Previous Article | Next Article ![]()
Journal of Virology, February 2001, p. 1476-1486, Vol. 75, No. 3
Laboratory of Molecular Neurovirology, Center
for Neurovirology and Cancer Biology, College of Science and
Technology, Temple University, Philadelphia, Pennsylvania
19122,1 Laboratory of Molecular & Cellular Pathology, School of Medicine,2 and
Laboratory of Comparative Pathology, Graduate School of
Veterinary Medicine,3 Hokkaido
University, and CREST, Japan Science and Technology
Corporation,4 Sapporo, Japan
Received 27 July 2000/Accepted 26 October 2000
In addition to encoding the structural and regulatory proteins,
many viruses encode auxiliary proteins, some of which have been shown
to play important roles in lytic and latent states of the viruses. The
human neurotropic JC virus (JCV) genome encodes an auxiliary protein
called Agno whose function remains unknown. Here, we investigated the
functional role of JCV Agno protein on transcription and replication of
the viral genome in glial cells. Results from transfection of human
glial cells showed that Agno protein suppresses both T-antigen-mediated
transcription of the viral late gene promoter and T-antigen-induced
replication of viral DNA. Affinity chromatography and
coimmunoprecipitation assays demonstrated that the Agno protein and T
antigen physically interact with each other. Through the use of a
series of deletion mutants, we demonstrated that the
T-antigen-interacting region of Agno protein is localized to its
amino-terminal half and the Agno-interacting domain of T antigen maps
to its central portion. Furthermore, utilizing various Agno deletion
mutants in functional studies, we confirmed the importance of the
Agno-T antigen interaction in the observed down-modulation of T antigen
function upon viral gene transcription and DNA replication by Agno
protein. Taken together these data suggest that the Agno protein of
JCV, which is produced late during the late phase of the lytic cycle,
can physically and functionally interact with the viral early protein, T antigen, and downregulate viral gene expression and DNA replication. The importance of these observations in the lytic cycle of JCV is discussed.
Results from a large volume of
studies have shown that the auxiliary proteins produced by various
eukaryotic viruses may play a critical role in orchestrating the viral
lytic cycle and the state of viral latency. This group of proteins has
a diverse effect on various stages of infection including transcription
(11, 13, 14, 27, 41, 61), translation (19),
replication (12, 35, 50), viral assembly
(39), release of viral particles (51, 56),
and export of viral transcripts from nucleus to cytoplasm
(15). In addition, this group of viral proteins may have
an impact upon host function and, by deregulating expression of key
cellular genes, contribute to the pathogenesis of viral-induced disease.
The human neurotropic polyomavirus, JC virus (JCV), contains an open
reading frame for expressing a 71-amino-acid peptide whose function in
the viral life cycle remains unknown. Clinically, replication of JCV in
glial cells induces the fatal demyelinating disease of the brain,
progressive multifocal leukoencephalopathy (PML) (5, 8,
60).
The genome of JCV is composed of a double-stranded covalently linked
circular DNA which is composed of three functional regions (17), including viral early and late coding regions and
the viral noncoding regulatory region (Fig.
1A). The viral early coding region
encodes two regulatory proteins, small and large T antigens. Although
little is known about the function of small t antigen, the large T
antigen was shown to be a multifunctional phosphoprotein which, by
interacting with several cellular proteins including Pur
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.3.1476-1486.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Interaction of JC Virus Agno Protein with T Antigen
Modulates Transcription and Replication of the Viral Genome in
Glial Cells
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
and YB-1
(18, 47, 48), can modulate both the initiation of viral
DNA replication and activation of JCV late gene transcription. In
addition to small and large T antigens, the viral early genome encodes
several spliced variants of early proteins, due to alternative splicing
of the early transcripts (57). These variants of T antigen
have been shown to differentially interact with the retinoblastoma family of tumor suppressor proteins (7). Additionally, JCV T antigen is oncogenic and its expression can induce development of
tumors of neural origin in experimental animals (31, 49, 58), and its genome has been found in several human tumors
(32, 33, 45). The viral late coding region is responsible
for expression of three structural proteins, VP1, VP2, and VP3, all of
which participate in the formation of viral capsids (36).
In addition, the leader of the late transcripts contains an open
reading frame for the 71-amino-acid Agno protein.

View larger version (40K):
[in a new window]
FIG. 1.
Structural organization of the JCV genome and Agno
protein. (A) JCV genomic structure, depicting the direction of the
genes encoding the early and late proteins with arrows. Early genes
encode small and large T antigens. Late genes encode viral capsid
proteins, VP-1, -2, and -3, and Agno protein. The control region is
located between the early and late genes. (B) Comparison of primary
amino acid sequences of JCV Agno protein with its counterparts from
SV40 and BKV.
JCV is closely related to the other polyomaviruses, including the simian vacuolating virus (SV40) and the human BK virus (BKV) (16, 17). These viruses share significant sequence homology, particularly in their coding regions (16). JCV and SV40 exhibit approximately 80% homology in their early coding regions, close to 70% homology in their late coding sequences for VP1, VP2, and VP3, and less than 70% homology in the region corresponding to Agno protein. The highest degree of divergence between JCV and SV40 Agno proteins is clustered at the far carboxyl terminal regions (Fig. 1B). JCV and BKV also share a similar degree of homology in those respective regions. The regulatory region of JCV is distinct from those of SV40 and BKV and is responsible for cell-type-specific transcription of the viral genome in central nervous system (CNS) cells (1, 28, 42, 43, 54, 55). Earlier studies on both BKV and SV40 established that the Agno gene is expressed during the late phase of infection (25, 26, 30, 38, 46). Mutational analysis of SV40 Agno protein revealed the importance of this protein in the regulation of the SV40 lytic cycle and virion production (4, 38, 40). While the mechanisms involved in this process remain unknown, it is postulated that SV40 Agno protein may have a functional role at the level of viral assembly (26, 37, 38, 40), maturation (24, 26), transcription, and translation (3, 21, 22).
In this study, we examined the effect of JCV Agno protein on transcription and replication of the viral genome in glial cells, in the absence and presence of the viral early protein T antigen. We demonstrate that functional and structural interaction of Agno protein with T antigen results in suppression of viral gene expression and DNA replication in glial cells.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell lines. HJC-15b (44) cells were derived from hamster brain tumors induced by JCV (59) and were grown in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal calf serum and antibiotics (penicillin-streptomycin, 100 µg/ml). U-87MG, a human glial origin cell line, was grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and antibiotics (penicillin-streptomycin, 100 µg/ml). All cells were maintained at 37°C in a humidified atmosphere with 7% CO2.
Plasmid constructs.
The pBLCAT3-Mad-1L reporter
construct containing the regulatory region of JCV Mad-1 strain in the
late orientation was described previously (10). The
glutathione S-transferase (GST) fusion protein of JCV T
antigen (pGEX2T-T-antigen) and its C-terminal [pGEX2T-T-antigen
(1-411), pGEX2T-T-antigen (1-265), and pGEX2T-T-antigen (1-82)] and
N-terminal [pGEX2T-T-antigen (266-688), pGEX2T-T-antigen (412-688),
and pGEX2T-T-antigen (629-688)] deletion mutants were previously
described (47). pGEX2T-T-antigen (250-450) was created by
PCR amplification of the respective region by forward
(5'-ACTACTTCGGATCCGGGGGCCTTAAGGAGCATGACTTT-3') and reverse
(5'-ACTACTTG AATTCAACATTTAATGACTTTCCCCC-3') primers. The
resulting fragment was cloned in frame into
BamHI/EcoRI sites of pGEX2T vector. A plasmid
containing an intronless JCV T-antigen coding region (6)
was used as a template in PCR amplification. PGEX1
T-Agno and its
deletion mutants were also created by PCR amplification utilizing the
following specific primers. Forward primers (FP) were Agno
5'-BamHI
(5'-ACTGACGGATCCGCCACCATGGTTCTTCGCCAGCTGTCA-3'), FP aa 18 (5'-ACTGACGGATCCGCCACCATGAGTGGAACTAAAAAAAGAGCT-3'), FP aa 37 (5' - AC TGACGGATCCGCCACCATGC TGGAC T T T TGCACAGG TGAA - 3'),
and FP aa 55 (5'-ACTGACGGATCCGCCACCATGAGTGGTTTGACTGAGCAGACATAC-3'). Reverse primers (RP) were Agno-3' EcoRI
(5'-ACTGACGAATTCCTACTATGTAGCTTTTGGTTCAGG-3'), RP aa 54 (5'-ACTGACGAATTCCTAGTGTCTCTGTCTTTTTTTCCC-3'), and RP aa 36 (5'-ACTGACGAATTCCTACAAAAATTCTAACAAAAAAAT-3'). A pBR322-based plasmid containing the entire JCV Mad-1 DNA was used as a template in
PCR amplification. The PCR products were digested with
BamHI/EcoRI and cloned in the pGEX11T vector.
Further, full-length Agno and its two deletion mutants (amino acids 1 to 36 and 55 to 71) were also subcloned into pCDNA3
expression vector (Invitrogen) at BamHI/EcoRI sites by utilizing PCR amplification with the respective primers as
described above. pEBV-HisA-Agno plasmid was created by PCR amplification with the following primers: Agno-5'
(5'-CCGCTTAGGATCCATGGTTCTTGGCCAGCTGTCA-3') and Agno-3'
(5'-ACGTCCAAAGCTTCTATGTAGCTTTTGGTTCAGG-3'). The respective PCR product was digested with BamHI and
HindIII enzymes and subcloned into
BamHI/HindIII sites of the vector.
pEBV-HisA-SV40-Agno plasmid was also created by PCR amplification with
SV40 5' (5'-ACACAAAGGATCCCGCCGCCATGGTGCTGCGCCGGCTGTCACGC-3') and SV40 Agno 3' (5'-ACACAAAAAGCTTTTAACTTTCTGGTTTTTCAGT-3')
primers, and the resulting PCR products were subcloned into
BamHI/HindIII sites of the vector.
Transient transfection assays. U-87MG cells were transfected by the calcium phosphate precipitation method (20) with reporter constructs alone or in combination with Agno and T-antigen expression plasmids. Plasmid concentrations used in each transfection experiment are indicated below and/or in the figure legends. The total amount of DNA transfected into the cells was normalized with relevant empty vector DNA. A glycerol shock was applied at 4 h posttransfection and cells were harvested after 36 h. Chloramphenicol acetyl transferase (CAT) activity of samples was determined by utilizing 40 µg of protein for each sample. Transfections were repeated at least three times with different plasmid preparations and standard deviations are indicated by error bars.
Expression and purification of recombinant GST fusion
proteins.
Fifty-milliliter overnight cultures of Escherichia
coli DH5
transformed with either pGEX1
T-Agno or pGEX2T-JCV T
antigen or their respective deletion mutant plasmids were diluted 1:10 in fresh Luria-Bertani broth supplemented with ampicillin (100 µg/ml). Cultures were induced with 0.3M
isopropyl-
-thiogalactopyranoside (IPTG) at an optical density of 0.5 and incubated for an additional 2 h at 37°C. Cells were
collected by centrifugation and resuspended in 10 ml of lysis buffer
containing 20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.5%
Nonidet P-40 supplemented with 1 mM phenylmethylsulfonyl fluoride, 2 mM
pepstatin A, 0.6 mM leupeptin, and 2 mM benzamidine. After sonication,
clear cell lysates were prepared by centrifugation at 12,000 × g. Lysates were then incubated with 150 µl of 50% glutathione-Sepharose beads (Pharmacia, Piscataway, N.J.) overnight at
4°C. GST fusion proteins were purified by three cycles of washing and
centrifugation with 5 ml of lysis buffer. Fusion proteins were analyzed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
followed by Coomassie blue staining.
GST affinity chromatography assays (GST pull-down). For GST pull-down assays, 2 µg of either GST alone, GST-Agno, or its deletion mutants immobilized on Sepharose beads was incubated with 0.5 mg of whole-cell extracts prepared from HJC cells constitutively expressing JCV T antigen for 4 h at 4°C in lysis buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 0.5% Nonidet P-40. The protein-complexed beads were washed extensively with lysis buffer and resolved by SDS-10% PAGE followed by Western blot analysis using an antibody (Ab-2 416) directed against JCV T antigen. In a different method, GST or GST-JCV T antigen (2 µg of each) immobilized on Sepharose beads was incubated overnight with 4 µl of [35S]-labeled in vitro-translated Agno in lysis buffer in a 300-µl total volume. The protein-complexed beads were extensively washed with lysis buffer and resolved by SDS-15% PAGE. Proteins were detected by fluorography for the presence of Agno.
Coimmunoprecipitation and Western blot analysis.
pEBV-His-Agno expression plasmid was transfected into HJC-15b (hamster
astrocytic cell line constitutively expressing JCV T antigen) cells via
the calcium phosphate precipitation method (20). At
36 h posttransfection, cells were lysed in lysis buffer containing
150 mM NaCl, 20 mM Tris-HCl (pH 7.4), and 0.25% Nonidet P-40
supplemented with a cocktail of proteinase inhibitors including 1 mM
phenylmethylsulfonyl fluoride, leupeptin (10 µg/ml), aprotinin (1 µg/ml), and 50 mM sodium fluoride. Five hundred micrograms of
whole-cell extract in a total volume of 0.5 ml was incubated either
with 2 µg of anti-T7 antibody (
-T7) (Novagen, Madison, Wis.)
directed against the His-T7-tagged Agno or 2 µg of preimmune antisera
(
-pre) overnight at 4°C. Immunocomplexes were precipitated with
the addition of protein A-Sepharose beads (Pharmacia) for an additional
2 h and washed extensively with lysis buffer. Immunocomplexes were
then resolved by SDS-10% PAGE and analyzed by Western blotting using
an anti-T-antigen antibody (Ab-2 416) (Oncogene, Uniondale, N.Y.)
and developed with an ECL detection kit (Amersham, Arlington Heights,
Ill.) according to the manufacturer's recommendations.
In vitro transcription and translation assay. Full-length Agno protein was radiolabeled with [35S]methionine using a TNT-coupled in vitro transcription-translation system (Promega, Madison, Wis.) according to the recommendations of the manufacturer.
Replication assay. Replication assays were carried out as previously described (9). Briefly, a replication-competent plasmid, pBLCAT3-Mad-1L, containing the regulatory region of the Mad-1 strain of JCV, was introduced alone or in combination with expression vectors, CMV-T-antigen and CMV-Agno, into U-87MG (0.4 × 106 cells per plate) cells with the calcium phosphate precipitation method. Plasmid concentrations used in transfections are indicated in the respective figure legends, and the total amount of DNA transfected into the cells was normalized with appropriate empty vectors. A glycerol shock was applied at 4 h posttransfection and the medium was replenished. At 72 h posttransfection, low-molecular-weight DNA containing both input and replicated plasmids was isolated by the Hirt method (23), digested with SacI and DpnI enzymes, resolved on a 0.8% agarose gel and analyzed by using Southern blotting. Probes for Southern blots were prepared from a DNA fragment encompassing the regulatory region of JCV Mad-1 by utilizing a ready-prime random labeling kit (Amersham/Pharmacia Biotechnologies). The bands corresponding to the replicated DNA were quantitated utilizing a densitometer (Bio-Rad Fx PhosphorImager) with Quantity One software. The degree of inhibition of T-antigen-mediated JCV DNA replication by Agno protein was expressed as percent inhibition with respect to the degree of viral DNA replication in the presence of JCV T antigen alone.
| |
RESULTS |
|---|
|
|
|---|
Effect of Agno protein on transcriptional activity of the
JCV promoters.
To determine the functional importance of Agno
protein on transcriptional activity of the JCV late promoter, a plasmid
that permits expression of Agno protein under the control of the Rous sarcoma virus (RSV) promoter was created and the first stable production of Agno protein was determined by Western blot analysis. As
shown in Fig. 2A, anti-T7 antibody
specifically immunoprecipitated histidine-tagged Agno protein in
extracts from U-87MG cells transfected with a His-tagged Agno
expression plasmid (compare lane 4 to lane 3). The specificity of this
immunoprecipitation was demonstrated by the use of both normal mouse
serum (lane 1) and anti-T7 antibody (lane 2), both of which showed no
cross-reactivity with the proteins prepared from the untransfected
cells. Next, we performed cotransfection experiments in U-87MG cells by
using a reporter construct containing the JCV late gene promoter and
expression plasmids for Agno and JCV T antigen. As shown in Fig. 2B, in
the absence of T antigen a CAT reporter construct containing the JCV
late promoter was poorly expressed (lane 1). Cotransfection of the
reporter construct with a T-antigen expression plasmid resulted in a
substantial increase (ninefold) in the transcriptional activity from
the late promoter (compare lanes 1 and 2). In contrast, when increasing amounts of a plasmid expressing Agno protein were cointroduced along
with a constant amount of T-antigen expression plasmid into glial
cells, we observed a suppressive effect of Agno on the
T-antigen-mediated activation of the late promoter (compare lane 2 to
lanes 3 and 4). At the highest DNA concentration, expression of Agno
protein alone further decreased the basal expression of the late
promoter, suggesting that Agno may have a negative regulatory effect on the basal expression of JCV late promoter. To further test this possibility, we carried out transfection experiments using a constant amount of reporter construct containing JCV late promoter alone (Fig.
2C, lane 1) or in combination with an increasing amount of Agno
expression plasmid (lanes 2 and 3). As shown in Fig. 2C, production of
Agno protein in U-87MG caused a considerable decrease in the basal
level of JCV late gene transcription (lanes 2 and 3). In addition, we
have also performed transfection experiments to assess the effect of
SV40 Agno protein on JCV late promoter expression. As shown in Fig. 2D,
SV40 Agno showed only a minor inhibitory effect on the transcription of
the JCV late promoter in the presence of T antigen (Fig. 2D),
suggesting that the observed negative effect of Agno on JCV gene
expression is specific. These observations indicate that Agno protein
negatively regulates both basal and T-antigen-induced transcription of
the JCV late promoter.
|
Effect of Agno on T-antigen-mediated JCV DNA replication.
The
observed effect of Agno protein on T-antigen-mediated transcription of
the JCV late genome suggested that Agno protein may also exert a
regulatory effect on T-antigen-mediated viral DNA replication. To
investigate this possibility, we performed DpnI replication
assays (9). A replication-competent plasmid containing the
JCV origin of DNA replication was introduced alone or in combination
with an Agno gene expression plasmid into U-87MG cells. At 72 h
posttransfection, low-molecular-weight DNA was isolated by the Hirt
procedure (23) and newly replicated DNA was analyzed by
Southern blot analysis. As shown in Fig.
3, in the presence of T antigen, the
plasmid containing viral DNA was efficiently replicated (lane 2).
However, in the presence of Agno protein, a substantial decrease in
T-antigen-induced viral DNA replication was observed. Agno protein
alone showed no ability to induce viral DNA replication (lane 5). Of
note, in recent studies it was shown that JCV with a mutation in Agno
has a different growth cycle compared to the wild-type virus,
suggesting the importance of Agno in the viral lytic cycle (Y. Okada et
al., unpublished data). These observations indicate that Agno protein
can negatively affect T-antigen-induced replication of JCV DNA, perhaps
through its interaction with and inactivation of T antigen.
|
Interaction of Agno protein and T antigen.
Results from
transcription and replication studies suggested that JCV large T
antigen may physically interact with the late auxiliary Agno protein.
To test this possibility, we performed affinity chromatography (GST
pull-down) experiments in which one of the two proteins was
prokaryotically expressed as a GST fusion protein and bound to a
glutathione resin while the other protein was passed over the resin and
analyzed for its ability to be specifically retained by the GST fusion
protein. In the first experiment, GST or GST-Agno protein was
immobilized on glutathione-Sepharose beads and incubated with
whole-cell extracts from HJC-15b cells, which constitutively express T
antigen. Proteins bound to beads were extensively washed and were
analyzed by Western blot analysis using antibodies specific for T
antigen. As demonstrated in Fig. 4A, T
antigen was retained on the Sepharose column containing GST-Agno (lane
3). Interestingly, Agno protein is able to interact with three isoforms
of JCV T antigen expressed in HJC-15b cells. These three isoforms of T
antigen are believed to represent different phosphorylated forms of T
antigen (53). This interaction was not observed between T
antigen and GST (lane 2).
|
Mapping of the region within Agno protein which interacts with T
antigen.
In the next series of experiments, we attempted to map
the region of Agno protein which is involved in the interaction with T
antigen. A series of deletion mutants in the Agno gene was created and
mutant Agno proteins fused to GST were incubated with whole-cell lysates from HJC-15b cells. Bound complexes were resolved by SDS-PAGE and analyzed by Western blotting using anti-T-antigen antibody. As
shown in Fig. 5A, removal of the region
of the Agno protein which is positioned between residues 55 to 71 and
36 to 71 enhanced the binding ability of Agno protein to T antigen in
comparison to that observed with the full-length Agno protein (compare
lanes 4 and 5 to lane 3). Deletion of the region spanning residues 1 to
18 showed a moderate effect on the binding ability of Agno protein to T
antigen (compare lane 6 to lane 3). Removal of the residues between 37 to 71 and 55 to 71 completely abrogated association of Agno protein and
T antigen. These observations suggest that the region positioned
between residues 18 to 37 is important for allowing Agno protein to
interact with T antigen. In support of this conclusion, results from
the binding of a truncated Agno protein encompassing residues 18 to 54 revealed the ability of this protein to interact with T antigen (lane
9). This study, in addition, demonstrates that amino acid residues
between 36 and 71 have a negative effect on the interaction between
Agno and T antigen. Figure 5B illustrates the Coomassie blue-stained SDS-PAGE of the full-length and mutant Agno proteins which were used in
this study and verifies the integrity of the protein preparations. Figure 5C summarizes the results of the GST pull-down assay and depicts
the regions of Agno which bind to T antigen.
|
Identification of the region within T antigen which is important
for its interaction with Agno protein.
To identify the region(s)
of T antigen necessary for its interaction with Agno protein, a series
of carboxy-terminal (Fig. 6A) and
amino-terminal (Fig. 6B) deletion mutants of T antigen were
prokaryotically expressed as GST fusion proteins and incubated with in
vitro-translated [35S]methionine-labeled Agno protein.
Consistent with previous observations (Fig. 3A), while full-length T
antigen fused to GST interacted with Agno protein (lane 3), GST protein
alone showed no binding to T antigen (lane 2). The carboxy-terminal
deletion mutant of T antigen containing residues 1 to 411 retained its
binding ability to Agno protein (compare lanes 3 to 4). The removal of
residues 1 to 266 significantly affected the ability of T antigen to
interact with Agno protein (lane 5). A further carboxy-terminal
deletion completely abolished interaction of Agno protein with T
antigen (lane 6).
|
Effect of mutant Agno proteins on T-antigen-induced JCV gene
transcription and viral DNA replication.
To further assess the
functional interaction between Agno protein and T antigen, we examined
the ability of mutant Agno proteins which have retained or lost their
binding activity with T antigen upon JCV gene transcription and
replication in glial cells. We chose mutant protein Agno (1-36), which
showed the ability to interact with T antigen in in vitro GST pull-down
assays, and mutant protein Agno(55-71), which showed no binding
activity to T antigen. For the transcriptional assays, we performed
transfections using a reporter JCV late CAT construct alone or in
combination with the T-antigen expression plasmid and plasmids
expressing protein mutants Agno(1-36) and Agno(55-s71). As shown in
Fig. 7A, Agno(1-36), which strongly binds
to T antigen, showed a drastic negative effect on the
T-antigen-mediated activation of the JCV late promoter (Fig. 7A)
compared to the full-length protein (Fig. 2B), while mutant Agno(55-71)
had no effect on the level of transcriptional activation of the JCV
promoter by T antigen (Fig. 7B).
|
| |
DISCUSSION |
|---|
|
|
|---|
The 71-amino-acid Agno protein of JCV may play an important role in the viral lytic cycle by modulating the rate of viral gene transcription and DNA replication. To exert its activity, Agno protein may interact with the viral key regulatory protein, T antigen, which is expressed early during infection. This is an interesting observation, as it demonstrates that interaction of Agno protein, which is produced at the late phase of the infection cycle, with the early protein, T antigen, can modulate the activity of this protein during the late stage of lytic infection. While the importance of this regulatory event in the pathogenesis of JCV-induced demyelination of the CNS remains to be elucidated, one may speculate that, by slowing the rate of late gene expression and viral DNA replication, Agno protein may prevent disproportional production of capsid proteins and viral DNA during the course of the infection cycle and optimize the efficiency of virion formation. Furthermore, Agno protein may prolong the course of the lytic cycle in CNS cells, and this may further contribute to the pathogenesis of the disease, which is manifested by gradual demyelination of the CNS.
Similar to SV40 T antigen, JCV T antigen is composed of several
interesting domains which interact with several functionally important
cellular proteins. For example, the region which is important for Agno
protein interaction, i.e., residues 250 to 450, overlaps with the
binding sites for p53, YB-1, and polymerase
and has several
activities such as helicase and Zn binding. Thus, it is likely that
Agno protein, by associating with T antigen, controls several of these
activities during the late stages of the infection cycle. In addition,
structurally, Agno protein has several interesting features. First, the
protein is highly basic and contains several posttranslational
modification sites including phosphorylation by protein kinase C and
casein kinase II. While the phosphorylation sites for protein kinase C
are clustered at the amino terminal of the Agno protein, the carboxyl
terminal of the protein is the target for phosphorylation by casein
kinase II. Although the phosphorylation of JCV Agno protein remains to be illustrated, earlier studies have shown that BKV Agno protein can be
phosphorylated (46). Future studies in our laboratory are
aimed to further characterize the structural features of the Agno
protein and their importance in regulation of the JCV lytic cycle and
host function during the course of infection.
The studies presented in this communication provide evidence, for the first time, that the human papovavirus Agno protein, by interacting with the viral regulatory protein, T antigen, can modulate the activity of this protein upon viral gene expression and DNA replication. With the notion that JCV infection occurs in greater than 70% of the human population during childhood and the virus remains in the latent state throughout life, one may question whether Agno protein plays any role in maintaining the virus at latency. Furthermore, it is interesting to determine the function of Agno protein during the course of immunosuppression, when the virus gains an opportunity to exit from latency and actively replicates in brain cells. Our recent preliminary observations have shown expression of the Agno protein in oligodendrocytes of patients with PML, suggesting that this protein is expressed during the course of the disease. As such, one may hypothesize that the negative regulatory effect of Agno protein on viral replication may alter the course of disease progression, or that a mechanism induced upon immunosuppression prevents the Agno protein from imposing its suppressive function on viral gene transcription and replication. Our future experiments, which are aimed at the identification of the proteins which are associated with Agno protein in the infected oligodendrocytes during the course of infection, should provide some clues regarding the role of Agno protein in the pathogenesis of PML.
| |
ACKNOWLEDGMENTS |
|---|
We thank past and present members of the Center for Neurovirology and Cancer Biology for insightful discussions, sharing of ideas, and reagents. We thank Cynthia Schriver for editorial assistance.
This work was made possible by grants awarded by NIH to K.K. Y.O. is a research fellow of the Japan Society for the Promotion of Science.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Molecular Neurovirology, Center for Neurovirology and Cancer Biology, College of Science and Technology, Temple University, 1900 N. 12th St., 015-96, Room 203, Philadelphia, PA 19122. Phone: (215) 204-0678. Fax: (215) 204-0679. E-mail: kkhalili{at}astro.temple.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ahmed, S.,
J. Rappaport,
H. Tada,
D. Kerr, and K. Khalili.
1990.
A nuclear protein derived from brain cells stimulates transcription of the human neurotropic virus promoter.
J. Biol. Chem.
265:13899-13905 |
| 2. |
Ahmed, S.,
M. Chowdhury, and K. Khalili.
1990.
Regulation of a human neurotropic virus promoter, JCVE: identification of a novel activator domain located upstream from the 98 bp enhancer promoter region.
Nucleic Acids Res.
18:7417 |
| 3. | Alwine, J. 1982. Evidence for simian virus 40 late transcriptional control: mixed infections of wild-type simian virus 40 and a leader deletion mutant exhibit trans effects on late viral RNA synthesis. J. Virol. 37:730-737. |
| 4. |
Barkan, A., and J. E. Mertz.
1981.
DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.
J. Virol.
37:730-737 |
| 5. | Berger, J. R., and M. Concha. 1995. Progressive multifocal leukoencephalopathy: the evolution of a disease once considered rare. J. Neurovirol. 1:5-18[Medline]. |
| 6. | Bollag, B., B. C. Mackeen, and R. J. Frisque. 1995. Purified JC virus T antigen derived from insect cells preferentially interacts with binding site II of the viral core origin under replication conditions. Virology 218:81-93. |
| 7. | Bollag, B., C. Prins, E. L. Snyder, and R. Frisque. 2000. Purified JC T and T' proteins differentially interact with the retinoblastoma family of tumor suppressor proteins. Virology 274:165-178[CrossRef][Medline]. |
| 8. | Brooks, B. R., and D. L. Walker. 1984. Progressive multifocal leukoencephalopathy. Neurol. Clin. 2:299-313[Medline]. |
| 9. | Chang, C.-F., G. L. Gallia, V. Muralidharan, N. N. Chen, P. Zolteck, E. Johnson, and K. Khalili. 1996. Evidence that replication of human neurotropic JC virus DNA in glial cells is regulated by the sequence-specific single-stranded DNA-binding protein Pura. J. Virol. 70:4150-4156[Abstract]. |
| 10. |
Chen, N. N., and K. Khalili.
1995.
Transcriptional regulation of human JC polyomavirus promoters by cellular proteins YB-1 and Pur in glial cells.
J. Virol.
69:5843-5848[Abstract].
|
| 11. | Cohen, E. A., R. A. Subbramanian, and H. G. Gottlinger. 1996. Role of auxiliary proteins in retroviral morphogenesis. Curr. Top. Microbiol. Immunol. 214:219-235[Medline]. |
| 12. | Collette, Y., and D. Olive. 1999. The primate lentivirus-encoded Nef protein can regulate several steps of the viral replication cycle. Virology 265:173-177[CrossRef][Medline]. |
| 13. | Cullen, B. 1998. HIV-1 auxiliary proteins: making connections in a dying cell. Cell 93:685-692[CrossRef][Medline]. |
| 14. |
Diaz-Guerra, M., and M. Esteban.
1993.
Vaccinia virus nucleoside triphosphate phosphohydrolase I controls early and late gene expression by regulating the rate of transcription.
J. Virol.
67:7561-7572 |
| 15. | Fisher, U., J. Huber, W. C. Boelens, I. W. Mattaj, and D. Baltimore. 1995. The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs. Cell 82:475-483[CrossRef][Medline]. |
| 16. |
Frisque, R. J.,
G. L. Bream, and M. T. Cannella.
1984.
Human polyomavirus JC virus genome.
J. Virol.
51:458-469 |
| 17. | Frisque, R. J., and F. A. White, III. 1992. The molecular biology of JC virus, causative agent of progressive multifocal leukoencephalopathy, p. 25-158. In E. R. P. Roos (ed.), Molecular neurovirology: pathogenesis of viral CNS infections. Humana Press Inc., Totowa, N.J. |
| 18. |
Gallia, L. G.,
M. Safak, and K. Khalili.
1998.
Interaction of the single-stranded DNA-binding protein Pura with the human polyomavirus JC virus early protein T-antigen.
J. Biol. Chem.
273:32662-32669 |
| 19. | Garcia-Sastre, A., A. Egorov, D. Matassov, S. Brandt, D. E. Levy, J. E. Durbin, P. Palese, and T. Muster. 1998. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 252:324-330[CrossRef][Medline]. |
| 20. | Graham, F. L., and A. J. van der Eb. 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456-467[CrossRef][Medline]. |
| 21. |
Haggerty, S.,
D. L. Walker, and R. J. Frisque.
1989.
JC virus-simian virus 40 genomes containing heterologous regulatory signals and chimeric early regions: identification of regions restricting transformation by JC virus.
J. Virol.
63:2180-2190 |
| 22. | Hay, N., D. H. Skolnik, and Y. Aloni. 1982. Attenuation in the control of SV40 gene expression. Cell 29:183-193[CrossRef][Medline]. |
| 23. | Hirt, B. J. 1967. Selective extraction of polyoma DNA from infected mouse cell culture. J. Mol. Biol. 26:365-369[CrossRef][Medline]. |
| 24. |
Hou-Jong, M. H.,
S. H. Larsen, and A. Roman.
1987.
Role of the agnoprotein in regulation of simian virus 40 replication and maturation pathways.
J. Virol.
61:937-939 |
| 25. | Jackson, V., and R. Chalkley. 1981. Use of whole-cell fixation to visualize replicating and maturing simian virus 40: identification of a new viral gene product. Proc. Natl. Acad. Sci. USA 78:6082-6085. |
| 26. | Jay, G., S. Nomura, C. W. Anderson, and G. Khoury. 1981. Identification of the SV40 agnogene product: a DNA binding protein. Nature 291:346-349[CrossRef][Medline]. |
| 27. | Kao, S.-Y., A. F. Calman, P. A. Luciw, and B. M. Peterlin. 1987. Antitermination of transcription within the long terminal repeat of HIV-1 by tat gene product. Nature 330:489-493[CrossRef][Medline]. |
| 28. |
Kenney, S.,
V. Natarajan,
D. Strike,
G. Khoury, and N. P. Salzman.
1984.
JC virus enhancer-promoter active in human brain cells.
Science
226:1337-1339 |
| 29. | Khalili, K., L. Feigenbaum, and G. Khoury. 1987. Evidence for a shift in 5'-termini of early viral RNA during the lytic cycle of JC virus. Virology 158:469-472[CrossRef][Medline]. |
| 30. |
Khalili, K.,
J. Brady,
J. Papas,
S. Spence,
M. Sadofsky, and G. Khoury.
1988.
COOH-terminal mutants of large tumor antigen of simian virus 40: a role for the early protein late in the lytic cycle.
Proc. Natl. Acad. Sci. USA
85:354-358 |
| 31. | Krynska, B., J. Otte, R. Franks, K. Khalili, and C. Croul. 1999. Human ubiquitous JCV(CY) T-antigen gene induces brain tumors in experimental animals. Oncogene 18:39-46[CrossRef][Medline]. |
| 32. |
Krynska, B.,
L. Del Valle,
S. Croul,
J. Gordon,
C. D. Katsetos,
M. Carbone,
A. Giordano, and K. Khalili.
1999.
Detection of human neurotropic JC virus DNA sequence and expression of the viral oncogenic protein in pediatric medulloblastomas.
Proc. Natl. Acad. Sci. USA
96:11519-11524 |
| 33. |
Laghi, L.,
A. E. Randolph,
D. P. Chauhan,
G. Marra,
E. O. Major,
J. V. Neel, and C. R. Boland.
1999.
JC virus DNA is present in the mucosa of the human colon and in colorectal cancers.
Proc. Natl. Acad. Sci. USA
96:7484-7489 |
| 34. | Lashgari, M., H. Tada, S. Amini, and K. Khalili. 1989. Regulation of JCVL promoter function. Transactivation of JCVL promoter by JCV and SV40 early proteins. Virology 170:292-295[CrossRef][Medline]. |
| 35. | Levy, N. D., Y. Refaeli, and D. B. Weiner. 1995. Extracellular Vpr protein increases cellular permissiveness to human immunodeficiency virus replication and reactivates virus from latency. J. Virol. 68:1243-1252. |
| 36. |
Major, E. O.,
K. Amemiya,
C. S. Tornatore,
S. A. Houff, and J. R. Berger.
1992.
Pathogenesis and molecular biology of progressive multifocal leukoencephalopathy, the JC virus-induced demyelinating disease of the human brain.
Clin. Microbiol. Rev.
5:49-73 |
| 37. |
Margolskee, R. F., and D. Nathans.
1983.
Suppression of a VP1 mutant of simian virus 40 by missense mutations in serine codons of the viral agnogene.
J. Virol.
48:405-409 |
| 38. |
Mertz, J. E.,
A. Murphy, and A. Barkan.
1983.
Mutants deleted in the agnogene of simian virus 40 define a new complementation group.
J. Virol.
45:36-46 |
| 39. | Michaud, G., A. Zachary, V. B. Rao, and L. W. Black. 1989. Membrane-associated assembly of a phage T4 DNA entrance vertex structure studied with expression vectors. J. Mol. Med. 209:667-681. |
| 40. |
Ng, S. C.,
J. E. Mertz,
S. Sanden-Will, and M. Bina.
1985.
Simian virus 40 maturation in cells harboring mutants deleted in the agnogene.
J. Biol. Chem.
260:1127-1132 |
| 41. | Perini, G., S. Wagner, and M. R. Green. 1995. Recognition of bZIP proteins by the human T-cell leukaemia virus transactivator Tax. Nature 376:602-605[CrossRef][Medline]. |
| 42. | Raj, G., and K. Khalili. 1995. Transcriptional regulation: lessons from the human neurotropic polyomavirus, JCV. Virology 213:283-291[CrossRef][Medline]. |
| 43. |
Raj, G. V., and K. Khalili.
1994.
Identification and characterization of a novel GGA/C-binding protein, GBP-i, that is rapidly inducible by cytokines.
Mol. Cell. Biol.
14:7770-7781 |
| 44. | Raj, G. V., J. Gordon, T. J. Logan, D. J. Hall, A. Deluca, A. Giordano, and K. Khalili. 1995. Characterization of glioma cells derived from polyomavirus-induced brain tumors in hamsters. Int. J. Oncol. 7:801-808. |
| 45. |
Rencic, A.,
J. Gordon,
J. Otte,
M. Curtis,
A. Kovatich,
P. Zoltick,
K. Khalili, and D. Andrews.
1996.
Detection of JC virus DNA sequence and expression of the viral oncoprotein, tumor antigen, in brain of immunocompetent patient with oligoastrocytoma.
Proc. Natl. Acad. Sci. USA
93:7352-7357 |
| 46. |
Rinaldo, C. H.,
T. Traavik, and A. Hey.
1998.
The agnogene of the human polyomavirus BK is expressed.
J. Virol.
72:6233-6236 |
| 47. |
Safak, M.,
G. L. Gallia,
S. A. Ansari, and K. Khalili.
1999.
Physical and functional interaction between the Y-box binding protein YB-1 and human polyomavirus JC virus large T antigen.
J. Virol.
73:10146-10157 |
| 48. |
Safak, M.,
G. L. Gallia, and K. Khalili.
1999.
Reciprocal interaction between two cellular proteins, Pur and YB-1, modulates transcriptional activity of JCVCY in glial cells.
Mol. Cell. Biol.
19:2712-2723 |
| 49. |
Small, J. A.,
G. Khoury,
G. Jay,
P. M. Howley, and G. M. Scangos.
1986.
Early regions of JC virus and BK virus induce distinct and tissue-specific tumors in transgenic mice.
Proc. Natl. Acad. Sci. USA
83:8288-8292 |
| 50. |
Spina, C. A.,
T. J. Kwoh,
M. Y. Chowers,
J. C. Guatelli, and D. D. Richman.
1994.
The importance of nef in the induction of human immunodeficiency virus type 1 replication from primary quiescent CD4 lymphocytes.
J. Exp. Med.
179:115-123 |
| 51. |
Strebel, K.,
T. Klimkait,
F. Maldarelli, and M. A. Martin.
1989.
Molecular and biochemical analysis of human immunodeficiency virus type 1 Vpu protein.
J. Virol.
68:3784-3791 |
| 52. | Swenson, J. J., P. W. Trowbridge, and R. J. Frisque. 1996. Replication activity of JC virus large T antigen phosphorylation and zinc finger domain mutants. J. Neurovirol. 2:78-86[Medline]. |
| 53. | Swenson, J. J., and R. J. Frisque. 1995. Biochemical characterization and localization of JC virus large T antigen phosphorylation domains. Virology 212:295-308[CrossRef][Medline]. |
| 54. |
Tada, H.,
M. Lashgari,
J. Rappaport, and K. Khalili.
1989.
Cell type-specific expression of JC virus early promoter is determined by positive and negative regulation.
J. Virol.
63:463-466 |
| 55. | Tada, H., M. S. Lashgari, and K. Khalili. 1991. Regulation of JCVL promoter function: evidence that a pentanucleotide "silencer" repeat sequence AGGGAAGGGA down-regulates transcription of the JC virus late promoter. Virology 180:327-338[CrossRef][Medline]. |
| 56. |
Terwilliger, E. F.,
E. A. Cohen,
Y. C. Lu,
J. G. Sodroski, and W. A. Hasetine.
1989.
Functional role of the human immunodeficiency virus type 1 vpu.
Proc. Natl. Acad. Sci. USA
86:5163-5167 |
| 57. | Trowbridge, P. M., and R. Frisque. 1995. Identification of three new JC virus proteins generated by alternative splicing of the early viral mRNA. J. Neurovirol. 1:195-206[Medline]. |
| 58. |
Varakis, J.,
G. M. Zu Rhein,
B. L. Padgett, and D. L. Walker.
1978.
Induction of peripheral neuroblastomas in Syrian hamsters after injection of neonates with JC virus.
Cancer Res.
38:1718-1722 |
| 59. | Walker, D. L., B. L. Padgett, G. M. ZuRhein, A. E. Albert, and R. F. Marshal. 1973. Human papovavirus (JC): induction of brain tumors in hamsters. Science 17:674-676. |
| 60. | Walker, D. L. 1978. Progressive multifocal encephalopathy: an opportunistic viral infection of the central nervous system, p. 307-329. In P. J. a. B. Vinken, and G. W. Bruyn (ed.), Handbook of clinical neurology. Elsevier North Holland, New York, N.Y. |
| 61. | Wei, P., M. E. Garber, S.-M. Fang, W. H. Fisher, and K. A. Jones. 1998. A novel CDK-9-associated C-type cyclin interacts directly with HIV-1 tat and mediates its high-affinity, loop-specific binding to TAR RNA. Cell 92:451-462[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»