INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Occlusion-derived virus (ODV) of Autographa californica nucleopolyhedrovirus (AcMNPV) initiates primary infection through gut cells of the susceptible insect, where the columnar cells are the primary sites of infection (13, 31). Columnar cells, however, are in a differentiated state (7). Thus, AcMNPV must have the ability to progress the infected columnar cell from G₀ to G₁ and further progress the cell to a phase conducive to viral DNA replication (S phase). These events occur rapidly: in virus-challenged Trichoplusia ni larvae, midgut infection is detectable by 4 h postinoculation and systemic infection is detected by 12 h (31).

Viral regulation of the host cell cycle could be accomplished through several mechanisms. One mechanism is the early transcription-translation of viral genes which interact with cellular proteins or protein complexes. Some evidence suggests that AcMNPV may be utilizing this mechanism. The ie-2 gene is sufficient to arrest transfected Sf9 cells in S phase: the arrested cells do not undergo mitosis, have abnormally large nuclei, and contain greater than 4N DNA content (19). Infected Sf9 cells, however, show only a transient increase of cells in S phase, and the cells quickly progress to G₂/M phase, where they remain arrested throughout infection (4). A second viral strategy to regulate the host cell cycle is to present, as structural components of the virus, a protein(s) or protein complexes that interact with cellular proteins immediately upon infection. For AcMNPV, the structural protein ODV-EC27 (EC27) is a candidate for such a strategy: it has amino acid similarity with cellular cyclins, and it coprecipitates with cellular cyclin kinases (1, 4). Its introduction into the cell at the time of infection may allow it to interact immediately with cellular cyclin kinases or function as a cyclin homologue in a manner analogous to that of other viral cyclin homologues. In our continuing study of the function of AcMNPV structural proteins and their interactions with host cell proteins, we have identified a new structural protein of budded virus (BV) and ODV, BV/ODV-C42 (C42; orf101), and show that this protein is present in complexes that also contain the viral proteins EC27 and p78/83.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Insect cell line and virus. Spodoptera frugiperda IPLB-Sf21-AE clonal isolate 9 (Sf9) cells were cultured in suspension at 27°C in TNMFH medium (26) supplemented with 10% fetal bovine serum and 1% pluronic F68 (complete medium). AcMNPV (strain E2) was used to infect cells at a defined multiplicity of infection (MOI), with time zero set at the time of virus addition. After 1 h of adsorption, cells were washed and resuspended in fresh, complete medium.

Primer extension. Sf9 cells were infected (MOI, 10), and mRNA was purified using the Poly(A)Pure mRNA isolation kit (Ambion, Inc., Austin, Tex.). Two oligonucleotides (PE1, 5'-GCATAGGCTCGTCTATTTTTAACCGC-3'; PE2, GTCTAACACGTTGACCGTTTCG) were 5' end labeled with T₄ polynucleotide kinase and probed against 3 µg of cellular mRNA. Extension products were generated using Superscript II reverse transcriptase (Life Technologies, Gaithersburg, Md.) in the presence of 2.3 µg of actinomycin D, 28 U of RNasin, and 0.5 mM deoxynucleoside triphosphates for 60 min at 45°C and then precipitated and digested with 0.1 N NaOH for 30 min at room temperature, resuspended in 80% formamide loading buffer, and boiled for 3 min before being loaded onto a denaturing gel (7.0 M urea, 6% polyacrylamide, 100 mM Tris-borate, 20 mM EDTA, pH 8.3). Transcript initiation sites were identified by comparison with a DNA sequence by using the same oligonucleotide primers as used for generating the extension products and run concurrently on the denaturing gel with the extension products.

Western blot analysis of infected cells, virus, and virus fractionation. Sf9 cells were infected with AcMNPV (MOI, 10), and at the indicated time postinfection (p.i.), cells were collected and washed once with phosphate-buffered saline (PBS). Cell pellets were resuspended in PBS containing protease inhibitors (20 µg of leupeptin/ml, 20 µg of aprotinin/ml, 20 µg of pepstatin A/ml, 1 mM E64). Cells were broken by sonication, and protein concentration was determined by the method of Bradford (3).

Yeast two-hybrid library construction and screen. Sf9 cells were infected (MOI, 20), and at 18 or 24 h p.i., cells were collected and mRNA was isolated by using either the Poly A Tract System 1000 (Promega, Madison, Wis.) or the Poly(A)Pure mRNA isolation kit (Ambion). The cDNA library was generated using the Two Hybrid cDNA Construction kit (Clontech, Palo Alto, Calif.), and thus, the genomic fragments were cloned into the vector pGAD10. The libraries were amplified, and the resulting titers of the amplified libraries were as follows: at 18 h p.i., 1.31 × 10¹², and at 24 h p.i., 3.25 × 10¹³. To harvest large quantities of DNA from each library, a 1-ml aliquot of amplified library was diluted and grown on 200 Luria broth-ampicillin-supplemented plates (150-mm diameter), bacteria were harvested, and plasmid DNA was purified using the Plasmid Giga kit (Qiagen, Valencia, Calif.). Transfection and chromogenic reactions were performed according to the manufacturer's protocol (Clontech).

Clones for yeast two-hybrid screens. orf144 (EC27), 1629K (p78/83), and orf101 (C42) were cloned into the yeast binding domain vector pAS2-1. Both orf144 and orf101 were amplified from genomic fragments using the appropriate PCR primers and cloned into pAS2-1 such that the inserted gene was placed in frame using the EcoRI site provided by the multicloning region. The fusion region for the EC27 clone was EFELGTRGS-Met-144, while the fusion for C42 was EFR-Met-101 (fusion amino acids E and F were provided by the EcoRI cloning site, and the first amino acid encoded by the cloned gene is underlined). The resultant insert was fully sequenced to verify frame and to assure the fidelity of the polymerase reaction. A copy of the AcMNPV E2 strain 1629K gene was provided by C. Richardson (McGill University, Montreal, Quebec, Canada [28]), and it was directly subcloned into pAS2-1. The resultant clone had the Met start provided by an NdeI site with an N-terminal His tag sequence; thus, the fusion region was MHHHHHHLVPRGSGI-Thr-1629K.

Production of antibodies. For C42, orf101 was digested from pAS2-1 (described above) and cloned into pGEX 5X-1 using a 5' EcoRI site and a 3' SalI site. The frame was established by the EcoRI site; thus, the fusion site was EFR-Met-101. The clone was transformed into BL21 cells, and protein was induced using 0.4 mM IPTG (isopropyl--D-thiogalactopyranoside) and either purified by excision from an SDS-polyacrylamide gel (denatured) or purified using glutathione-agarose beads (native) according to the manufacturer's instructions (Pharmacia Biotech, Arlington Heights, Ill.). After antigen purification, three rabbits were injected for each antigen (native or denatured). The first injection (intramuscular) was approximately 200 µg of protein diluted with RIBI adjuvant (MPL+TDM+CWS emulsion; RIBI Immunochem Research Inc., Hamilton, Mont.). Two additional injections followed at 28-day intervals, and each injection contained one-half the amount of the previous injection. Twelve days after the third injection, the sera were tested, and 2 days later, animals were exsanguinated and plasma was collected.

Microscopy. (i) Confocal analysis. Sf9 cells were infected (MOI, 10) and collected at the appropriate time. The harvested cells were washed once with Grace's medium, and 2.1 × 10⁵ cells were transferred and allowed to attach to the slide using a one-well Cytofuge concentrator (StatSpin Technologies, Norwood, Mass.). The cells were fixed with 3.7% paraformaldehyde in PBS (20 mM phosphate, 140 mM NaCl, pH 7.2) for 10 min at room temperature. The cells were washed three times with PBS, permeabilized by sequential treatments with methanol (10 min) and Triton X-100 (0.5%, 10 min), and washed three times with PBS. The cells were then blocked for 1 h with blocking solution (1% chicken serum and 3% bovine serum albumin in PBS) and incubated overnight at 4°C with primary antibody (C42; pAb 10910; 1:2,000). Primary antibody was removed by washing three times with PBS, the cells were then incubated with Alexa-488-linked anti-rabbit IgG for 2 h (1:2,000; Molecular Probes, Eugene, Oreg.) and washed three times with PBS, and DNA was stained with DAPI (4',6-diamidino-2-phenylindole; 0.1 µg/ml in PBS; 5 s). Cells were washed three times with PBS and viewed with a Zeiss Axiovert CARV 135 confocal microscope. Hundreds of cells were viewed, and approximately 15 fields of view containing 30 to 50 cells were collected, along with representative single cells. Representative cells are shown. Z-stack sections were collected at 0.75-µm intervals. Deconvolution was performed using Zeiss KS 4.0 software.

(ii) Immunoelectron microscopy (IEM). Sf9 cells were infected (MOI, 20), and virus was adsorbed for 1 h, removed, and replaced with complete medium. At the designated time p.i., cells were pelleted and fixed and ultrathin sections were prepared for antibody reactions as described by Hong et al. (11). Sections were blocked with TTBS-bovine serum albumin (1%) for 1 h, reacted with antibody (C42; pAb 10910; 1:1,000; overnight; 4°C), washed with Tris-buffered saline, and reacted with secondary anti-rabbit, gold-conjugated IgG (30 nm, 1:15 dilution; Electron Microscopy Sciences, Washington, Pa.) for 1 h at room temperature. The sections were stained with uranyl acetate (2) and lead citrate (27) and visualized with a Zeiss 10C transmission electron microscope.

Blue native gel electrophoresis. Blue native gel electrophoresis was adapted from the work of Schagger and von Jagow (24). Sf9 cells were infected (MOI, 20), collected at 28 h p.i. (2 × 10⁷ cells per sample), and washed with PBS, and the pellet was frozen until use. The pellet was resuspended in water containing 200 U of DNase I, passed through a 27-gauge needle 10 times, sonicated for 45 s, and incubated on ice for 2 h. The cells were then microcentrifuged (16,000 × g) for 10 min (4°C), and the soluble fraction (supernatant) was transferred to a fresh tube and mixed with an equal volume of 3× gel buffer (1.5 M aminocaproic acid, 150 mM Bis-Tris, pH 7.0). To remove intact viral nucleocapsids, the soluble fraction was centrifuged (100,000 × g, 30 min; Beckman TLA100, 50,000 rpm), and to further remove large protein complexes (i.e., ribosomes [30]), the soluble fraction was collected and further centrifuged (400,000 × g, 15 min; Beckman TLA100, 95,000 rpm). The supernatant was collected, and for every 200 µl of sample, 10 µl of dye was added (5% Serva Blue G, 500 mM aminocaproic acid). A linear 6 to 13% acrylamide gradient gel was generated (6%, 1.43 ml of 48:1.5 acrylamide:bisacrylamide, 4 ml of 3× gel buffer, 6.57 ml of H₂O, 38 µl of 10% ammonium persulfate, 1.2 µl of TEMED [N,N,N',N'-tetramethylethylenediamine]; 13%, 3.14 ml of acrylamide:bisacrylamide, 4 ml of 3× gel buffer, 2.4 ml of glycerol, 2.46 ml of H₂O, 38 µl of 10% ammonium persulfate, 12 µl of TEMED). After polymerization, the gel was overlaid with a 4% stack (0.6 ml of acrylamide:bisacrylamide, 2.5 ml of 3× gel buffer, 4.33 ml of H₂O, 60 µl of 10% ammonium persulfate, 6 µl of TEMED). The gel was run with the cathode buffer containing 50 mM Tricine, 15 mM Bis-Tris, and 0.02% Serva Blue G (pH 7.0) and the anode buffer containing 50 mM Bis-Tris, pH 7.0. Samples were loaded (30 µl per well) and run at a constant voltage (200 V) for 2 h, at which time the cathode buffer was discarded and replaced with the same buffer minus Serva Blue G. The gel was then run overnight at 4°C.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

orf101 is a late gene that codes for a highly conserved 42-kDa structural protein of the baculovirus nucleocapsid. A homologue of orf101 is found in all the baculovirus genome databases, including the most divergent genome, Xestia c-nigrum granulovirus (Xc-n GV). A comparison of the predicted amino acid sequences shows that several regions of the orf101 gene product are highly conserved among the nucleopolyhedroviruses (Fig. 1). Three conserved regions are significant, the N-terminal region (amino acids 1 to 45) and amino acids 130 to 200 and 280 to 360, and these regions share the highest degree of conservation with Xc-n GV. A conserved classical putative nuclear localization signal (KRKK) is located at the C terminus of all the proteins (Fig. 1, asterisk) and SOSUI analysis (10) predicts that the protein product of orf101 would be soluble. The canonical binding motif for the family of pocket proteins (pRB, p130, and p107 [reviewed in reference 9]) is found in the N-terminal conserved region of AcMNPV and Bombyx mori nucleopolyhedrovirus (LxCxE [Fig. 1, underlined]). This motif is not found in Lymantria dispar nucleopolyhedrovirus, Orgyia pseudotsugata nucleopolyhedrovirus (OpMNPV), Spodoptera exigua nucleopolyhedrovirus, Helicoverpa armigera nucleopolyhedrovirus, or Xc-n GV.

View larger version (105K): [in this window] [in a new window]   FIG. 1.   Amino acid sequence comparison of orf101. Identical amino acids of the nucleopolyhedroviruses are shaded and outlined, while conservative changes are shown in shaded regions. Because it is the most divergent, Xc-n GV C42 was treated separately, and both identical and conserved amino acids are shaded. The clones that were identified as interacting with orf144 using yeast two-hybrid library screening are noted with arrows above the sequence. The location of the LxCxE motif (canonical binding sequence for pocket proteins) is underlined, while the nuclear localization signal (KRKK) is noted with asterisks. Rules used to assign conservation are as follows: A = G = S = T, V = L = I = M = F = Y = W, N = Q = D = E, and R = K = H. Accession numbers: AcMNPV, L22858 (nucleotides 88004 to 86921); BmMNPV (B. mori nucleopolyhedrovirus), L33180 (nucleotides 81679 to 80591); OpMNPV, U79530 (nucleotides 85649 to 85485); LdMNPV (L. dispar nucleopolyhedrovirus), U58676 (nucleotides 101348 to 100203); SeMNPV (S. exigua nucleopolyhedrovirus), AF169823 (nucleotides 61806 to 62972); HaSNPV (H. armigera single nucleopolyhedrovirus), AF271059 (nucleotides 82544 to 83653); and Xc-n GV, AF162221 (nucleotides 86182 to 87300).

View larger version (58K): [in this window] [in a new window]   FIG. 2.   Primer extension analysis of orf101. Transcription initiation was mapped using 3 µg of mRNA isolated from infected-cell extracts. Two oligonucleotides were used to accurately assign nucleotide initiation sites, although only the results from oligonucleotide 1 are shown here. The initiation sites of the extension products are indicated to the right and in the sequence shown below. Because of the high degree of amino acid sequence conservation (Fig. 1), the first ATG is tentatively assigned as the start codon.

View larger version (49K): [in this window] [in a new window]   FIG. 3.   Temporal analysis of appearance and accumulation of C42. Preparations of uninfected- and infected-cell extracts collected at various times p.i. (noted above lanes 1 to 9) and purified BV and ODV and respective envelope (ENV) and nucleocapsid (CAP) preparations were separated by SDS-polyacrylamide gel electrophoresis, transferred to a PVDF membrane, and tested with antisera to C42 (pAb 10910, 1:5,000). Sample concentrations are noted on the bottom (micrograms), and migration of molecular weight (MW; in thousands) markers is noted on the right. The purity of the envelope and nucleocapsid preparations was verified using antibodies to the marker proteins ODV-E66, gp67, and p39 (data not shown).

View larger version (48K): [in this window] [in a new window]   FIG. 4.   Confocal analysis of C42 localization in infected Sf9 cells. Infected Sf9 cells were collected at 24, 48, and 72 h p.i. and reacted with primary antibody to C42 (pAb 10910) and secondary antibody labeled with Alexa-488 IgG (Alexa-488; column 1). DNA was stained using DAPI (column 2). The merged image includes Alexa-488 and DAPI (column 3), while the bright-field image shows the gross structure of the cell (column 4). Z-stack sections from representative cells are shown, and column 5 shows a single view of the three-dimensional reconstruction. The white arrow indicates the location of the virogenic stroma, while the yellow arrow (24 h p.i., columns 3 and 4) shows the cytoplasmic label of C42.

View larger version (122K): [in this window] [in a new window]   FIG. 5.   IEM analyses of C42 localization in infected Sf9 cells. Infected Sf9 cells were collected at 24, 48, and 72 h p.i. and processed for IEM. Primary antibody was C42 (pAb 10910), and secondary antibody was anti-rabbit 30-nm-gold-labeled IgG. (A) Preimmune control serum (48 h p.i.). (B and C) Labeling of virogenic stroma (48 h p.i. [B] and 72 h p.i. [C]). (D to F) Labeling of C42 at the nucleocapsid of ODV (48 h p.i.). Size designations are in micrometers. Arrows show immunogold labeling of C42.

C42 is present in a complex with p78/83 and EC27. orf101 (C42) was first drawn to our attention when a yeast two-hybrid screen of infected-cell cDNA libraries (18 and 24 h p.i.), using orf144 (EC27) as bait, identified eight interacting clones encoded by orf101 (noted in Fig. 1, arrows). In a similar screen, when 1629K (p78/83) was used as bait to probe a 24 h-p.i. Sf9 cDNA library, this screen identified orf101 (C42) seven times. Sequence analysis showed that all seven orf101 library clones started at the first methionine. To confirm the yeast two-hybrid predictions that C42:EC27 and C42:p78/83 interact directly to form complexes, we needed a procedure that would (i) identify protein interactions which occur prior to virus assembly and/or (ii) remove assembled nucleocapsids and virus, while retaining conditions that allow protein complexes to remain intact. For this, we used blue native electrophoresis. This technique separates both acidic and basic protein complexes and provides a tentative assignment of the complex's molecular mass (17, 23, 24). We chose to use a 28-h-p.i. infected-cell sample because EC27, C42, and p78/83 are present, and studies using other viral structural proteins (ODV-E66, ODV-E25, and FP25K) show that these proteins are being translated at their maximal rate (20). Figure 6A gives a summary of sample preparation. After infected cells were harvested, DNA was degraded (DNase, sonication, and shear forces), and virus, nucleocapsids (100,000 × g), and very large complexes (e.g., ribosomes, 400,000 × g [30]) were removed by sequential centrifugation. All fractions were analyzed, and C42 was detected primarily in the 400,000 × g soluble fraction (Fig. 6A, asterisk). The blue native gel analysis of this fraction is shown in Fig. 6B. A complex with an approximate molecular mass of 500 to 600 kDa which was immunoreactive with antibodies to C42 (lane 2), p78/83 (lane 4), and EC27 (lane 6) was detected. Additionally, complexes showing positive interactions between C42 and p78/83 were also detected at lower masses, with the most prominent of these being at ~180 kDa (lanes 2 and 4, circle). This experiment was repeated three times with cell extracts isolated from different infections, and the immunoreactive profiles were the same. To confirm the specificity of the interactions detected by native gel electrophoresis, we performed control antibody reactions with E66, FP25K, and E25, and none of these antibodies were detected in complexes with molecular masses corresponding to those shown in Fig. 6 (data not shown). We note that the antibody to EC27 strongly reacts to a cellular complex at approximately 140 kDa; however, we do not know the significance of this observation.

View larger version (36K): [in this window] [in a new window]   FIG. 6.   Native gel electrophoresis. (A) Summary overview of purification protocol of 28-h-p.i. infected-cell extracts. (B) The samples of the soluble fraction were separated using blue native electrophoresis, blotted onto a PVDF membrane, and probed with the indicated antibody. Arrows point to a complex containing EC27, C42, and p78/83, while the circles show a complex containing only C42 and p78/83. U, uninfected-cell lysate; I, infected-cell lysate. Approximate molecular masses are indicated on the left (kilodaltons).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Transcriptional analyses show that orf101 is a late gene with maximal levels of transcripts accumulating at 24 h p.i. (Fig. 2). This agrees with the data of Russell and Rohrmann (22) showing that, during infection by OpMNPV, p40 (orf3, the gene homologue to AcMNPV orf101) transcripts are detected at 24 h p.i., steady-state transcript levels decrease by 36 h p.i., and transcription initiates from a conserved TAAG sequence. Our study suggests that, if transcripts are made early during infection (CAGT), their steady-state levels are low and protein accumulation is not detectable (Fig. 2 and 3). orf101 encodes a protein with a relative molecular mass of 42 kDa that is a component of both BV and ODV nucleocapsid (Fig. 2 and 3). We have designated this gene product BV/ODV-C42 (C42).

C42 is conserved among baculoviruses and contains a classical nuclear localization sequence located at the C terminus (Fig. 1). Consistent with the presence of this motif, C42 is predominantly detected within the infected-cell nucleus. At 24 h p.i., C42 is associated with the virogenic stroma; by 48 h p.i., it locates at the edge of the stroma; and at later time points, it is located in a dispersed pattern throughout the nucleus which is consistent with its incorporation into ODV (Fig. 4). These observations were confirmed by IEM, which shows the localization of C42 within the virogenic stroma and the nucleocapsid of the virion (Fig. 5).

Yeast two-hybrid analysis, using orf144 as bait, identified eight interacting clones containing truncated orf101 (C42). Sequence analysis showed that these corresponded to four independent clones of orf101, and the details of these clones are shown in Fig. 1. Yeast two-hybrid screens using 1629K (p78/83) as bait also identified orf101 seven times, and sequence analysis revealed that these represented the same clone, all containing the methionine start codon for C42. To confirm that the interactions predicted by yeast two-hybrid analysis reflected interactions which occurred in vivo, blue native gel and Western blot analysis was performed using fractions prepared from infected cells (28 h p.i.). This analysis showed that C42 and p78/83 (p78/83 is also a structural protein of baculovirus [18, 21]) comigrate, consistent with complex formation, and that they are present in two complexes, a complex at 180 kDa and a larger complex (approximately 500 to 600 kDa) that also contains EC27.

The primary sequence of AcMNPV C42 contains the canonical binding motif of the pocket proteins (LxCxE). Interaction of viral proteins with pocket proteins (pRB, p130, and p107) plays an essential role in viral infectivity of other viruses. Simian virus 40 T, human papillomavirus E7, and adenovirus E1A (reviewed in reference 9) interact with pocket proteins to stimulate activity of the transcription factor E2F. Indeed, mutations within the pRB binding motif of the rubella virus gene NSP90 decreased viral DNA replication to <0.5%, while deletion of the motif was lethal (8). If such a mechanism is utilized by baculoviruses, one might predict that the pocket protein binding motif of C42 would be conserved among all baculoviruses; however, genome sequences show that this is not the case (Fig. 1). Thus, if C42 functionally interacts with pocket proteins, it is possible that it also performs other functions, that this function is host specific, or that other viruses and/or viral genes encode proteins with analogous function. Other examples of control of cell cycle and viral DNA replication by viruses include the coding of cellular cyclin homologues. Human herpesvirus (k-cyclin [6]), herpesvirus saimiri (v-cyclin [12]), murine gammaherpesvirus 68 (m-cyclin [29]), and walleye fish dermal sarcoma retrovirus (16) all encode cyclin-like proteins. The viral k- and v-cyclins complex with cdk6, increase the resistance of cyclin-dependent kinases to inhibitors, and enhance substrate range, and the viral cyclin-cdk6 complex directly triggers the initiation of DNA synthesis in isolated late-G₁ nuclei (15).

It is possible that C42, EC27, and p78/83 together, or individually, interact with cellular components to generate an S-phase-like environment and stimulate in vivo DNA replication. Like the putative interaction of EC27 with cellular cyclin kinases, interaction of C42 with the pocket family of proteins would be a good candidate for regulation of the cell cycle and may play a direct role in viral DNA replication in vivo. Current studies are focused on more fully understanding the nature and function of the viral protein complexes containing EC27, C42, and p78/83 and determining if C42 functionally interacts with pocket proteins. Such interactions would strongly suggest that AcMNPV presents proteins (as part of its structural composition) that interact with cellular regulatory proteins immediately upon infection. These interactions likely play a critical role in regulating the cell cycle and enhancing viral infectivity.