Previous Article | Next Article 
Journal of Virology, December 2001, p. 12169-12181, Vol. 75, No. 24
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.24.12169-12181.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Matrix Protein and Another Viral Component
Contribute to Induction of Apoptosis in Cells Infected with
Vesicular Stomatitis Virus
Sarah A.
Kopecky,1,*
Mark C.
Willingham,2 and
Douglas
S.
Lyles1
Department of Microbiology and
Immunology1 and Department of
Pathology,2 Wake Forest University School of
Medicine, Winston-Salem, North Carolina 27157-1064
Received 22 June 2001/Accepted 18 September 2001
 |
ABSTRACT |
The induction of apoptosis in host cells is a prominent cytopathic
effect of vesicular stomatitis virus (VSV) infection. The viral matrix
(M) protein is responsible for several important cytopathic effects,
including the inhibition of host gene expression and the induction of
cell rounding in VSV-infected cells. This raises the question of
whether M protein is also involved in the induction of apoptosis. HeLa
or BHK cells were transfected with M mRNA to determine whether M
protein induces apoptosis when expressed in the absence of other viral
components. Expression of M protein induced apoptotic morphological
changes and activated caspase-3 in both cell types, indicating that M
protein induces apoptosis in the absence of other viral components. An
M protein containing a point mutation that renders it defective in the
inhibition of host gene expression (M51R mutation) activated little, if
any, caspase-3, while a deletion mutant lacking amino acids 4 to 21 that is defective in the virus assembly function but fully functional in the inhibition of host gene expression was as effective as wild-type
(wt) M protein in activating caspase-3. To determine whether M protein
influences the induction of apoptosis in the context of a virus
infection, the M51R M protein mutation was incorporated onto a wt
background by using a recombinant infectious cDNA clone (rM51R-M
virus). The timing of the induction of apoptosis by rM51R-M virus was
compared to that by the corresponding recombinant wt (rwt) virus and to
that by tsO82 virus, the mutant virus in which the M51R
mutation was originally identified. In HeLa cells, rwt virus induced
apoptosis faster than did rM51R-M virus, demonstrating a role for M
protein in the induction of apoptosis. In contrast to the results
obtained with HeLa cells, rwt virus induced apoptosis more slowly than
did rM51R-M virus in BHK cells. This indicates that a viral component
other than M protein contributes to induction of apoptosis in BHK cells
and that wt M protein acts to delay induction of apoptosis by the other
viral component. tsO82 virus induced apoptosis more
rapidly than did rM51R-M virus in both HeLa and BHK cells. These two
viruses contain the same point mutation in their M proteins, suggesting
that sequence differences in genes other than that for M protein affect
their rates of induction of apoptosis.
 |
INTRODUCTION |
The induction of apoptosis in host
cells is an important aspect of viral pathogenesis in many virus
systems (33). One of the key questions to be addressed is
which viral components induce apoptosis in virus-infected cells.
Vesicular stomatitis virus (VSV), the prototype rhabdovirus, was an
early example of a virus that was shown to induce the morphological
changes and DNA fragmentation associated with apoptosis
(20). Many of the cytopathic effects of VSV infection have
been attributed to the activity of the viral matrix (M) protein. For
example, M protein plays a major role in the inhibition of host gene
expression (5, 6, 12, 30) and in the induction of cell
rounding (7, 26) that are characteristic of VSV-infected
cells. M protein is a structural component of the virion and performs
several important functions in virus assembly. However, the functions
of M protein in virus assembly are genetically separable from its role
in cytopathogenesis (6, 26). The involvement of M protein
in the cytopathic effects of VSV infection raises the question of
whether M protein is also involved in the induction of apoptosis.
M protein affects several important cellular processes, whose
inhibition could contribute to the induction of apoptosis, both in
VSV-infected cells and when expressed in transfected cells in the
absence of other viral components. For example, M protein inhibits
transcription by all three host RNA polymerases (1). In
the case of host RNA polymerase II, the target of the inhibition was
identified as transcription factor TFIID (38, 39). M
protein also blocks nucleocytoplasmic transport of RNAs and proteins
that are dependent on Ran guanosine triphosphatase (17).
Recently, M protein has been shown to interact with one or more nuclear pore components, including the nucleoporin Nup98 (31, 36). This interaction appears to account for M protein-induced inhibition of
nucleocytoplasmic transport. M protein has also been shown to cause
cell rounding in the absence of other viral components and is the only
viral component that causes cell rounding at early times postinfection
(7). Cell rounding induced by M protein involves
disruption of all three types of cytoskeletal elements, including
actin, vimentin, and tubulin (26). M protein interacts with tubulin in vitro and tubulin coimmunoprecipitates with M protein
from VSV-infected cells, suggesting that an in vivo interaction between
tubulin and M protein may contribute to cell rounding (29).
The goal of the experiments presented here was to determine whether M
protein is involved in the induction of apoptosis by VSV. This was
addressed by expressing M protein in the absence of other viral
components and by using mutant M proteins that are either defective in
the inhibition of host gene expression or in viral assembly functions
(6). Our results demonstrate that M protein induces
apoptosis when expressed in the absence of other viral components. The
induction of apoptosis by M protein was genetically correlated with its
ability to inhibit host gene expression and not with its virus assembly
functions. The influence of M protein on the induction of apoptosis in
the context of a virus infection was tested by using viruses containing
a mutant M protein that was defective in the ability to inhibit host
gene expression and in the ability to induce apoptosis. In HeLa cells, VSV M protein mutants induced apoptosis more slowly than did the wild-type (wt) strains from which they were derived. This indicates that M protein is an important inducer of apoptosis in VSV-infected HeLa cells. However, in BHK cells, the VSV M protein mutants induced apoptosis more rapidly than did wt VSV. This indicates that a viral
component other than M protein contributes to the induction of
apoptosis by VSV in BHK cells and that wt M protein acts to delay
induction of apoptosis by the other viral component. Thus, both M
protein and another viral component contribute to the induction of
apoptosis in cells infected with VSV.
 |
MATERIALS AND METHODS |
Cells and viruses.
BHK cells and HeLa cells were cultured in
Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine
serum (FBS). wt VSV (Indiana serotype, Orsay strain) and the
tsO82 virus were grown in BHK cells as previously described,
except that tsO82 virus was grown at 31°C
(27). The infectious VSV cDNA clone previously described
(37) was modified to contain three additional restriction
sites to facilitate cloning of M gene mutations. The new
sites were introduced into an XbaI-KpnI fragment
containing the M gene by PCR mutagenesis as previously
described (34). The new sites (underlined) and the
surrounding sequences (positive sense) were SpeI
(5'CTGTAGACTAGTACGTACTATGAAAAAAA3'),
AflII
(5'GAGTTCCTTAAGGAAGATTCTC3'), and
AscI (5'TCTCCTAATTGGCGCGCCTCTCGAACAAC3').
Recombinant virus was isolated from the modified cDNA clone as
previously described and was designated rwt virus (21,
37). The M51R mutation was introduced into the M gene
of the modified cDNA clone as previously described (6),
and the virus isolated from this cDNA was designated rM51R-M virus.
Stocks were prepared from recombinant viruses that were plaque isolated
twice, and the sequences of their M genes were confirmed by
automated DNA sequencing of reverse transcription-PCR products prepared
as previously described (6). For individual experiments,
infections were performed with a multiplicity of infection (MOI) of 20 PFU/cell in DMEM containing 2% FBS.
Fluorescence microscopy.
Plasmids encoding M protein and
enhanced green fluorescent protein (EGFP) were used for in vitro
transcription of mRNA as previously described by using a commercial
kit (Message Machine; Ambion, Inc.) (4). The resulting
mRNAs contained 5' caps and 3' poly(A) sequences that enhance
expression in transfected cells. BHK cells were grown in 35-mm-diameter
dishes to about 50% confluency and cotransfected with 1 µg of M
mRNA and 1 µg of EGPF mRNA or transfected with 1 µg of EGPF
mRNA alone by using Lipofectin reagent as previously described
(4). At 24 h posttransfection, the media were
replaced with HEPES-buffered saline (HBS). The cells were analyzed by
fluorescence microscopy using a 25× water immersion objective. The
fluorescein channel was used to detect the presence of EGFP to indicate
transfected cells.
Caspase-3 activity assay.
HeLa or BHK cells were grown in
24-well plates to about 50% confluency and were either transfected
with M mRNAs or infected with wt and M mutant viruses. For Fig. 2,
cells were transfected with 300 ng of yeast RNA (control), 300 ng of
EGFP mRNA (control), 30 ng of wt M mRNA, 30 ng of MN1 M
mRNA, or 300 ng of M51R-M mRNA for 24 h. The total amount
of RNA transfected was held constant at 300 ng in all samples with the
addition of yeast RNA. For Fig. 3, HeLa or BHK cells were transfected
with the amount of M mRNA indicated and for the times indicated
with the total amount of RNA transfected held constant at 300 ng in all
samples with the addition of yeast RNA. The cells were lysed, and
caspase-3 activity was determined by using a fluorogenic substrate
(DVED-AFC; R&D Systems, Inc.) in accordance with the protocol supplied
by the manufacturer. Each sample was incubated for 2 h with the
peptide substrate for caspase-3, and the reaction was stopped by the
addition of 900 µl of 10 mM Tris-10 mM NaCl, pH 8.1. Fluorescence
intensities were measured at excitation and emission wavelengths of 400 and 490 nm, respectively, and compared to standards of
7-amino-4-trifluoromethyl-coumarin at known concentrations.
Time lapse microscopy.
BHK and HeLa cells were grown to
about 50% confluency in 25-cm flasks and infected at an MOI of 20 PFU/cell. Each flask was placed on a rocker for 30 min at room
temperature and then placed on the stage of a Zeiss inverted Axiovert
phase-contrast time lapse microscopy system equipped with an incubator
containing an atmosphere of 5% CO2 and a
temperature of 37°C as previously described (8). The
progression of the cells was followed with phase-contrast time lapse
microscopy using a Dage MTI-100 video camera affixed to the microscope
at a time lapse ratio of 600:1. The time when each of 50 to 130 cells
entered apoptosis was determined from a time-date generator record on
the videotape. Images for Fig. 3 were digitized and captured from the
videotape record.
Fluorescence time lapse microscopy was performed to determine the fate
of cells expressing M protein and EGFP. BHK or HeLa cells were
transfected with M and EGPF mRNAs or EGPF mRNA alone as
described above. Five hours posttransfection, when sufficient EGFP was
being expressed to be viewed by fluorescence microscopy, the dish was
placed in the microscope incubator. A fluorescence image was recorded
to determine which cells were transfected. The progression of the cells
was then followed with phase-contrast time lapse microscopy. Additional
fluorescence images were taken at 24 h posttransfection.
Cell membrane permeability assay.
BHK or HeLa cells grown in
six-well dishes to about 60% confluency were infected at an MOI of 20 PFU/cell. At the time points indicated in Fig. 5, the cells were washed
with HBS and 4 µmol of ethidium homodimer-1 (Molecular Probes, Inc.)
was added to each sample for 15 min to label cells with permeable cell
membranes. The cells were washed three times with HBS and harvested by
lifting with trypsin and then adding DMEM containing 10% FBS. Each
sample was filtered and analyzed by flow cytometry using a
Becton-Dickinson FACStar Plus flow cytometer. The percentage of intact
cells that had permeable cell membranes was determined by using
CellQuest software (Becton-Dickinson, Inc.). It was noted that
VSV-infected cells underwent a slight increase in permeability to
ethidium homodimer-1 at early times postinfection, when the cells were still alive. Dead cells were clearly resolved as a separate population with much higher fluorescence intensity. The flow cytometry analysis was gated by forward and side scatter so that only intact cells were
analyzed. In order to account for the cells that disintegrated and
could not be analyzed by flow cytometry, intact cells were counted in a
Coulter counter. For each time point, uninfected cells were lifted and
fixed with 4% formaldehyde at the same time that another cell sample
was infected, so that the original number of infected cells could be
determined. Infected cells corresponding to each time point were fixed
at the end of the experiment. All of the cells were counted, and the
number of cells that disintegrated was determined by subtracting the
number of intact infected cells from the number of uninfected cells at
each time point. The total percentage of dead cells was calculated by
adding the percentage of intact cells labeled with ethidium homodimer-1
using flow cytometry to the percentage of cells that disintegrated as
measured by the Coulter counter.
Viral growth rate.
HeLa and BHK cells were grown in
60-mm-diameter dishes to about 90% confluency and infected at an MOI
of 20 PFU/cell. One hour postinfection, the medium was aspirated and
the cells were washed three times with phosphate-buffered saline
and refed with 5 ml of DMEM with 2% FBS. At each time point, 100-µl
aliquots were removed from each plate and stored at
70°C. Titers of
infectious virus released from the cells were determined by plaque
assay with BHK cells.
Rate of viral protein synthesis.
BHK and HeLa cells were
grown in six-well dishes to about 90% confluency and infected at an
MOI of 20 PFU/cell. At 4, 8, and 12 h postinfection, cells were
labeled with [35S]methionine as previously
described (6). Cells were solubilized with 0.3 ml of 2%
sodium dodecyl sulfate (SDS) disruption buffer. The DNA in the samples
was sheared in a syringe with a 26-gauge needle, and the proteins were
resolved by SDS-polyacrylamide gel electrophoresis (PAGE) on 10%
polyacrylamide gels. The gels were fixed, dried, and analyzed by
phosphorescence imaging. The radioactivity of the M protein bands was
quantified with ImageQuant software (Molecular Dynamics, Inc.).
 |
RESULTS |
M protein induces apoptosis in the absence of other viral
components.
BHK or HeLa cells were transfected with in
vitro-transcribed M mRNA to determine whether they undergo the
characteristic morphological and biochemical changes associated with
apoptosis. Cells were transfected with M mRNA rather than plasmid
DNA containing the M gene because M protein inhibits its own
expression from DNA vectors that depend on host transcriptional
activity (5). Cells were cotransfected with mRNA
encoding EGFP so transfected cells could be distinguished from
nontransfected cells by fluorescence microscopy. Fluorescence images of
transfected BHK cells obtained at 24 h posttransfection are shown
in Fig. 1. Control BHK cells transfected
with EGFP mRNA retained their normal elongated morphology (Fig.
1A). BHK cells cotransfected with M mRNA and EGFP mRNA showed the characteristic round morphology of cells expressing M protein (Fig.
1B). The cell in panel B denoted by the arrow appears to be undergoing
membrane blebbing, a key morphological change associated with the
induction of apoptosis. In cells undergoing apoptosis, membrane
blebbing is followed by a period of cessation of membrane activity.
Thus, it is possible that all of the transfected cells in Fig. 1B were
apoptotic, but most of the cells had undergone membrane blebbing
earlier and had already ceased membrane activity. Indeed, time lapse
microscopy demonstrated that all of the BHK cells transfected with M
mRNA underwent membrane blebbing between 10 and 26 h
posttransfection (data not shown). Membrane blebbing was not observed
in control cells transfected with EGFP mRNA alone. Similar results
were obtained with HeLa cells cotransfected with M and EGFP mRNAs
(data not shown). These results suggest that M protein induces cells to
undergo apoptosis when it is expressed in the absence of other viral
components.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 1.
M protein expression induces morphological changes
associated with apoptosis. BHK cells were transfected with EGPF
mRNA (A) or M mRNA and EGPF mRNA (B). At 24 h
posttransfection, cells were analyzed by fluorescence microscopy using
a 25× water immersion objective. The fluorescein channel was used to
detect the presence of EGFP to indicate transfected cells. Digital
fluorescence images of transfected cells expressing EGFP are shown in
both panels. the arrow in panel B indicates a cell undergoing membrane
blebbing.
|
|
The induction of apoptosis by M protein was confirmed by assaying the
activity of caspase-3 in cells transfected with M mRNA.
Caspase-3
activity was chosen as an indicator of apoptosis because
most apoptotic
pathways involve the activation of caspase-3, while
necrotic death is
typically not associated with the activation
of caspases. HeLa cells
(Fig.
2A) or BHK cells (Fig.
2B) were
transfected with mRNA encoding wt M protein. Cells were also
transfected
with mRNAs encoding mutant M proteins to determine
whether the
induction of apoptosis was genetically correlated with the
virus
assembly functions of M protein or with its ability to inhibit
host gene expression. A mutant M protein containing a substitution
of
arginine for methionine at position 51 of the 229-amino-acid
M protein
(M51R mutation) is defective in the ability to inhibit
host gene
expression but is fully functional in virus assembly
(
6,
9,
12,
19,
26). In contrast, an M protein deletion
mutant, MN1, missing
amino acids 4 to 21 is defective in the virus
assembly functions but
inhibits host gene expression and causes
cell rounding as effectively
as does wt M protein (
6,
26).
Cells were also transfected
with yeast RNA or EGFP mRNA as negative
controls. Twenty-four hours
posttransfection, the cells were lysed
and caspase-3 activity was
determined with a fluorogenic substrate.
In these experiments, we used
an amount of wt or MN1 M mRNA (30
ng per culture) that was 10-fold
less than that of M51R-M or EGFP
mRNA (300 ng per culture) in order
to achieve comparable levels
of protein expression. This is because the
cytopathic activity
of wt and MN1 M proteins enhances translation of
transfected mRNAs
(
4). The enhanced expression from
transfected mRNA of wt M
protein compared to that of the M51R-M
protein described previously
(
26) was reconfirmed during
the course of these experiments
(data not shown). The level of M
protein expression in these experiments
was approximately 1,000-fold
lower than that in VSV-infected cells
(
27).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Caspase-3 activity in cells expressing wt and mutant M
proteins. HeLa (A) or BHK (B) cells were transfected with 300 ng of
yeast RNA (control), 300 ng of EGFP mRNA (control), 30 ng of wt M
mRNA, 30 ng of MN1 M mRNA, or 300 ng of M51R-M mRNA.
Transfection with these amounts of mRNA has been shown to result in
comparable levels of expression of the wt and mutant M proteins
(26). At 24 h posttransfection, the cells were lysed
and caspase-3 activity was measured with a fluorogenic substrate. The
amount of caspase-3 activated is expressed in arbitrary fluorescence
units. The data represent the average ± the standard deviation of
four experiments.
|
|
Expression of wt M protein induced activation of caspase-3 in both HeLa
cells (Fig.
2A) and BHK cells (Fig.
2B), indicating
that M protein can
induce apoptosis in the absence of other viral
components. Expression
of MN1 mutant M protein, which is defective
in viral assembly functions
such as membrane budding, induced
levels of caspase-3 comparable to
those obtained with wt M protein
in both cell types. In contrast,
expression of the M51R mutant
M protein activated little, if any,
caspase-3 in either cell type.
These data indicate that the M51R mutant
M protein, which is defective
in the ability to inhibit host gene
expression, is also defective
in the ability to induce apoptosis. Thus,
the induction of apoptosis
by M protein is genetically correlated with
the inhibition of
host gene expression and not with its virus assembly
functions.
M protein expression resulted in higher levels of caspase-3 activity in
HeLa cells than in BHK cells. This is apparent from
the difference in
the scales of the
y axes of Fig.
2A and B. wt
M protein
activated 10.4-fold higher levels of caspase-3 than
did the EGFP
control in HeLa cells but only 2.7-fold higher levels
in BHK cells.
This indicates that HeLa cells are more sensitive
to caspase-3
activation by M protein than are BHK
cells.
To determine whether the difference in the levels of caspase-3
activation in HeLa and BHK cells was dependent on the amount
of M
mRNA transfected or the time of transfection, the concentration
dependence and time course of M protein-induced apoptosis were
determined in both cell types. Figure
3A
shows the results of
transfection of HeLa cells (open circles) and BHK
cells (closed
circles) with different amounts of M mRNA ranging
from 0 to 300
ng. Twenty-four hours posttransfection, the cells were
lysed and
caspase-3 activity was determined with a fluorogenic
substrate.
Expression of M protein induced caspase-3 activation over
similar
titration ranges in both cell types. Figure
3B shows a time
course
of caspase-3 activation after transfection of HeLa cells (open
circles) and BHK cells (closed circles) with 30 ng of M mRNA.
Significant activation of caspase-3 began at about 18 h
posttransfection
in both cell types and continued throughout the
duration of the
time course. The levels of caspase-3 activity in BHK
cells were
approximately threefold less than in HeLa cells in these
experiments.
Thus, the difference in the levels of caspase-3 activity
induced
by M protein in HeLa cells versus BHK cells was not dependent
on the amount of M mRNA transfected or the time posttransfection
at
which the cells were analyzed.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
M protein expression induces activation of caspase-3.
(A) HeLa cells (open circles) or BHK cells (closed circles) were
transfected with the indicated amounts of M mRNA for 24 h. The
cells were analyzed for caspase-3 activity as described in the legend
to Fig. 2. The amount of caspase-3 activated is expressed in arbitrary
fluorescence units. (B) BHK cells (closed circles) or HeLa cells (open
circles) were transfected with 30 ng of M mRNA for the indicated
times. Cells were lysed and assayed for caspase-3 activity. The data
represent the average ± the standard deviation of three
experiments.
|
|
M protein and another viral component contribute to induction of
apoptosis in cells infected with VSV.
The conclusion that M
protein can induce apoptosis in the absence of other viral components
raises the question of whether M protein is also involved in induction
of apoptosis in the context of a virus infection. This question was
addressed by using viruses containing the M51R mutation. The M51R
mutation was originally identified in the M protein of tsO82
virus, but it was not known at the time whether the tsO82
virus contained additional mutations in genes other than M.
To address this possibility, the M51R mutation was introduced onto the
wt background of an infectious VSV cDNA clone. The recombinant virus
containing the mutation was designated rM51R-M virus, and its
properties were compared to those of the corresponding rwt virus.
Likewise, the tsO82 virus was compared to the wt Orsay (wtO)
strain from which it was derived.
Time lapse microscopy was used to determine the timing of morphological
changes associated with the induction of apoptosis
by wt and M protein
mutant viruses. Cells undergoing apoptosis
proceed through a
characteristic sequence of morphological changes
beginning with cell
rounding followed by membrane blebbing. This
is followed by a period of
cessation of membrane activity. The
final stages of apoptosis involve
the protrusion of thin surface
microspikes, cell surface blistering,
and membrane rupture. Examples
of these morphological changes can be
seen in Fig.
4, which shows
images
obtained by phase-contrast time lapse microscopy of HeLa
or BHK cells
infected with wtO virus. Figure
4A to C show the
same field containing
HeLa cells infected with wtO virus at various
times postinfection. At
early times postinfection (e.g., 4 h,
panel A), the only cells
that were round were those undergoing
mitosis (cells 1 and 2). Cells
entering mitosis during the first
few hours postinfection, such as
cells 1 and 2, regained their
flattened morphology upon completion of
mitosis (data not shown).
When VSV-infected HeLa cells entered
apoptosis, cell rounding
was closely followed by the onset of membrane
blebbing. This is
evident in panel B (9.5 h postinfection), in which
cells 3 and
4 were undergoing membrane blebbing. The other round cells
in
the field had undergone membrane blebbing previously and had ceased
membrane activity by this point. By 15.5 h postinfection (panel
C), all of the cells were round and cells 3 and 4 had ceased membrane
blebbing. There were noticeable apoptotic bodies surrounding cell
3, and cells 5 to 7 were undergoing membrane blistering, which
is a late
stage of apoptosis that precedes membrane rupture.

View larger version (158K):
[in this window]
[in a new window]
|
FIG. 4.
Time lapse microscopy analysis of morphological changes
in VSV-infected cells. HeLa cells (A to C) or BHK cells (D to F) were
infected with wtO virus and then analyzed by phase-contrast time lapse
microscopy. Digital images of the same fields captured at different
times postinfection are shown. The images of infection of HeLa cells
were taken at 4 h (A), 9.5 h (B), and 15.5 h (C). The
images of infection of BHK cells were taken at 0.5 h (A), 11 h (B), and 18 h (C). Numbered cells were chosen to illustrate cell
rounding due to mitosis (cells 1 and 2), membrane blebbing (cells 3, 4, 8, 9, and 10), and cell blistering due to apoptosis (cells 5, 6, and
7), and a BHK cell that remained elongated at a late time postinfection
(cell 11).
|
|
A similar pattern of morphological changes was observed in BHK cells
infected with VSV (Fig.
4D to F), with the exception
that in BHK cells,
membrane blebbing did not always immediately
follow cell rounding.
Cells 8 to 10 are examples of BHK cells
that were elongated at early
times postinfection (Fig.
4D), underwent
membrane blebbing at 11 h
postinfection (Fig.
4E), and ceased
membrane activity by 18 h
postinfection (Fig.
4F). In contrast
to HeLa cells, a few BHK cells
remained elongated at late times
postinfection (e.g., cell
11).
In order to compare apoptosis induced by wt VSV and M protein mutant
viruses, time lapse microscopy was used to quantify the
timing of the
induction of apoptosis in cells infected with each
of the different
viruses. The time at which each of 50 to 130
cells in the field entered
apoptosis was determined from the time-date
record on the videotape.
The data were expressed as the cumulative
percentage of cells that had
entered apoptosis as a function of
time postinfection. The onset of
membrane blebbing, rather than
cell rounding, was chosen as the
criterion for the time of entry
into apoptosis because of the
possibility that M protein has cell
rounding activity that is
independent of the induction of
apoptosis.
Figure
5 shows the time lapse microscopy
results obtained with HeLa cells (panels A and B) and BHK cells (panels
C and D)
infected with wt VSV and M protein mutant viruses. Panels A
and
C show results obtained with the recombinant viruses derived from
cDNA clones, and panels B and D show results obtained with viruses
derived from the Orsay strain. HeLa cells infected with rwt virus
entered apoptosis rapidly so that nearly all of the cells had
entered
apoptosis by 16 h postinfection (Fig.
5A, closed squares).
The
rM51R-M virus (open squares) induced apoptosis more slowly
in HeLa
cells, so that about 10% of the cells had entered apoptosis
by 16 h postinfection. These data indicate that the effect of
wt M protein is
to accelerate cell death in HeLa cells. Results
of similar experiments
performed with BHK cells contrast markedly
with those obtained with
HeLa cells. In the first 12 h postinfection,
about 15% of the BHK
cells infected with rwt virus entered apoptosis
(Fig.
5C, closed
squares) while few cells infected with rM51R-M
virus showed apoptotic
changes by this time (open squares). However,
the majority of BHK cells
infected with rwt virus entered apoptosis
more slowly than did cells
infected with rM51R-M virus. These
results indicate that another viral
component is the main inducer
of apoptosis in BHK cells and that the
effect of wt M protein
is to delay apoptosis induced by this other
viral component in
most BHK cells. The prolonged period of induction of
apoptosis
by rwt virus in BHK cells resulted in a graph that was less
sigmoid
shaped than the others in Fig.
5. Similar results have been
obtained
with other cell types undergoing VSV-induced apoptosis in
which
M protein delays apoptosis (data not shown).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Induction of apoptosis in cells infected with wt VSV and
VSV M gene mutants. HeLa cells (A and B) or BHK cells (C
and D) were infected with rwt virus (closed squares), rM51R-M virus
(open squares), wtO virus (closed circles), or tsO82
virus (open circles) and analyzed by time lapse microscopy as described
in the legend to Fig. 4. The time at which each of 50 to 130 cells
entered apoptosis was determined from the time-date record on the
videotape. Data shown are the cumulative percentage of cells entering
apoptosis as a function of time postinfection. The data represent an
average of two experiments.
|
|
There was little difference in the timing of the induction of apoptosis
in HeLa cells between the wtO and
tsO82 viruses (Fig
5B).
Particularly noteworthy is the fact that cells infected with
tsO82 virus (Fig.
5B, open circles) entered apoptosis more
rapidly
than did cells infected with rM51R-M virus (Fig.
5A, open
squares).
In the case of BHK cells, most of the cells entered apoptosis
more slowly when infected with wtO virus (Fig.
5D, closed circles)
than
when infected with
tsO82 virus (open circles), similar to
the results obtained with the recombinant viruses (Fig.
5C), supporting
the hypothesis that another viral component induces apoptosis
in BHK
cells and the effect of wt M protein is to delay apoptosis
in most
VSV-infected BHK
cells.
The differences in the induction of apoptosis between viruses with wt
versus mutant M proteins were confirmed by assaying
the activity of
caspase-3. Figure
6 shows the results
obtained
with HeLa cells (panels A and B) and BHK cells (panels C and
D)
infected with the wt and M protein mutant viruses. Panels A and
C
show results obtained with the recombinant viruses derived from
cDNA
clones, and panels B and D show results obtained with viruses
derived
from the Orsay strain. rwt virus (Fig.
6A, closed squares)
induced
caspase-3 activity in HeLa cells more rapidly than did
the rM51R-M
virus (open squares). For example, 50% of maximum
activity was induced
by rwt virus by approximately 14 h postinfection,
compared to
20 h postinfection with rM51R-M virus. These results
support the
conclusion that the effect of wt M protein is to accelerate
cell death
in HeLa cells, similar to the results obtained with
time lapse
microscopy (Fig.
5).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
Caspase-3 activity in cells infected with wt VSV and VSV
M gene mutants. HeLa cells (A and B) or BHK cells (C and
D) were infected with rwt virus (closed squares), rM51R-M virus (open
squares), wtO virus (closed circles), or tsO82 virus
(open circles) for the times indicated. Duplicate samples were analyzed
for caspase-3 activation as described in the legends to Fig. 2 and 3.
The amount of caspase-3 activated is expressed as arbitrary
fluorescence units. The data represent the average ± the standard
deviation of three experiments.
|
|
Results of experiments performed with BHK cells contrast markedly with
those obtained with HeLa cells. Infection with rM51R-M
virus (Fig.
6C,
open squares) activated much higher levels of
caspase-3 than did
infection with rwt virus (Fig.
6C, closed squares).
These results
indicate that another viral component is the main
inducer of apoptosis
in BHK cells and that the effect of wt M
protein is to inhibit
activation of caspase-3 by this other viral
component. These results
are also consistent with the results
obtained with time lapse
microscopy (Fig.
5).
wtO virus (Fig.
6B, closed circles) induced caspase-3 activity in HeLa
cells more rapidly than did
tsO82 virus (open circles),
supporting the conclusion that wt M protein accelerates the induction
of apoptosis in HeLa cells. The difference in the timing of the
induction of apoptosis between wtO virus and
tsO82 virus was
more
pronounced when measured by activation of caspase-3 (Fig.
6B)
compared to the onset of membrane blebbing (Fig.
5B). In BHK cells,
tsO82 virus (Fig.
6D, open circles) induced more caspase-3
activity
than did wtO virus (closed circles), similar to the results
obtained
with time lapse microscopy (Fig.
5). These results further
support
the conclusion that another viral component induces apoptosis
in BHK cells and the effect of wt M protein is to delay apoptosis
in
VSV-infected BHK cells. In HeLa cells infected with wtO virus
and BHK
cells infected with
tsO82 virus, the level of caspase-3
declined at late times postinfection. We attribute this to a loss
of
caspase-3 following the loss of membrane integrity during cell
death.
The time lapse microscopy and caspase-3 results were further confirmed
by flow cytometry experiments that quantified cell
death induced by
M gene mutant viruses and their wt controls.
Infected cells
were labeled with ethidium homodimer-1, a fluorescent
dye that
penetrates cells with permeable cell membranes, thus
making it a marker
for dead cells. The percentage of labeled cells
was determined by flow
cytometry, which was gated so that only
intact cells were analyzed. In
order to account for the cells
that had died and disintegrated and
therefore were not analyzed
by flow cytometry, intact infected cells
were counted in a Coulter
counter. For each time point, uninfected
cells were lifted and
fixed at the same time that another cell sample
was infected,
so that the original number of infected cells could be
determined.
The number of cells that disintegrated was determined by
subtracting
the number of intact infected cells from the number of
uninfected
cells at each time point. The total percentage of dead cells
was
calculated by adding the percentage of cells labeled with ethidium
homodimer-1 to the percentage of cells that disintegrated as measured
by the Coulter counter. Figure
7 shows
the time course of cell
death induced by wt VSV and
M gene
mutant viruses in HeLa cells
(panels A and B) and BHK cells (panels C
and D). rwt virus effectively
killed HeLa cells so that nearly all of
the cells were dead by
24 h postinfection (Fig.
7A, closed
squares). The rM51R-M virus
(open squares) was much less effective than
rwt virus in killing
HeLa cells so that fewer than half of the cells
were dead at 24
h postinfection. These results support the
conclusion that the
effect of wt M protein is to accelerate cell death
in HeLa cells,
similar to the conclusions from time lapse microscopy
(Fig.
5)
and caspase-3 activation (Fig.
6). There was little difference
in cell killing between wtO virus (Fig.
7B, closed circles) and
tsO82 virus (open circles).
tsO82 virus induced
cell death at
a greater rate than did rM51R-M virus, even though both
viruses
contain the M51R mutation in their M proteins, supporting the
hypothesis that there is more than one component that contributes
to
the death of VSV-infected cells. This result is also similar
to the
results obtained with time lapse microscopy.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 7.
Induction of cell death by wt VSV and VSV
M gene mutants as measured by membrane permeability.
HeLa cells (A and B) or BHK cells (C and D) were infected with rwt
virus (closed squares), rM51R-M virus (open squares), wtO virus (closed
circles), or tsO82 virus (open circles). Duplicate
samples were labeled with ethidium homodimer-1 and analyzed by flow
cytometry. The percentage of intact cells that had permeable cell
membranes was determined by using CellQuest software. In order to
account for the cells that disintegrated and could not be analyzed by
flow cytometry, intact cells were counted in a Coulter counter. For
each time point, uninfected cells were lifted and fixed with 4%
formaldehyde at the same time that another cell sample was infected.
Infected samples corresponding to each time point were fixed at the end
of the experiment. All of the cells were counted, and the number of
cells that disintegrated was determined by subtracting the number of
intact infected cells from the number of uninfected cells at each time
point. The total percentage of dead cells was calculated by adding the
percentage of intact cells labeled with ethidium homodimer-1 as
measured by flow cytometry to the percentage of cells that
disintegrated as measured by the Coulter counter. The data represent
the average ± standard deviation of three experiments.
|
|
In BHK cells, there was little difference in the cell death caused by
rwt virus and that caused by rM51R-M virus over the
24-h time course
(Fig.
7C), and
tsO82 virus killed BHK cells faster
than did
wtO virus (Fig.
7D). These results are similar to those
obtained by
time lapse microscopy and caspase-3 activation, although
the onset of
membrane blebbing and the activation of caspase-3
are earlier events
than the membrane rupture measured by these
experiments. Thus, we can
again conclude that another viral component
is the main inducer of
apoptosis in BHK cells. The effect of wt
M protein is to delay the
induction of apoptosis by this other
viral component in BHK cells
infected with VSV. This delay was
apparent when the
tsO82
and wtO viruses were compared (Fig.
7D).
In the case of the rM51R-M and
rwt viruses, the delay was not
apparent in Fig.
7C because fewer
infected cells died within the
24-h time
course.
Viral growth and M protein expression by wt and M protein mutant
viruses.
Rates of wt and M protein mutant virus growth and protein
expression in HeLa or BHK cells were determined in order to determine whether the induction of apoptosis by these viruses is related to the
level of virus replication or M protein expression. Cells were infected
with each of the two different M protein mutant viruses (rM51R-M or
tsO82) or the corresponding wt virus (rwt or wtO), and the
virus yield was determined by plaque assay as a function of time
postinfection. The results of two viral growth experiments performed
with HeLa cells were averaged and are shown in Fig.
8A. RM51R-M virus (open squares) produced
levels of progeny similar to those produced by rwt virus (closed
squares) at early times postinfection but accumulated to approximately
10-fold higher titers than did rwt virus by 24 h postinfection. In
repeated experiments at 24 h postinfection, this trend in virus
yield, although reproducible, was not statistically significant,
4.0 × 107 ± 2.0 × 107 for rwt virus and 1.8 × 108 ± 1.3 × 108 for
rM51R-M virus (n = 4, P = 0.1). These
data indicate that the M51R M protein mutation does not have a
deleterious effect on virus growth and that in HeLa cells, it slightly
enhanced the yield of the recombinant virus. There was little
difference between the growth of tsO82 virus (open circles)
and that of the wtO virus from which it was derived (closed circles).
tsO82 virus was originally identified as a ts
mutant in chicken embryo cells (13) but is not temperature
sensitive for virus growth in most cell types. These results obtained
at 37°C are consistent with the lack of temperature sensitivity of
this virus for growth in HeLa cells. rwt virus grew to lower titers
than either of the viruses derived from the Orsay strain. This appears
to reflect strain differences in virus growth.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 8.
Effects of M gene mutations on virus
growth. HeLa cells (A) or BHK cells (B) were infected with wtO virus
(closed circles), tsO82 virus (open circles), rwt virus
(closed squares), or rM51R-M virus (open squares). One hour
postinfection, the cells were washed with phosphate-buffered
saline and 5 ml of DMEM with 2% FBS was added to each dish. At
the indicated time point, 100 µl of supernatant was removed from each
plate and stored at 70°C. Plaque assays were performed in duplicate
with BHK cells. The data reported are averages of two experiments.
|
|
The results of similar experiments performed with BHK cells are shown
in Fig.
8B. RM51R-M virus (open squares) grew to higher
titers than did
rwt virus (closed squares), although there was
less difference between
the viral growth rates in BHK cells than
in HeLa cells. The viruses
derived from the Orsay strain (circles)
grew to higher titers than did
the viruses derived from the infectious
cDNA clone (squares). As in
HeLa cells, it is also apparent that
the
tsO82 virus is not
temperature sensitive in BHK cells. The
important conclusion to be
drawn from these data is that the M51R
M protein mutation does not have
a deleterious effect on virus
growth.
The levels of viral protein synthesis in cells infected with M protein
mutants and the corresponding wt viruses are shown
in Fig.
9. HeLa or BHK cells were infected with
each of the four
viruses for 4, 8, or 12 h and then pulsed with
[
35S]methionine for 10 min. The proteins were
solubilized and analyzed
by SDS-PAGE and phosphorescence imaging.
Figure
9A and C show
representative images obtained with HeLa and BHK
cells, respectively.
Figure
9B and D show quantitation of the
radioactivity of the
M protein bands from three separate experiments
expressed as a
percentage of the amount of M protein synthesis at
4 h postinfection
with the wtO virus, which was near the maximum
rate. Rates of
M protein synthesis in cells infected with the wtO and
rwt viruses
declined over the 12-h time course in both cell types due
to the
dramatic inhibition of both viral and host protein synthesis
that
is typical of VSV-infected cells. rwt virus synthesized less M
protein at 4 h postinfection than did the wtO virus, particularly
in BHK cells. This may contribute to the differences in virus
growth
seen in Fig.
8 and to the differences between these two
virus strains
in the induction of apoptosis. However, M protein
synthesis by the
tsO82 and rM51R-M viruses was similar to that
of the
respective wt controls at 4 h postinfection (black bars)
and
actually increased between 4 and 8 h postinfection (gray bars).
By
12 h postinfection (white bars), M protein synthesis by the
tsO82 virus was reduced, indicating that viral protein
synthesis
was inhibited in these cells at this time point. M protein
synthesis
in cells infected with rM51R-M virus increased over the 12-h
time
course, indicating that viral protein synthesis in these cells
was
not inhibited at these times postinfection. Most importantly,
the level
of M protein expressed by the mutant viruses was not
less than the
level of M protein expressed by the corresponding
wt viruses. These
data indicate that the M protein mutation does
not lead to reduced
levels of M protein expression. Thus, the
effects of the M protein
mutation on the induction of apoptosis
seen in Fig.
5 and
6 are due to
changes in the activity of M protein
in cytopathogenesis rather than to
changes in the level of M protein
expression.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 9.
Effects of M gene mutations on rates of
protein synthesis in VSV-infected cells. HeLa cells (A and B) or BHK
cells (C and D) were infected with one of the four viruses indicated.
At 4, 8, or 12 h postinfection, cells were labeled with
[35S]methionine for 10 min and analyzed by SDS-PAGE.
Radioactivity was determined by phosphorescence imaging. Representative
images are shown in panels A and C. The viral proteins are indicated to
the left of each gel. The radioactivity of the M protein bands was
quantified and is shown in panels B and D as the average ± the
standard deviation of three experiments. The amount of M protein is
expressed as a percentage of the amount of M protein synthesized by wtO
virus at 4 h postinfection. The amounts of M protein synthesized
at 4 h (black bars), 8 h (gray bars), and 12 h (white
bars) are grouped together for each virus.
|
|
Also apparent in Fig.
9A and C are the differences in the viruses'
abilities to inhibit host protein synthesis, as seen by
differences in
the levels of the nonviral protein bands (e.g.,
the region between
viral proteins L and G). The wtO and rwt viruses
were both effective at
inhibiting host protein synthesis, as is
typical during a VSV
infection. The
tsO82 virus was less effective
than the wtO
virus, and the rM51R-M virus was less effective than
the rwt virus at
inhibiting host protein synthesis over this time
course examined. This
indicates that the M51R M protein mutation
reduced the ability of VSV
to inhibit translation of host proteins
in infected
cells.
 |
DISCUSSION |
Our previous experiments and those of other laboratories have
established that the VSV M protein plays a major role in
cytopathogenesis by VSV (5, 7, 17). M protein is a
structural component of the virion and has several important functions
in virus assembly (23). However, M protein plays an
important role in viral cytopathogenesis that is genetically separable
from its function in virus assembly (6, 26). M protein is
a potent inhibitor of host gene expression, both in virus-infected
cells and when expressed in transfected cells in the absence of other
viral gene products (5, 12, 30). M protein also inhibits
cytoskeletal and cell adhesion functions, leading to cell rounding
(7, 26, 29). The purpose of the experiments presented here
was to determine whether M protein is also responsible for the
induction of apoptosis in VSV-infected cells. The data presented here
show that M protein induces cell death when expressed in the absence of
other viral components (Fig. 1, 2, and 3). Furthermore, cell death
occurred by induction of apoptosis rather than necrosis, as shown by
induction of the morphological changes that are characteristic of
apoptosis and by the activation of caspase-3. M protein mutants
demonstrated that the induction of apoptosis by M protein expression is
genetically correlated with its ability to inhibit host gene expression
and not with its viral assembly function. The ability of M protein to
induce apoptosis was supported by results obtained with HeLa cells
infected with the recombinant virus containing the M51R M protein
mutation, which renders M protein defective in the ability to inhibit
host gene expression and in the ability to induce apoptosis. HeLa cells
infected with the rM51R-M virus entered apoptosis more slowly than did
cells infected with the rwt virus (Fig. 5A, 6A, and 7A), supporting a
role for wt M protein in the induction of apoptosis in VSV-infected
HeLa cells.
However, there is clearly another viral component that contributes to
induction of apoptosis in VSV-infected cells in addition to M protein.
The most striking argument for the presence of another viral inducer of
apoptosis comes from the results obtained with BHK cells (Fig. 5C, 6C,
and 7C). Most BHK cells infected with either rM51R-M or
tsO82 virus entered apoptosis faster than did cells infected
with the corresponding wt viruses. A similar result was obtained
previously by using another mutant virus containing the M51R mutation
in its M protein (L. Poliquin and D. D. Dunigan, Abstr. 15th Annu.
Meet. Am. Soc. Virol., abstr. W20-7, 1996). Since the M51R M
protein is defective in the ability to induce apoptosis (Fig. 2), these
results indicate that another viral component is the principal inducer
of apoptosis in BHK cells infected with VSV. The effect of wt M protein
was to delay VSV-induced apoptosis in BHK cells. These results can be
explained by a model in which the induction of apoptosis by another
viral component requires new host gene expression in BHK cells
(25). In this model, wt M protein inhibits the expression
of host gene products necessary for the induction of apoptosis. Thus,
the effect of wt M protein would be to delay the induction of
apoptosis by VSV in BHK cells. In cells infected with the M
protein mutant viruses, the expression of proapoptotic host gene
products would not be inhibited and apoptosis would be induced more
rapidly than in cells infected with wt viruses.
The existence of another viral component besides M protein that is
involved in the induction of apoptosis could account for the difference
between the tsO82 and rM51R-M viruses in the induction of
apoptosis. Both of these viruses contain the M51R mutation in their M
proteins, yet tsO82 virus induced apoptosis more rapidly than did rM51R-M virus in both HeLa and BHK cells (Fig. 5, 6, and 7).
It is likely that sequence differences between these viruses in genes
other than M account for this difference in their rates of
induction of apoptosis. The sequences of the M proteins of these
viruses do differ in 6 out of 229 amino acids (15), since the M protein of tsO82 virus is derived from the Orsay
strain of VSV while that of the recombinant virus is derived from the San Juan strain (37). It is possible that these sequence
differences in their M proteins are responsible for the difference in
the induction of apoptosis. However, there is no detectable difference between the San Juan and Orsay M proteins in the ability to inhibit host gene expression (unpublished results). Thus, it is more likely that sequence differences in a viral component other than M protein are
responsible for the difference in induction of apoptosis by these two viruses.
The data presented here raise the question of how M protein and another
viral component induce apoptosis in VSV-infected cells. Our hypothesis
is that the induction of apoptosis by M protein is a consequence of the
inhibition of host gene expression. The VSV M protein is remarkably
potent as an inhibitor of host gene expression. For example, the levels
of M protein required to inhibit gene expression in transfected cells
are 1,000-fold lower than the levels of M protein expressed in
VSV-infected cells (5, 27). The inhibition of host gene
expression by M protein occurs at the level of transcription and at the
level of nuclear-cytoplasmic transport of host RNAs (25).
Inhibition of such fundamental cellular processes is inconsistent with
cell survival, and it is likely that these activities of M protein are
responsible for the induction of apoptosis. Alternatively, M protein
may induce apoptosis by inhibiting other cellular processes, such as
cytoskeletal function, or M protein may have an apoptosis-inducing
activity that is independent of its other cytopathic effects.
Understanding the mechanism by which another viral component induces
apoptosis in VSV-infected cells depends, of course, on the identity of
the other viral component. A likely candidate is viral double stranded
RNA (10, 22). This would be consistent with recent
evidence implicating the activation of protein kinase R in the
induction of apoptosis by VSV (3). Double-stranded RNA is
a by-product of viral replication not normally present in uninfected
cells and is a major activator of protein kinase R (2,
35). Another possibility is that viral leader RNA contributes to
the induction of apoptosis of VSV-infected cells. Leader RNA is the
first gene product transcribed from the viral genome, but it does not
encode a protein. Leader RNA has been implicated in the virus-induced
inhibition of host transcription, but protein synthesis is necessary
for the inhibition of host RNA synthesis during a VSV infection,
indicating that leader RNA could not be solely responsible for the
inhibition (11, 16, 28, 32). Nonetheless, leader RNA might
contribute to the cytopathic effects of VSV infection and could play a
role in the induction of apoptosis. The viral glycoprotein (G protein)
is another candidate that may contribute to induction of apoptosis of
VSV-infected cells. For example, G protein might bind to cellular
receptors that activate pathways involved in the induction of
apoptosis. Stable cell lines have been made that express the VSV G
protein, indicating that expression of G protein is not inherently
toxic to cells (14). Thus, G protein probably cannot
induce apoptosis in the absence of other viral components. However, it
is possible that during a viral infection, G protein interacts with
other viral components to activate cell death receptors. A goal of our
future experiments will be to identify the viral components other than
M protein that contribute to the induction of apoptosis by VSV.
Induction of apoptosis in virus-infected cells is usually considered a
host antiviral response to limit the amount of viral progeny.
Inhibition of host gene expression by M protein appears to be a
mechanism by which to prevent expression of host antiviral gene
products, such as interferons and other antiviral proteins (25). Thus, the delay caused by wt M protein in the onset
of VSV-induced apoptosis in BHK cells would be consistent with this role of M protein in the inhibition of the host antiviral response. However, a possible consequence of VSV's encoding an M protein that
promotes apoptosis is that in some cell types, premature cell death may
result in a lower number of viral particles released from each infected
cell. HeLa cells infected with rM51R-M virus survived much longer than
cells infected with rwt virus, and rM51R-M virus grew to slightly
higher titers in HeLa cells (Fig. 5, 6, 7, and 8), supporting the idea
that premature induction of apoptosis in cells infected with rwt virus
limits virus growth. However, there are clearly other factors that
determine the level of virus growth, since both the wtO and
tsO82 viruses grew to high titers in HeLa cells (Fig. 8),
despite the fact that they rapidly induce apoptosis in infected cells
(Fig. 5, 6, and 7). Thus, it is likely that the premature induction of
apoptosis by M protein is only a minor disadvantage for VSV compared to
the advantages derived from the M protein-induced inhibition of the
host antiviral response.
In many cases of viral disease, including VSV, virus-induced cell death
is the primary cause of disease symptoms in host organisms (18). In the case of Sindbis virus, mortality in infected
mice is dramatically reduced when apoptosis is suppressed by Bcl-2 protein expressed by the virus (24). Differential
sensitivity of cells in different tissues to induction of apoptosis
could play a role in determining which tissues give rise to disease symptoms following virus infection. Our results showing that HeLa and
BHK cells have dramatically different responses to the activity of M
protein following VSV infection, suggest that M protein plays a role in
determining which cell types are most affected by virus-induced apoptosis in the intact host. Thus, these results provide a basis for
exploration of the differential responsiveness among cell types to
viral inducers of apoptosis and the implications of this differential
responsiveness for viral pathogenesis in intact hosts.
 |
ACKNOWLEDGMENTS |
We thank Griffith Parks and Maryam Ahmed for helpful advice and
comments on the manuscript. We also thank Margie McKenzie for isolating
virus from the infectious clones.
This work was supported by Public Health Service grant AI 32983 from
the National Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Wake Forest University School of Medicine, Winston-Salem, NC 27157-1064. Phone: (336) 716-2270. Fax: (336) 716-9928. E-mail: skopecky{at}wfubmc.edu.
 |
REFERENCES |
| 1.
|
Ahmed, M., and D. S. Lyles.
1998.
Effect of vesicular stomatitis virus matrix protein on transcription directed by host RNA polymerases I, II, and III.
J. Virol.
72:8413-8419[Abstract/Free Full Text].
|
| 2.
|
Balachandran, S.,
C. N. Kim,
W. C. Yeh,
T. W. Mak,
K. Bhalla, and G. N. Barber.
1998.
Activation of the dsRNA-dependent protein kinase, PKR, induces apoptosis through FADD-mediated death signaling.
EMBO J.
17:6888-6902[CrossRef][Medline].
|
| 3.
|
Balachandran, S.,
P. C. Roberts,
T. Kipperman,
K. N. Bhalla,
R. W. Compans,
D. R. Archer, and G. N. Barber.
2000.
Alpha/beta interferons potentiate virus-induced apoptosis through activation of the FADD/caspase-8 death signaling pathway.
J. Virol.
74:1513-1523[Abstract/Free Full Text].
|
| 4.
|
Black, B. L.,
G. Brewer, and D. S. Lyles.
1994.
Effect of vesicular stomatitis virus matrix protein on host-directed translation in vivo.
J. Virol.
68:555-560[Abstract/Free Full Text].
|
| 5.
|
Black, B. L., and D. S. Lyles.
1992.
Vesicular stomatitis virus matrix protein inhibits host cell-directed transcription of target genes in vivo.
J. Virol.
66:4058-4064[Abstract/Free Full Text].
|
| 6.
|
Black, B. L.,
R. B. Rhodes,
M. McKenzie, and D. S. Lyles.
1993.
The role of vesicular stomatitis virus matrix protein in inhibition of host-directed gene expression is genetically separable from its function in virus assembly.
J. Virol.
67:4814-4821[Abstract/Free Full Text].
|
| 7.
|
Blondel, D.,
G. G. Harmison, and M. Schubert.
1990.
Role of matrix protein in cytopathogenesis of vesicular stomatitis virus.
J. Virol.
64:1716-1725[Abstract/Free Full Text].
|
| 8.
|
Collins, J. A.,
C. A. Schandi,
K. K. Young,
J. Vesely, and M. C. Willingham.
1997.
Major DNA fragmentation is a late event in apoptosis.
J. Histochem. Cytochem.
45:923-934[Abstract/Free Full Text].
|
| 9.
|
Coulon, P.,
V. Deutsch,
F. Lafay,
C. Martinet-Edelist,
F. Wyers,
R. C. Herman, and A. Flamand.
1990.
Genetic evidence for multiple functions of the matrix protein of vesicular stomatitis virus.
J. Gen. Virol.
71:991-996[Abstract/Free Full Text].
|
| 10.
|
Der, S. D.,
Y. L. Yang,
C. Weissmann, and B. R. Williams.
1997.
A double-stranded RNA-activated protein kinase-dependent pathway mediating stress-induced apoptosis.
Proc. Natl. Acad. Sci. USA
94:3279-3283[Abstract/Free Full Text].
|
| 11.
|
Dunigan, D. D.,
S. Baird, and J. Lucas-Lenard.
1986.
Lack of correlation between the accumulation of plus-strand leader RNA and the inhibition of protein and RNA synthesis in vesicular stomatitis virus infected mouse L cells.
Virology
150:231-246[CrossRef][Medline].
|
| 12.
|
Ferran, M. C., and J. M. Lucas-Lenard.
1997.
The vesicular stomatitis virus matrix protein inhibits transcription from the human beta interferon promoter.
J. Virol.
71:371-377[Abstract].
|
| 13.
|
Flamand, A.
1970.
Genetic study of vesicular stomatitis virus: classification of spontaneous thermosensitive mutants into complementation groups.
J. Gen. Virol.
8:187-195[Abstract/Free Full Text].
|
| 14.
|
Florkiewicz, R. Z.,
A. Smith,
J. E. Bergmann, and J. K. Rose.
1983.
Isolation of stable mouse cell lines that express cell surface and secreted forms of the vesicular stomatitis virus glycoprotein.
J. Cell Biol.
97:1381-1388[Abstract/Free Full Text].
|
| 15.
|
Gopalakrishna, Y., and J. Lenard.
1985.
Sequence alterations in temperature-sensitive M-protein mutants (complementation group III) of vesicular stomatitis virus.
J. Virol.
56:655-659[Abstract/Free Full Text].
|
| 16.
|
Grinnell, B. W., and R. R. Wagner.
1983.
Comparative inhibition of cellular transcription by vesicular stomatitis virus serotypes New Jersey and Indiana: role of each viral leader RNA.
J. Virol.
48:88-101[Abstract/Free Full Text].
|
| 17.
|
Her, L. S.,
E. Lund, and J. E. Dahlberg.
1997.
Inhibition of Ran guanosine triphosphatase-dependent nuclear transport by the matrix protein of vesicular stomatitis virus.
Science
276:1845-1848[Abstract/Free Full Text].
|
| 18.
|
Huneycutt, B. S.,
Z. Bi,
C. J. Aoki, and C. S. Reiss.
1993.
Central neuropathogenesis of vesicular stomatitis virus infection of immunodeficient mice.
J. Virol.
67:6698-6706[Abstract/Free Full Text].
|
| 19.
|
Kaptur, P. E.,
M. O. McKenzie,
G. W. Wertz, and D. S. Lyles.
1995.
Assembly functions of vesicular stomatitis virus matrix protein are not disrupted by mutations at major sites of phosphorylation.
Virology
206:894-903[CrossRef][Medline].
|
| 20.
|
Koyama, A. H.
1995.
Induction of apoptotic DNA fragmentation by the infection of vesicular stomatitis virus.
Virus Res.
37:285-290[CrossRef][Medline].
|
| 21.
|
Lawson, N. D.,
E. A. Stillman,
M. A. Whitt, and J. K. Rose.
1995.
Recombinant vesicular stomatitis viruses from DNA.
Proc. Natl. Acad. Sci. USA
92:4477-4481[Abstract/Free Full Text].
|
| 22.
|
Lee, S. B., and M. Esteban.
1994.
The interferon-induced double-stranded RNA-activated protein kinase induces apoptosis.
Virology
199:491-496[CrossRef][Medline].
|
| 23.
|
Lenard, J.
1996.
Negative-strand virus M and retrovirus MA proteins: all in a family?
Virology
216:289-298[CrossRef][Medline].
|
| 24.
|
Levine, B.,
J. E. Goldman,
H. H. Jiang,
D. E. Griffin, and J. M. Hardwick.
1996.
Bcl-2 protects mice against fatal alphavirus encephalitis.
Proc. Natl. Acad. Sci. USA
93:4810-4815[Abstract/Free Full Text].
|
| 25.
|
Lyles, D. S.
2000.
Cytopathogenesis and inhibition of host gene expression by RNA viruses.
Microbiol. Mol. Biol. Rev.
64:709-724[Abstract/Free Full Text].
|
| 26.
|
Lyles, D. S., and M. O. McKenzie.
1997.
Activity of vesicular stomatitis virus M protein mutants in cell rounding is correlated with the ability to inhibit host gene expression and is not correlated with virus assembly function.
Virology
299:77-89.
|
| 27.
|
Lyles, D. S.,
M. O. McKenzie,
M. Ahmed, and S. C. Woolwine.
1996.
Potency of wild-type and temperature-sensitive vesicular stomatitis virus matrix protein in the inhibition of host-directed gene expression.
Virology
225:172-180[CrossRef][Medline].
|
| 28.
|
McGowan, J. J.,
S. U. Emerson, and R. R. Wagner.
1982.
The plus-strand leader RNA of VSV inhibits DNA-dependent transcription of adenovirus and SV40 genes in a soluble whole-cell extract.
Cell
28:325-333[CrossRef][Medline].
|
| 29.
|
Melki, R.,
Y. Gaudin, and D. Blondel.
1994.
Interaction between tubulin and the viral matrix protein of vesicular stomatitis virus: possible implications in the viral cytopathic effect.
Virology
202:339-347[CrossRef][Medline].
|
| 30.
|
Paik, S. Y.,
A. C. Banerjea,
G. G. Harmison,
C. J. Chen, and M. Schubert.
1995.
Inducible and conditional inhibition of human immunodeficiency virus proviral expression by vesicular stomatitis virus matrix protein.
J. Virol.
69:3529-3537[Abstract].
|
| 31.
|
Petersen, J. M.,
L. S. Her,
V. Varvel,
E. Lund, and J. E. Dahlberg.
2000.
The matrix protein of vesicular stomatitis virus inhibits nucleocytoplasmic transport when it is in the nucleus and associated with nuclear pore complexes.
Mol. Cell. Biol.
20:8590-8601[Abstract/Free Full Text].
|
| 32.
|
Poirot, M. K.,
W. M. Schnitzlein, and M. E. Reichmann.
1985.
The requirement of protein synthesis for VSV inhibition of host cell RNA synthesis.
Virology
140:91-101[CrossRef][Medline].
|
| 33.
|
Roulston, A.,
R. C. Marcellus, and P. E. Branton.
1999.
Viruses and apoptosis.
Annu. Rev. Microbiol.
53:577-628[CrossRef][Medline].
|
| 34.
|
Sarkar, G., and S. S. Sommer.
1990.
The "megaprimer" method of site-directed mutagenesis.
BioTechniques
8:404-407[Medline].
|
| 35.
|
Thomis, D. C., and C. E. Samuel.
1995.
Mechanism of interferon action: characterization of the intermolecular autophosphorylation of PKR, the interferon-inducible, RNA-dependent protein kinase.
J. Virol.
69:5195-5198[Abstract].
|
| 36.
|
von Kobbe, C.,
J. M. van Deursen,
J. P. Rodrigues,
D. Sitterlin,
A. Bachi,
X. Wu,
M. Wilm,
M. Carmo-Fonseca, and E. Izaurralde.
2000.
Vesicular stomatitis virus matrix protein inhibits host cell gene expression by targeting the nucleoporin nup98.
Mol. Cell
6:1243-1252[CrossRef][Medline].
|
| 37.
|
Whelan, S. P.,
L. A. Ball,
J. N. Barr, and G. T. Wertz.
1995.
Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones.
Proc. Natl. Acad. Sci. USA
92:8388-8392[Abstract/Free Full Text].
|
| 38.
|
Yuan, H.,
S. Puckett, and D. S. Lyles.
2001.
Inhibition of host transcription by vesicular stomatitis virus involves a novel mechanism that is independent of phosphorylation of TATA-binding protein (TBP) or association of TBP with TBP-associated factor subunits.
J. Virol.
75:4453-4458[Abstract/Free Full Text].
|
| 39.
|
Yuan, H.,
B. K. Yoza, and D. S. Lyles.
1998.
Inhibition of host RNA polymerase II-dependent transcription by vesicular stomatitis virus results from inactivation of TFIID.
Virology
251:383-392[CrossRef][Medline].
|
Journal of Virology, December 2001, p. 12169-12181, Vol. 75, No. 24
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.24.12169-12181.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ahmed, M., Mitchell, L. M., Puckett, S., Brzoza-Lewis, K. L., Lyles, D. S., Hiltbold, E. M.
(2009). Vesicular Stomatitis Virus M Protein Mutant Stimulates Maturation of Toll-Like Receptor 7 (TLR7)-Positive Dendritic Cells through TLR-Dependent and -Independent Mechanisms. J. Virol.
83: 2962-2975
[Abstract]
[Full Text]
-
Dancho, B., McKenzie, M. O., Connor, J. H., Lyles, D. S.
(2009). Vesicular Stomatitis Virus Matrix Protein Mutations That Affect Association with Host Membranes and Viral Nucleocapsids. J. Biol. Chem.
284: 4500-4509
[Abstract]
[Full Text]
-
Pettit Kneller, E. L., Connor, J. H., Lyles, D. S.
(2009). hnRNPs Relocalize to the Cytoplasm following Infection with Vesicular Stomatitis Virus. J. Virol.
83: 770-780
[Abstract]
[Full Text]
-
Carey, B. L., Ahmed, M., Puckett, S., Lyles, D. S.
(2008). Early Steps of the Virus Replication Cycle Are Inhibited in Prostate Cancer Cells Resistant to Oncolytic Vesicular Stomatitis Virus. J. Virol.
82: 12104-12115
[Abstract]
[Full Text]
-
Zhong, Q., Wen, Y.-J., Yang, H.-S., Luo, H., Fu, A.-F., Yang, F., Chen, L.-J., Chen, X., Qi, X.-R., Lin, H.-G., Wan, Y., Chen, X.-C., Wei, Y.-Q., Zhao, X.
(2008). Efficient inhibition of cisplatin-resistant human ovarian cancer growth and prolonged survival by gene transferred vesicular stomatitis virus matrix protein in nude mice. Ann Oncol
19: 1584-1591
[Abstract]
[Full Text]
-
Remold, S. K., Rambaut, A., Turner, P. E.
(2008). Evolutionary Genomics of Host Adaptation in Vesicular Stomatitis Virus. Mol Biol Evol
25: 1138-1147
[Abstract]
[Full Text]
-
Ngunjiri, J. M., Sekellick, M. J., Marcus, P. I.
(2008). Clonogenic Assay of Type A Influenza Viruses Reveals Noninfectious Cell-Killing (Apoptosis-Inducing) Particles. J. Virol.
82: 2673-2680
[Abstract]
[Full Text]
-
Whitlow, Z. W., Connor, J. H., Lyles, D. S.
(2008). New mRNAs Are Preferentially Translated during Vesicular Stomatitis Virus Infection. J. Virol.
82: 2286-2294
[Abstract]
[Full Text]
-
Won, S., Ikegami, T., Peters, C. J., Makino, S.
(2007). NSm Protein of Rift Valley Fever Virus Suppresses Virus-Induced Apoptosis. J. Virol.
81: 13335-13345
[Abstract]
[Full Text]
-
Irie, T., Carnero, E., Okumura, A., Garcia-Sastre, A., Harty, R. N.
(2007). Modifications of the PSAP region of the matrix protein lead to attenuation of vesicular stomatitis virus in vitro and in vivo. J. Gen. Virol.
88: 2559-2567
[Abstract]
[Full Text]
-
Li, J., Chorba, J. S., Whelan, S. P. J.
(2007). Vesicular Stomatitis Viruses Resistant to the Methylase Inhibitor Sinefungin Upregulate RNA Synthesis and Reveal Mutations That Affect mRNA Cap Methylation. J. Virol.
81: 4104-4115
[Abstract]
[Full Text]
-
Gaddy, D. F., Lyles, D. S.
(2007). Oncolytic Vesicular Stomatitis Virus Induces Apoptosis via Signaling through PKR, Fas, and Daxx. J. Virol.
81: 2792-2804
[Abstract]
[Full Text]
-
Dillon, P. J., Wansley, E. K., Young, V. A., Alexander-Miller, M. A., Parks, G. D.
(2006). Exchange of P/V genes between two non-cytopathic simian virus 5 variants results in a recombinant virus that kills cells through death pathways that are sensitive to caspase inhibitors. J. Gen. Virol.
87: 3643-3648
[Abstract]
[Full Text]
-
Whitlow, Z. W., Connor, J. H., Lyles, D. S.
(2006). Preferential Translation of Vesicular Stomatitis Virus mRNAs Is Conferred by Transcription from the Viral Genome. J. Virol.
80: 11733-11742
[Abstract]
[Full Text]
-
Lichty, B. D., McBride, H., Hanson, S., Bell, J. C.
(2006). Matrix protein of Vesicular stomatitis virus harbours a cryptic mitochondrial-targeting motif.. J. Gen. Virol.
87: 3379-3384
[Abstract]
[Full Text]
-
Abdel-Latif, L., Murray, B. K., Renberg, R. L., O'Neill, K. L., Porter, H., Jensen, J. B., Johnson, F. B.
(2006). Cell death in bovine parvovirus-infected embryonic bovine tracheal cells is mediated by necrosis rather than apoptosis. J. Gen. Virol.
87: 2539-2548
[Abstract]
[Full Text]
-
Connor, J. H., McKenzie, M. O., Lyles, D. S.
(2006). Role of residues 121 to 124 of vesicular stomatitis virus matrix protein in virus assembly and virus-host interaction.. J. Virol.
80: 3701-3711
[Abstract]
[Full Text]
-
Ahmed, M., Brzoza, K. L., Hiltbold, E. M.
(2006). Matrix Protein Mutant of Vesicular Stomatitis Virus Stimulates Maturation of Myeloid Dendritic Cells. J. Virol.
80: 2194-2205
[Abstract]
[Full Text]
-
Connor, J. H., Lyles, D. S.
(2005). Inhibition of Host and Viral Translation during Vesicular Stomatitis Virus Infection: eIF2 IS RESPONSIBLE FOR THE INHIBITION OF VIRAL BUT NOT HOST TRANSLATION. J. Biol. Chem.
280: 13512-13519
[Abstract]
[Full Text]
-
Gaddy, D. F., Lyles, D. S.
(2005). Vesicular Stomatitis Viruses Expressing Wild-Type or Mutant M Proteins Activate Apoptosis through Distinct Pathways. J. Virol.
79: 4170-4179
[Abstract]
[Full Text]
-
Das, S. C., Pattnaik, A. K.
(2004). Phosphorylation of Vesicular Stomatitis Virus Phosphoprotein P Is Indispensable for Virus Growth. J. Virol.
78: 6420-6430
[Abstract]
[Full Text]
-
Kassis, R., Larrous, F., Estaquier, J., Bourhy, H.
(2004). Lyssavirus Matrix Protein Induces Apoptosis by a TRAIL-Dependent Mechanism Involving Caspase-8 Activation. J. Virol.
78: 6543-6555
[Abstract]
[Full Text]
-
Ebert, O., Shinozaki, K., Kournioti, C., Park, M.-S., Garcia-Sastre, A., Woo, S. L. C.
(2004). Syncytia Induction Enhances the Oncolytic Potential of Vesicular Stomatitis Virus in Virotherapy for Cancer. Cancer Res.
64: 3265-3270
[Abstract]
[Full Text]
-
Prehaud, C., Lay, S., Dietzschold, B., Lafon, M.
(2003). Glycoprotein of Nonpathogenic Rabies Viruses Is a Key Determinant of Human Cell Apoptosis. J. Virol.
77: 10537-10547
[Abstract]
[Full Text]
-
Sur, J.-H., Allende, R., Doster, A. R.
(2003). Vesicular Stomatitis Virus Infection and Neuropathogenesis in the Murine Model are Associated with Apoptosis. Vet Pathol
40: 512-520
[Abstract]
[Full Text]
-
Bose, S., Mathur, M., Bates, P., Joshi, N., Banerjee, A. K.
(2003). Requirement for cyclophilin A for the replication of vesicular stomatitis virus New Jersey serotype. J. Gen. Virol.
84: 1687-1699
[Abstract]
[Full Text]
-
Kopecky, S. A., Lyles, D. S.
(2003). The Cell-Rounding Activity of the Vesicular Stomatitis Virus Matrix Protein Is due to the Induction of Cell Death. J. Virol.
77: 5524-5528
[Abstract]
[Full Text]
-
Ahmed, M., McKenzie, M. O., Puckett, S., Hojnacki, M., Poliquin, L., Lyles, D. S.
(2003). Ability of the Matrix Protein of Vesicular Stomatitis Virus To Suppress Beta Interferon Gene Expression Is Genetically Correlated with the Inhibition of Host RNA and Protein Synthesis. J. Virol.
77: 4646-4657
[Abstract]
[Full Text]
-
Kopecky, S. A., Lyles, D. S.
(2003). Contrasting Effects of Matrix Protein on Apoptosis in HeLa and BHK Cells Infected with Vesicular Stomatitis Virus Are due to Inhibition of Host Gene Expression. J. Virol.
77: 4658-4669
[Abstract]
[Full Text]
-
Rodriguez, L. L., Pauszek, S. J., Bunch, T. A., Schumann, K. R.
(2002). Full-length genome analysis of natural isolates of vesicular stomatitis virus (Indiana 1 serotype) from North, Central and South America. J. Gen. Virol.
83: 2475-2483
[Abstract]
[Full Text]
-
Connor, J. H., Lyles, D. S.
(2002). Vesicular Stomatitis Virus Infection Alters the eIF4F Translation Initiation Complex and Causes Dephosphorylation of the eIF4E Binding Protein 4E-BP1. J. Virol.
76: 10177-10187
[Abstract]
[Full Text]