut248, had stringent phenotypes and produced no plaques or infectious
virus at 39°C. For mut185 and mut248, restoration of the wild-type
phenotype was demonstrated by recombination with DNA containing only
the A20R gene (unpublished data). Except for mut177, which exhibited a
partial ts phenotype, charge-to-alanine substitutions in the central region (amino acids 167 to 255) produced stringent or presumably lethal mutants. These mutations may have weakened
intrapolypeptide contacts or contacts between the A20R protein and the
proteins encoded by other ORFs, such as D4R, D5R, or H5R.
Temperature shift-up experiments indicated that the crucial period for
activity of the A20R protein was between 6 and 12 h, making it
unlikely that the defect was in virus entry or early gene expression. A
defect in viral early protein synthesis was also ruled out by metabolic
labeling and Western blotting experiments that revealed similar
patterns of proteins between 2 and 6 h after infection at 31 and
39°C. Since relatively little infectious virus had formed by 12 h at 31°C, the timing also made it unlikely that the defect was in a
late step in virus assembly. The timing did fit either a block in DNA
replication or an early stage of virion morphogenesis. Direct evidence
for a block in viral DNA synthesis was obtained by quantitative dot
blot hybridization analysis. With the two most stringent mutants, no
viral DNA synthesis was detected when cells were infected at 39°C.
Even at 31°C, there was some reduction in DNA synthesis compared to
that of the wild-type virus. Temperature shift-down experiments
indicated that the defect was reversible even after 12 h, a result
that is compatible with the reversibility of certain drugs that block
viral DNA replication. Viral late-protein synthesis, which is dependent
on viral DNA replication, was blocked in one mutant (mut248) and
reduced in the other (mut185) at 39°C. The synthesis of viral late
proteins in cells infected with mut185 suggests that very small amounts of replicated DNA can serve as a template for intermediate and late transcription.
Vaccinia virus ts mutants that express viral early proteins
but have DNA synthesis-negative phenotypes were previously identified from collections derived by random mutagenesis (2). The
four DNA synthesis negative complementation groups were mapped to ORFs E9L (24), D5R (7, 8), B1R (20,
21), and D4R (18, 22), which encode the DNA
polymerase, a nucleoside triphosphatase, a serine or threonine kinase,
and the uracil DNA glycosylase, respectively. The A20R gene thus
represents the fifth DNA negative complementation group. Traktman
(23) cited unpublished data indicating that the A20R
protein is a previously described 48-kDa early protein that enhances
the processivity of the viral DNA polymerase in vitro
(17). Based on interactions determined with the yeast
two-hybrid system (16), A20R probably forms part of a
multienzyme replication complex that includes the D4R and D5R proteins.
We thank Christine White, Joanna Shisler, Linda Wyatt, and
Tatiana Senkevich for protocols, suggestions, and discussion of the
data and Norman Cooper for cells and viruses.
| 1.
|
Black, E. P.,
N. Moussatche, and R. C. Condit.
1998.
Characterization of the interactions among vaccinia virus transcription factors G2R, A18R, and H5R.
Virology
245:313-322[CrossRef][Medline].
|
| 2.
|
Condit, R. C., and E. G. Niles.
1990.
Orthopoxvirus genetics.
Curr. Top. Microbiol. Immunol.
169:1-40.
|
| 3.
|
Davison, A. J., and B. Moss.
1989.
The structure of vaccinia virus early promoters.
J. Mol. Biol.
210:749-769[CrossRef][Medline].
|
| 4.
|
DeMasi, J., and P. Traktman.
2000.
Clustered charge-to-alanine mutagenesis of the vaccinia virus H5 gene: isolation of a dominant, temperature-sensitive mutant with a profound defect in morphogenesis.
J. Virol.
74:2393-2405[Abstract/Free Full Text].
|
| 5.
|
Ellison, K. S.,
W. Peng, and G. McFadden.
1996.
Mutations in active-site residue of the uracil-DNA glycosylase encoded by vaccinia virus are incompatable with virus viability.
J. Virol.
70:7965-7973[Abstract].
|
| 6.
|
Evans, E.,
N. Klemperer,
R. Ghosh, and P. Traktman.
1995.
The vaccinia virus D5 protein, which is required for DNA replication, is a nucleic acid-independent nucleotide triphosphatase.
J. Virol.
69:5353-5361[Abstract].
|
| 7.
|
Evans, E., and P. Traktman.
1992.
Characterization of vaccinia virus DNA replication mutants with lesions in the D5 gene.
Chromosoma
102:S72-S82[CrossRef][Medline].
|
| 8.
|
Evans, E., and P. Traktman.
1987.
Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication.
J. Virol.
61:3152-3162[Abstract/Free Full Text].
|
| 9.
|
Falkner, F. G., and B. Moss.
1990.
Transient dominant selection of recombinant vaccinia viruses.
J. Virol.
64:3108-3111[Abstract/Free Full Text].
|
| 10.
|
Garcia, A. D.,
L. Aravind,
E. V. Koonin, and B. Moss.
2000.
Bacterial-type DNA Holliday junction resolvases in eukaryotic viruses.
Proc. Natl. Acad. Sci. USA
97:8926-8931[Abstract/Free Full Text].
|
| 11.
|
Goebel, S. J.,
G. P. Johnson,
M. E. Perkus,
S. W. Davis,
J. P. Winslow, and E. Paoletti.
1990.
The complete DNA sequence of vaccinia virus.
Virology
179:247-266[CrossRef][Medline]; 517-563.
|
| 12.
|
Hassett, D. E., and D. E. Condit.
1994.
Targeted construction of temperature-sensitive mutations in vaccinia virus by replacing clustered charged residues with alanine.
Proc. Natl. Acad. Sci. USA
91:4554-4558[Abstract/Free Full Text].
|
| 13.
|
Hassett, D. E.,
J. I. Lewis,
X. Xing,
L. DeLange, and R. C. Condit.
1997.
Analysis of a temperature-sensitive vaccinia virus mutant in the viral mRNA capping enzyme isolated by clustered charge-to-alanine mutagensis and transient dominant selection.
Virology
238:391-409[CrossRef][Medline].
|
| 14.
|
Holzer, G., and F. G. Falkner.
1997.
Construction of a vaccinia virus deficient in the essential DNA repair enzyme uracil DNA glycosylase by a complementing cell line.
J. Virol.
71:4997-5002[Abstract].
|
| 15.
|
Kovacs, G. R., and B. Moss.
1996.
The vaccinia virus H5R gene encodes late gene transcription factor 4: purification, cloning and overexpression.
J. Virol.
70:6796-6802[Abstract/Free Full Text].
|
| 16.
|
McCraith, S.,
T. Holtzman,
B. Moss, and S. Fields.
2000.
Genome-wide analysis of vaccinia virus protein-protein interactions.
Proc. Natl. Acad. Sci. USA
97:4879-4884[Abstract/Free Full Text].
|
| 17.
|
McDonald, W. F.,
N. Klemperer, and P. Traktman.
1997.
Characterization of a processive form of the vaccinia virus DNA polymerase.
Virology
234:168-175[CrossRef][Medline].
|
| 18.
|
Millns, A. K.,
M. S. Carpenter, and A. M. DeLange.
1994.
The vaccinia virus-encoded uracil DNA glycosylase has an essential role in viral DNA replication.
Virology
198:504-513[CrossRef][Medline].
|
| 19.
|
Moss, B.
1996.
Poxviridae: the viruses and their replication, p. 2637-2671.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 20.
|
Rempel, R. E.,
M. K. Anderson,
E. Evans, and P. Traktman.
1990.
Temperature-sensitive vaccinia virus mutants identify a gene with an essential role in viral replication.
J. Virol.
64:574-583[Abstract/Free Full Text].
|
| 21.
|
Rempel, R. E., and P. Traktman.
1992.
Vaccinia virus B1 kinase phenotypic analysis of temperature-sensitive mutants and enzymatic characterization of recombinant proteins.
J. Virol.
66:4413-4426[Abstract/Free Full Text].
|
| 22.
|
Stuart, D. T.,
C. Upton,
M. A. Higman,
E. G. Niles, and G. McFadden.
1993.
A poxvirus-encoded uracil DNA glycosylase is essential for virus viability.
J. Virol.
67:2503-2512[Abstract/Free Full Text].
|
| 23.
|
Traktman, P.
1996.
Poxvirus DNA replication, p. 775-793.
In
M. L. DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 24.
|
Traktman, P.,
R. C. Sridhar, and B. E. Roberts.
1984.
Transcriptional mapping of the DNA polymerase gene of vaccinia virus.
J. Virol.
49:125-131[Abstract/Free Full Text].
|
| 25.
|
Upton, C.,
D. T. Stuart, and G. McFadden.
1993.
Identification of a poxvirus gene encoding a uracil DNA glycosylase.
Proc. Natl. Acad. Sci. USA
90:4518-4522[Abstract/Free Full Text].
|
| 26.
|
Weir, J. P.,
G. Bajszar, and B. Moss.
1982.
Mapping of the vaccinia virus thymidine kinase gene by marker rescue and by cell-free translation of selected mRNA.
Proc. Natl. Acad. Sci. USA
79:1210-1214[Abstract/Free Full Text].
|
| 27.
|
Wertman, K. F.,
D. G. Drubin, and D. Botstein.
1992.
Systematic mutational analysis of the yeast ACT1 gene.
Genetics
132:337-350[Abstract].
|
| 28.
|
Yuen, L., and B. Moss.
1987.
Oligonucleotide sequence signaling transcriptional termination of vaccinia virus early genes.
Proc. Natl. Acad. Sci. USA
84:6417-6421[Abstract/Free Full Text].
|
| 29.
|
Zhang, Y., and B. Moss.
1991.
Inducer-dependent conditional-lethal mutant animal viruses.
Proc. Natl. Acad. Sci. USA
88:1511-1515[Abstract/Free Full Text].
|