Previous Article | Next Article ![]()
Journal of Virology, December 2001, p. 12128-12140, Vol. 75, No. 24
Laboratory of Infectious Diseases, National
Institute of Allergy and Infectious Diseases,1
and Molecular Immunogenetics and Vaccine Research Section,
Metabolism Branch, National Cancer
Institute,2 National Institutes of Health,
Bethesda, Maryland
Received 21 May 2001/Accepted 17 September 2001
An obstacle to developing a vaccine against human
respiratory syncytial virus (RSV) is that natural infection
typically does not confer solid immunity to reinfection. To investigate
methods to augment the immune response, recombinant RSV (rRSV) was
constructed that expresses murine granulocyte-macrophage
colony-stimulating factor (mGM-CSF) from a transcription cassette
inserted into the G-F intergenic region. Replication of rRSV/mGM-CSF in
the upper and lower respiratory tracts of BALB/c mice was reduced 23- to 74- and 5- to 588-fold, respectively, compared to that of the parental rRSV. Despite this strong attenuation of replication, the
level of RSV-specific serum antibodies induced by rRSV/mGM-CSF was
comparable to, or marginally higher than, that of the parental rRSV.
The induction of RSV-specific CD8+ cytotoxic T cells was
moderately reduced during the initial infection, which might be a
consequence of reduced antigen expression. Mice infected with
rRSV/mGM-CSF had elevated levels of pulmonary mRNA for gamma interferon
(IFN- Respiratory syncytial virus (RSV) is
the most important viral etiologic agent of serious pediatric
respiratory tract disease worldwide. RSV also is receiving increasing
recognition as an important cause of respiratory tract disease in the
elderly; in immunocompromised patients, such as bone marrow transplant
recipients; and in the general population (reviewed in reference
16). Reinfection by RSV is common, although disease is
less severe. A licensed RSV vaccine is not available, but passive
immunoprophylaxis with RSV-neutralizing antibody is now available for
high-risk infants (2).
RSV is a nonsegmented negative-strand RNA virus of the family
Paramyxoviridae. RSV encodes 11 proteins (reviewed in
references 8, 15, and 16), namely, three
transmembrane surface proteins (G, F, and SH); the virion matrix
protein M; the nucleocapsid and polymerase proteins N, P, M2-1,
and L; the putative transcription-replication regulatory factor M2-2;
and two nonstructural proteins, NS1 and NS2, that have been implicated
as antagonists of the type I interferon antiviral state
(31). While many components of the innate and adaptive
immune systems contribute to restricting and resolving an RSV
infection, the increased resistance to reinfection that is conferred by
prior infection appears to be mediated primarily by RSV-specific
secretory and serum antibodies (16, 17, 27). The F and G
glycoproteins are the major RSV neutralization antigens (17).
In the 1960s, a formalin-inactivated RSV vaccine evaluated in infants
and children was not protective and, paradoxically, was associated with
increased frequency and severity of disease during subsequent natural
RSV infection (26). It is now understood that the initial
vaccination primed for an immune-mediated pathogenic response that
occurred upon reexposure to viral antigen during the subsequent natural
infection, although the details of this phenomenon have not been
completely elucidated. One element appears to involve the
disproportionate induction of the Th2 subset of CD4+ T helper lymphocytes, characterized by
increased secretion of interleukin 4 (IL-4) and IL-10
(18). Subunit vaccines consisting of the RSV F and G
proteins also have been associated with enhanced pulmonary pathology
upon RSV challenge in experimental animals (22, 28, 35).
Other studies indicate that the disproportionate induction of
CD4+ T lymphocytes by RSV antigen is abrogated by
the concurrent induction of CD8+ T lymphocytes,
suggesting that the latter have a regulatory role (23,
32). Thus, the imbalanced CD4+-T-cell
response observed with RSV protein vaccines might be due to their
inefficiency in stimulating CD8+ T lymphocytes.
In contrast, the strong CD8+-T-cell response
associated with natural RSV infection could provide a regulatory role
that accounts for the lack of immune-mediated disease enhancement
during natural reinfection (35). This would be an
important advantage for a vaccine strategy based on infection with an
attenuated RSV (36).
The peak of serious pediatric RSV disease is between 2 and 9 months of
life, and thus, an RSV vaccine should be administered before this time.
Unfortunately, this age group exhibits reduced immune responses due to
immunologic immaturity and to immunosuppression mediated by maternally
derived RSV-specific serum immunoglobulin G (IgG) (36). An
additional challenge for developing a successful live attenuated RSV
vaccine is to achieve an appropriate level of attenuation and safety
while retaining sufficient immunogenicity. Recent clinical studies of
RSV vaccine candidates suggest that this goal can be achieved
(36). However, since even natural infection does not
confer solid immunity, we have been interested in the possibility of
modifying the immune response by expression of one or more cytokines or
chemokines from one or more genes inserted into the viral genome. Two
possible desirable outcomes would be augmentation of the immune
response and attenuation of the virus. An additional possibility is
that infection early in life might have a general beneficial effect in
"educating" the immature immune system (30), and this
might be augmented by expression of one or more appropriate cytokines
or chemokines.
We previously described a recombinant RSV (rRSV) that expressed murine
IFN- Construction and propagation of the recombinant viruses.
We
purchased a cDNA, flanked by MluI and BstBI
sites, that encodes the mature, 124-amino-acid form of mGM-CSF lacking
the 17-amino-acid signal peptide (R&D Systems, Minneapolis, Minn.). The
upstream end of this cDNA was modified by insertion into the HindIII-MluI window immediately upstream of
the mGM-CSF coding sequence of a synthetic DNA containing, in order, an
XmaI site, an RSV transcriptional gene start signal, and the
coding sequence for the signal peptide in frame with the GM-CSF coding
sequence. This synthetic DNA fragment was formed by annealing the
following two oligonucleotides:
AGCTTCCCGGGATGGGGCAAATATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCTCCGA and
CGCGTCGGAGCTGAGAGGCTGTAGACCACAATGCCCAGGAAAAGTAAATTCTGCAGCCACATATTTGCCCCATCCCGGGA (the XmaI restriction endonuclease sites are italicized, the
RSV gene start sequences are underlined, the signal peptide
coding sequences begin immediately after the underlined sequences, and nucleotides that contribute to the HindIII and
MluI restriction sites are in boldface). The downstream end
of the cDNA was modified to add an RSV gene end signal and
XmaI site by inserting into the
BstBI-BamHI window a synthetic double-stranded
DNA formed by annealing the following two oligonucleotides:
CGAATGCAAAAAACCAGTCCAAAAATAAAGTTATTAAAAATTCCCGG and
GATCCCGGGAATTTTTAATAACTTTATTTTTGGACTGGTTTTTTGCATT (the RSV gene end signals are underlined, the XmaI
restriction sites are italicized, and the sticky ends of
BstBI and BamHI restriction sites are in
boldface). The sequence of the engineered cDNA was confirmed in full.
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.24.12128-12140.2001
Granulocyte-Macrophage Colony-Stimulating Factor Expressed by
Recombinant Respiratory Syncytial Virus Attenuates Viral
Replication and Increases the Level of Pulmonary
Antigen-Presenting Cells
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) and interleukin 12 (IL-12) p40 compared to animals infected
by wild-type rRSV. Elevated synthesis of IFN-
could account for the
restriction of RSV replication, as was observed previously with an
IFN-
-expressing rRSV. The accumulation of total pulmonary
mononuclear cells and total CD4+ T lymphocytes was
accelerated in animals infected with rRSV/mGM-CSF compared to that in
animals infected with the control virus, and the level of
IFN-
-positive or IL-4-positive pulmonary CD4+ cells was
elevated approximately twofold. The number of pulmonary lymphoid and
myeloid dendritic cells and macrophages was increased up to fourfold in
mice infected with rRSV/mGM-CSF compared to those infected with the
parental rRSV, and the mean expression of major histocompatibility
complex class II molecules, a marker of activation, was significantly
increased in the two subsets of dendritic cells. Enhanced antigen
presentation likely accounts for the maintenance of a strong antibody
response despite reduced viral replication and would be a desirable
property for a live attenuated rRSV vaccine.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
from a supernumerary gene placed in the RSV genome between the
G and F genes, and we demonstrated that this cytokine mediated
attenuation of the virus and augmentation of the immune response
(11). A comparable rRSV expressing murine IL-2 had similar
but smaller effects (12). In the present study, we
constructed a comparable rRSV that expresses murine
granulocyte-macrophage colony-stimulating factor (mGM-CSF). This
cytokine was of particular interest because it mediates the
differentiation and maturation of dendritic cells and macrophages,
which are important to both innate and adaptive immunity. Several
groups have suggested using GM-CSF as a vaccine adjuvant expressed from
a plasmid during DNA immunization or supplied as soluble protein
(1, 5, 20, 21, 25, 29, 37). The development of reverse
genetics for negative-strand RNA viruses allowed us to explore the
approach of expressing GM-CSF as a supernumerary gene inserted into
live rRSV. In the present study of mice, expression of mGM-CSF by rRSV was associated with attenuation of virus replication, augmented proliferation and activation of pulmonary antigen-presenting cells, and
augmented stimulation of pulmonary CD4+ T lymphocytes.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (23K):
[in a new window]
FIG. 1.
Diagram of the genomic RNAs of two versions of rRSV
expressing mGM-CSF, namely, rRSV/mGM-CSF and rRSV/6120/mGM-CSF. In each
virus, a transcription cassette consisting of the mGM-CSF ORF under the
control of RSV gene start and gene end transcription signals (upper
box) was inserted into the XmaI site in the G-F
intergenic region of rRSV. The start and stop codons of the GM-CSF ORF
are in boldface, XmaI restriction endonuclease sites are
in italics, and RSV gene start and gene end signals are underlined. The
two viruses differ only in the SH gene of the respective rRSV
backbones, as illustrated in the lower box. The backbone of the
rRSV/mGM-CSF is that of the previously described wt rRSV
(14) modified to contain an XmaI site in
the G-F intergenic region (9). In the backbone of
rRSV/6120/mGM-CSF, the SH gene was modified (i) to contain five
translationally silent nucleotide substitutions in the last four codons
of the SH ORF and (ii) to delete 112 nucleotides (nt; positions 4499 to
4610) of the complete antigenomic sequence) from the downstream
nontranslated region of the SH gene (lower box). The
XhoI and PacI sites used in the
construction (Materials and Methods) are italicized and labeled, the SH
gene end signal is underlined, the SH codons are shown as triplets,
nucleotide substitutions are in lowercase, and the deleted sequence is
boxed with the sequence positions indicated.
|
|
|
Measurement of GM-CSF produced in HEp-2 cells. Duplicate monolayers were infected with 2 PFU per cell of rRSV/mGM-CSF, rRSV/6120/mGM-CSF, an rRSV expressing the chloramphenicol acetyltransferase (CAT) gene (rRSV/CAT [9]), or wt rRSV. Samples from the medium were taken at intervals over a 96-h period, and the concentration of mGM-CSF was determined by enzyme-linked immunoadsorbent assay (ELISA) using the Quantikine M Mouse GM-CSF Immunoassay (R&D Systems).
Virus replication and immunogenicity in vivo Eleven-week-old respiratory-pathogen-free female BALB/c mice were infected intranasally under light methoxyflurane anesthesia on day 0 with rRSV/6120/mGM-CSF, rRSV/6120, or medium alone. In experiment 1, the mice received 106 PFU per animal in a 0.1-ml inoculum, and six animals per group were sacrificed with CO2 on day 4. The nasal turbinates and lungs were harvested and assayed for infectious RSV by plaque titration (28). In experiment 2, groups of mice received doses of 106, 105, or 104 PFU of either virus. Six mice per group were sacrificed on days 3 (106 group only), 4 (all groups), and 5 (106 group only), and nasal turbinates and lung tissues were harvested and assayed for infectious RSV by plaque titration. To monitor serum antibody responses, each experiment described above also included (i) an uninfected control group and (ii) eight additional animals in each experimental group from which serum samples were taken on days 0, 28, and 56. Serum antibodies specific to the RSV F or G protein were measured by glycoprotein-specific ELISA (28), and RSV-neutralizing antibodies were measured by a 60% plaque reduction assay in the presence of complement (13).
Detection of mGM-CSF mRNA in mouse lungs by reverse transcription (RT)-PCR. Total RNA isolated from lungs of BALB/c mice on day 4 after infection with rRSV/mGM-CSF or wt rRSV was reverse transcribed using the primer AGAAAGGTTTTAAGGCTGTC, specific for positions 537 to 556 of the GM-CSF mRNA sequence (GenBank accession number X02333). PCR was performed using the above-mentioned oligonucleotide as a direct primer and the reverse primer R1 (GTGGTCTACAGCCTCTCAGC), specific for GM-CSF mRNA positions 207 to 226, or R2 (GTGGTCTACAGCCTCTCAGCT), which has the same sequence as the primer R1 except that it has an additional T base at the 3' end (boldface) which is specific for the silent mutation in the synthetic GM-CSF cDNA (R&D Systems) used in the construct. An initial 2-min denaturation step was performed, during which the Taq DNA polymerase was added, and then 30 cycles of PCR were performed (denaturation, 1 min at 94°C; annealing, 1 min at 45°C; elongation, 2 min at 72°C). The products were analyzed on a 2.5% agarose gel.
Analysis of pulmonary cytokine mRNAs. BALB/c mice in groups of 20 were infected intranasally with 106 PFU of rRSV/mGM-CSF or wt rRSV or were mock infected with Opti-MEM medium. On days 1 and 4 after infection, five mice from each group were sacrificed by CO2 asphyxiation, and lung tissues were harvested and processed for purification of total lung RNA by homogenization and extraction with Trizol (Life Technologies). The remaining 10 animals per group were challenged on day 28 by the intranasal administration of 106 PFU of wt rRSV per animal. On days 1 and 4 postchallenge (29 and 32 days following the initial infection), five animals from each group were sacrificed and total lung RNA was harvested. Material from each mouse was processed separately. Cytokine mRNAs were quantitated by an RNase protection method using the RiboQuant Multi-Probe RNase Protection Assay System (PharMingen) according to the instruction manual. Briefly, mouse cytokine mRNA-specific RNA probes labeled with [32P]UTP were synthesized using the multiprobe template sets mCK-1 and mCK-2B, and each probe set was hybridized separately overnight at 56°C with pulmonary mRNA or control mouse total RNA and yeast RNA and treated with RNase A followed by proteinase K. The remaining RNA was purified with phenol and chloroform and electrophoresed on 5% polyacrylamide sequencing gel in parallel with untreated probe as a marker. Radioactive bands were quantitated using a PhosphorImager 445 SI, the background was subtracted, and each species was expressed as a percentage of the L-32 housekeeping gene mRNA in the same RNA sample.
Isolation of pulmonary and spleen mononuclear cells (PMC and SMC). Lungs and spleens were removed following sacrifice, with material from each mouse processed separately. The lungs were rinsed, minced, and digested with 3,500 Dornase U of DNase I (Calbiochem)/ml and 75 U of collagenase (Life Technologies)/ml at 37°C for 2 h, adjusted to 0.01 M EDTA, chilled on ice, and filtered through 100-µm-pore-size nylon monofilament cloth (PGS). The cells were pelleted, resuspended, and subjected to centrifugation in Ficoll-Paque Plus solution (Amersham Pharmacia Biotech) at 400 × g and 20°C for 30 min. The PMC interface was collected, washed twice, and resuspended in 5 ml of RPMI 1640 medium (Life Technologies) containing 10% FBS, 100 U of penicillin/ml, and 100 µg of streptomycin sulfate/ml. For purification of SMC, the spleens were rinsed, mashed, washed, and subjected to differential centrifugation in Ficoll-Paque Plus solution as described above.
Assay of RSV-specific pulmonary and spleen cytotoxic T
lymphocytes (CTL).
BALB/c mice (five mice per group per day) were
infected with 106 PFU of rRSV/6120/mGM-CSF or
rRSV/6120 or were mock infected. PMC and SMC were isolated as described
above on days 5, 9, and 21 postinfection and assayed as described
below. On day 31, the remaining mice were challenged with
106 PFU of wt rRSV, and the cells were isolated
on day 37 (6 days postchallenge) and assayed. Cytolytic activity was
measured after the freshly isolated cells were incubated overnight
(7) with the peptide SYIGSINNI, representing
amino acids 82 to 90 of the M2-1 protein (27).
51Cr-labeled P815 target cells were pulsed for
2 h with 1 µM RSV-specific peptide. The peptide-labeled or
unlabeled target cells were mixed with PMC or SMC and incubated for
4 h at 37°C. The assays were performed in triplicate, and the
percent specific lysis was calculated as follows: [(experimental
release
spontaneous release)/(maximum release
spontaneous release)] × 100. Maximum release was determined from
supernatants of cells that were lysed by addition of 5% Triton X-100.
Spontaneous release was determined from the target cells incubated
without effector cells (6).
Intracellular cytokine staining and flow cytometric analysis of
pulmonary CD4+ cells.
To stimulate intracellular
cytokine accumulation, freshly isolated PMC (separately from each
mouse) were incubated at 37°C for 4 h in the presence of 2.5 ng
of phorbol 12-myristate 13-acetate (Sigma)/ml, 250 ng of ionomycin
(Sigma)/ml, and 6.5 µl of GolgiStop reagent (PharMingen)/ml. DNase I
was added to a final concentration of 3,500 Dornase U/ml, and
incubation was continued for an additional 10 min. The cells were
pelleted and resuspended in cold Cytostain Buffer (FBS)
(PharMingen). To block Fc receptors, cells at 106
per 100 µl were combined with 1 µg of purified rat anti-mouse CD16/CD32 (Fc
III/II receptor) and incubated for 15 min at 4°C. Then, the cells were diluted, pelleted, and washed, and 1 µg of Tri-Color-conjugated rat IgG2a against the mouse CD4 clone CT-CD4 (Caltag Laboratories) was added. The cells were incubated for 30 min at
4°C, washed, and simultaneously fixed and permeabilized by
resuspension in 250 µl of Cytofix/Cytoperm solution (PharMingen), incubation for 20 min at 4°C, and double washing with PermWash solution (PharMingen). To detect the accumulated cytokines, the cells
were resuspended in 100 µl of PermWash, and the following two
fluorochrome-labeled antibodies were added in the amounts which had
been optimized in preliminary experiments: (i) fluorescein isothiocyanate (FITC)-conjugated rat IgG1 against the mouse IFN-
clone XMG1.2 (PharMingen) and (ii) R-phycoerythrin
(R-PE)-conjugated rat IgG2b against the mouse IL-4 clone
BVD4-1D11 (PharMingen). The cells were incubated for 30 min at 4°C in
the dark, washed successively with PermWash and Cytostain buffer (FBS),
and resuspended in 500 µl of Cytostain buffer (FBS) each. The
specificity of staining was confirmed by isotype control and by
blocking performed by 30 min of preincubation (4°C) with 5 µg of an
unconjugated preparation of the same antibody. The isotype control for
the FITC-conjugated IFN-
-specific IgG1 rat antibody was
FITC-conjugated rat IgG1 clone R3-34 (PharMingen), and the control for
the Tri-Color-conjugated CD4-specific rat IgG2a antibody was conjugated
rat IgG2a clone LO-DNP-16 (Caltag Laboratories). Flow cytometry
analysis was performed using a FACSCalibur flow cytometer (Becton
Dickinson), and lymphocytes were gated as described previously
(24). A total of 60,000 lymphocytes were analyzed per
sample, excluding dead cells.
Flow cytometric analysis of pulmonary dendritic cells and macrophages. PMC from individual mice were treated to block Fc receptors as described above and combined with predetermined optimal amounts of the following fluorochromes added simultaneously: (i) FITC-labeled anti-mouse CD11b (clone M1/70; PharMingen), (ii) R-PE-labeled anti-mouse CD11c (clone HL3; PharMingen), and (iii) biotin-labeled anti-mouse I-Ad/I-Ed (clone 2G9; PharMingen). The cells were incubated for 30 min at 4°C in the dark, allophycocyanin-labeled streptavidin (PharMingen) was added, and the cells were incubated for a further 30 min at 4°C in the dark, washed twice with Hanks balanced salt solution-2% FBS, fixed by resuspension in 250 µl of Cytofix buffer (PharMingen) and incubation for 20 min at 4°C, and washed two more times. Flow cytometry analysis was performed, with 100,000 cells (excluding dead cells) analyzed per sample.
| |
RESULTS |
|---|
|
|
|---|
Construction and in vitro characterization of rRSV expressing mGM-CSF. A cDNA encoding mGM-CSF was placed under the control of RSV transcription gene start and gene end signals and inserted into the G-F intergenic region of an RSV antigenomic cDNA clone (Fig. 1). Recombinant virus was recovered and designated rRSV/mGM-CSF.
The growth of rRSV/mGM-CSF in HEp-2 cells was examined and was found to be delayed and reduced compared to that of its wt rRSV parent examined in parallel, with a maximum difference of 34-fold at 40 h postinfection (Fig. 2). However, the growth kinetics of rRSV/mGM-CSF in vitro were indistinguishable from those of rRSV/CAT, a previously described recombinant that contains a 735-nucleotide transcriptional unit encoding bacterial CAT (compared to 465 nt for the present mGM-CSF insert) inserted into the same genome locus. We have previously noted that the presence of a foreign insert attenuates RSV replication in vitro irrespective of its encoded protein (9-12). The basis for this attenuation has not been characterized in detail but appears to be increased genome length. Northern blot hybridization was used to monitor the expression of the inserted mGM-CSF gene as well as those of the RSV G, F, and L genes (data not shown). This confirmed that the mGM-CSF gene was expressed as a separate, abundant mRNA of the expected size. Transcription of the other genes was not affected significantly by the additional gene. In addition, RT-PCR analysis of viral RNA isolated from infected HEp-2 cells on the 10th passage in vitro did not reveal any evidence of deletion within the insert (data not shown), suggesting that the insert was stable, as has typically been observed for inserts in recombinant mononegaviruses. The concentration of mGM-CSF secreted into the medium of infected HEp-2 cells was approximately 1 µg/ml by 48 h postinfection (data not shown), a level of expression that was similar to those of IFN-
and IL-2 in previous studies (11, 12).
The reduced growth of the rRSV/mGM-CSF virus in vitro impeded the
preparation of a stock of sufficient titer for inoculation of mice. For
one experiment (Fig. 5), rRSV/mGM-CSF was
concentrated by centrifugation, but this resulted in considerable loss
of overall titer due to the lability of RSV infectivity. While this
work was in progress, we prepared another version of rRSV, called
rRSV/6120, in which most of the downstream noncoding region of the SH
gene was deleted without any change at the amino acid level (see
Materials and Methods). rRSV/6120 replicated approximately fivefold
more efficiently in vitro than its full-length rRSV parent, presumably due to the 112-nucleotide reduction in length. Therefore, we inserted the mGM-CSF transcription cassette into the rRSV/6120 backbone and
recovered the encoded virus, rRSV/6120/mGM-CSF. This virus is identical
to rRSV/mGM-CSF except for the above-mentioned noncoding deletion in
the SH gene. As expected, it replicated approximately fivefold more
efficiently in vitro than rRSV/mGM-CSF (not shown), and the
concentration of mGM-CSF secreted into the cell medium was
exactly the same as for rRSV/mGM-CSF (not
shown). rRSV/6120/mGM-CSF was used for in vivo experiments (Fig. 3, 4,
6, 7, and 8 and Table 1), with the parental rRSV/6120 as the control
virus.
|
|
|
|
|
Replication of rRSV/6120/mGM-CSF in mice is significantly attenuated compared to that of rRSV/6120. The replication of rRSV/6120/mGM-CSF in vivo was evaluated in parallel with that of its wt equivalent, rRSV/6120, by intranasal infection of BALB/c mice, after which the animals were sacrificed and virus titers in the lungs and nasal turbinates were determined by plaque assay (Fig. 3). In one experiment (Fig. 3, experiment 1), animals were each infected with 106 PFU of virus and the tissues were harvested on day 4. In a second experiment (Fig. 3, experiment 2), groups of animals received the same dose, 106 PFU, and were sacrificed for viral quantitation on day 3, 4, or 5 to examine the time course of infection. Other groups of animals received 105 or 104 PFU and were sacrificed for virus titration on day 4 in order to examine the extent of viral replication following a lower inoculum.
The titer of rRSV/6120/mGM-CSF was significantly lower than that of rRSV/6120 in both the upper and lower respiratory tract at all time points and all doses (P < 0.001 at any time point and any dose). For example, at the dose of 106 PFU, the difference between the two viruses was 10- to 74-fold depending on the location, time point, and particular experiment, with the exception of the lungs on day 5, when it was 588-fold. We previously showed that the presence of a foreign insert of this size at this site does not attenuate RSV in vivo by itself (11); therefore, the attenuation observed here is associated with expression of mGM-CSF. RT-PCR was used to confirm the expression of mGM-CSF mRNA in the lungs of animals infected with rRSV/mGM-CSF (not shown). Under the conditions of the assay, mGM-CSF mRNA was not detected in mock-infected or rRSV-infected animals but was readily detected in animals infected with rRSV/mGM-CSF (not shown).The induction of RSV-specific antibodies by rRSV/6120/mGM-CSF was not affected by its attenuation. Mice were infected with rRSV/6120/mGM-CSF or wt rRSV/6120 at a dose of 104, 105, or 106 PFU per animal, and serum samples were taken on days 28 and 56. The titer of RSV-specific serum IgG was measured by glycoprotein-specific ELISA using purified G and F proteins, and the titer of virus-neutralizing antibodies was measured by plaque reduction assay (Fig. 4). Despite the substantial degree of attenuation of rRSV/6120/mGM-CSF, its immunogenicity was very similar to that of its wt RSV counterpart for each viral inoculum.
Increased accumulation of pulmonary IFN-
and IL-12 p40 mRNA in
response to rRSV/mGM-CSF.
Mice were infected with rRSV/mGM-CSF or
wt rRSV, animals from each group were harvested 1 and 4 days later, and
total pulmonary RNA was isolated. The remaining animals were challenged
with wt RSV and harvested for pulmonary RNA isolation on days 29 and 32 (1 and 4 days postchallenge, respectively). The RNA samples were analyzed by an RNase protection assay with a commercially obtained kit
using the probes specific to IL-1
, IL-1
, IL-3, IL-4, IL-5, IL-6,
IL-9, IL-10, IL-12 p35, IL-12 p40, IL-13, IL-15, IFN-
, IL-1 receptor
antagonist, and macrophage migration inhibitory factor. An example of
an autoradiogram showing direct data is shown in Fig. 5A. The most
pronounced increases involved IFN-
and IL-12 p40 mRNA, and they are
summarized in Fig. 5B. The level of IFN-
mRNA was substantially
increased in response to rRSV/mGM-CSF compared to that in response to
wt rRSV on days 1 and 4 postinfection, by 65% (P < 0.02) and threefold (P < 0.001), respectively (Fig. 5). No significant difference was detected after the challenge. The
level of IL-12 p40 mRNA was increased by 42% (P < 0.05) in mice immunized with rRSV/mGM-CSF compared to the level in mice immunized with wt rRSV on day 4, whereas there was no significant difference on day 1. On day 29, there was no statistically significant difference, and on day 32, the level of IL-12 p40 mRNA was slightly greater (25%) in mice immunized with wt rRSV than in those immunized with rRSV/mGM-CSF (P < 0.05). IL-6 mRNA exhibited a
marginal increase on day 4 in response to rRSV/6210/mGM-CSF. The
remaining cytokine mRNAs were not affected by infection with either
virus under these conditions.
The CTL response to rRSV/6120/mGM-CSF was moderately diminished compared to the response to rRSV/6120. We next compared the abilities of rRSV/mGM-CSF and rRSV/6120 to stimulate RSV-specific CTL. Groups of 20 mice each were mock infected or infected with rRSV/6120/mGM-CSF or rRSV/6120. Five animals from each group were sacrificed on days 5, 9, and 21 postinfection, and the levels of RSV-specific primary spleen and pulmonary CTL were assayed using target cells that had been prepared by incubation with a synthetic peptide containing amino acids 82 to 90 of the RSV M2-1 protein. We previously showed that this sequence contains an immunodominant epitope for major histocompatibility complex class I (MHCI) (H2d)-restricted CD8+ CTL in BALB/c mice (27). The remaining five animals in each group were challenged intranasally with rRSV on day 31 and sacrificed for CTL assay on day 37 (6 days postchallenge).
RSV-specific CTL activity was undetectable for any group in the mononuclear cell fraction isolated from either the lung or the spleen on days 5 and 21 (data not shown). On day 9, pulmonary CTL activity was detected from mice infected with rRSV/6120/mGM-CSF or rRSV/6120, with the level of specific activity (percent lysis of pulse-labeled cells
percent lysis of unlabeled cells) associated with the
former being somewhat lower than that for the latter: 14.24% (standard
error [SE], 1.29) versus 23.05% (SE, 2.39), respectively (P < 0.02) (here and below, the effector-to-target
ratio was 50:1) (Fig. 6). In the spleen at this same time point, there
was a low level of RSV-specific CTL activity, which was not
statistically significant between the two viruses.
RSV-specific pulmonary CTL also were detected on day 37 (6 days
postchallenge) (Fig. 6). The level of CTL in mice that had received
rRSV/6120/mGM-CSF in the initial inoculation was somewhat reduced
compared to the level in those that had received rRSV/6120: 6.81% (SE,
1.59) versus 10.86% (SE, 1.36), however, this difference was not
statistically significant. The level of RSV-specific CTLs in the spleen
at this time point was negligible. Thus, expression of GM-CSF was
associated with a moderate reduction of the CTL response during the
initial infection.
Expression of mGM-CSF by rRSV results in increased levels of PMC,
total pulmonary CD4+ T lymphocytes, and IFN-
-positive
and IL-4-positive CD4+ T lymphocytes.
Groups of BALB/c
mice were infected with 106 PFU of
rRSV/6120/mGM-CSF or wt rRSV/6120 or were mock infected. Animals from
each group were sacrificed on days 5 and 10, and lungs were harvested and processed to isolate PMC. The remaining mice were challenged intranasally on day 28 with 106 PFU of wt rRSV
and sacrificed on days 32 and 38 (4 and 10 days postchallenge), and PMC
were isolated. Fresh cells were counted, stimulated in vitro to
accumulate intracellular cytokines, stained immunologically for CD4,
IFN-
, and IL-4, and analyzed by flow cytometry (Table 1).
and IL-4, which
are markers for the Th1 and Th2 subsets, respectively. This showed that
infection with wt rRSV/6120 resulted in large increases in cells
positive for IFN-
or IL-4 (23.5- and 5.5-fold increases,
respectively, on day 10 compared to the mock-infected animals). As is
characteristic of this model, the number of IL-4-positive cells was
substantially less than the number of IFN-
-positive cells. Also,
most of the CD4+ T lymphocytes were not positive
for either cytokine. Similar results were observed in response to
rRSV/6120/mGM-CSF, except that the numbers of cells positive for
IFN-
or IL-4 were higher on days 5 and 10 than those in mice
infected with the rRSV/6120 parent. For example, on day 5, there were
4.2- and 9.9-fold more IFN-
-positive and IL-4-positive
CD4+ cells, respectively, in animals infected
with rRSV/6120/mGM-CSF than in those infected with rRSV/6120, and on
day 10 the differences were 1.7- and 2.1-fold, respectively. Thus, the
total magnitude of the response of each of the two
CD4+ subsets, as well as the rapidity of the
response, was greater in animals infected with rRSV/6120/mGM-CSF.
These results showed that expression of mGM-CSF during RSV infection
was associated with a more rapid increase in PMC, total pulmonary
CD4+ T lymphocytes, IFN-
-positive pulmonary
CD4+ T cells, and IL-4-positive
CD4+ T cells during the initial infection. The
proportionate stimulations of the Th1 and Th2 subsets were
similar. The response to the wt rRSV challenge did not appear to
be greatly different whether the initial infecting virus was rRSV/6120
or rRSV/6120/GM-CSF.
Increased pulmonary dendritic cells and macrophages in response to expression of mGM-CSF. Groups of mice were infected with rRSV/6120/mGM-CSF or rRSV/6120 (four mice per group per day) or mock infected (two mice per group per day). Total PMC were isolated on days 5, 8, and 9 postinfection; labeled for CD11b, CD11c, and MHCII molecules; and analyzed by flow cytometry. The nonlymphoid fraction of freshly isolated PMC was identified by forward-side scatter characteristics (region R1) (Fig. 7A) and was analyzed further on the basis of expression of CD11b and CD11c (Fig. 7B) to identify three populations, namely, resident lung lymphoid dendritic cells (CD11blow/CD11cbright; region R2), myeloid dendritic cells (CD11bbright/CD11cbright; region R3), and macrophages (CD11bbright/CD11clow; region R4). Dot plots for representative individual mice are shown in Fig. 7B, and the calculated mean number of cells of each population is shown in Fig. 7C.
Infection with rRSV/6120 did not significantly increase the accumulation of any of these cell populations on any day compared to the mock-infected control, although for each population on each day the mean cell number was marginally greater for the rRSV/6120-infected animals. In contrast, infection with rRSV/6120/GM-CSF resulted in a large increase (up to fourfold) in each cell population on each day, with the exception of R2 on day 9.Activation of pulmonary dendritic cells in mice infected with rRSV/6120/mGM-CSF. We further analyzed the R2 (lymphoid dendritic cell), R3 (myeloid dendritic cell), and R4 (macrophage) cell subpopulations isolated on days 5, 8, and 9 postinfection to quantify the expression of MHCII molecules as a measure of activation. The results for days 5 and 8 are shown in Fig. 8. On day 5, the mean expression of MHCII was increased for the lymphoid and myeloid dendritic cells (R2 and R3 regions, respectively) from mice infected with rRSV/6120/mGM-CSF compared to those infected with wt rRSV/6120 (2.6- and 1.6-fold greater mean fluorescence). In contrast, the mean fluorescence of MHCII molecules in the macrophage subpopulation (R4 region) was 2.0-fold lower in animals infected with rRSV/6120/mGM-CSF. However, since the overall number of macrophages in these animals was increased 4.0-fold, the increase in numbers of MHCII-positive cells may compensate for that. On days 8 (Fig. 8) and 9 (not shown), the mean levels of expression of MHCII on lymphoid dendritic cells (R2 region) were similar for mice infected with the two viruses, but that for myeloid dendritic cells (R3) and macrophages (R4) was somewhat lower for mice infected with wt rRSV/6120/mGM-CSF versus rRSV/6120, although as indicated above, this was offset by the greater number of dendritic cells and macrophages in animals infected with rRSV/6120/mGM-CSF.
| |
DISCUSSION |
|---|
|
|
|---|
A promising strategy for a pediatric RSV vaccine involves immunization by intranasal infection with live attenuated RSV (36). rRSV can be attenuated by the staged introduction of known attenuating mutations via the cDNA intermediate, and various candidates are under clinical evaluation. However, all of the attenuating mutations that have been identified to date reduce the magnitude of viral replication in vivo. Unfortunately, this also appears to reduce the immunogenicity of the virus, probably due to a decreased number of infected cells and decreased antigen expression. For example, infection of chimpanzees with the attenuated vaccine candidate cpts248/404 induced a titer of RSV-neutralizing serum antibodies that was reduced 9.2-fold compared to that with wt RSV (19). A second problem associated with any pediatric RSV vaccine is the fact that the immune response of young infants, the vaccine target population, is reduced due to immunologic immaturity and the immunosuppressive effects of maternally derived RSV-specific serum antibodies present in that age group. To test the possibility of improving the immunogenicity of RSV, we constructed an rRSV expressing mGM-CSF and evaluated its replication and immunogenicity in mice. GM-CSF is well known to be a major stimulatory cytokine for dendritic cells, representing the most efficient antigen-presenting cells, and for macrophages, which have important roles in innate and adaptive immunity as effector cells, as cytokine-secreting cells, and in antigen presentation.
Replication of rRSV/6120/mGM-CSF in the respiratory tracts of mice was reduced approximately 50-fold compared to the parental virus, an effect that was specific to mGM-CSF. Thus, expression of this cytokine attenuated the virus. Despite this high degree of attenuation, rRSV/6120/mGM-CSF was at least as immunogenic as the control virus with regard to the induction of RSV-binding and RSV-neutralizing serum antibodies. As described below, this probably reflects the increased accumulation and activation of pulmonary antigen-presenting cells. On the other hand, there was a modest reduction in the induction of RSV-specific CD8+ CTL during the initial infection. This might be a consequence of reduced antigen expression due to attenuation of the virus.
Infection with rRSV/mGM-CSF was associated with an increased
accumulation of pulmonary mRNA for IFN-
and IL-12 p40 compared to
infection with wt rRSV. The increased production of IFN-
likely reflects increased stimulation of CD4+ T
lymphocytes as detected by flow cytometry. NK cells can be activated by
GM-CSF, and they represent another likely source of IFN-
,
particularly on day 1 postinfection. Monocytes, macrophages, and
dendritic cells probably were the source for the increased expression
of IL-12 p40 mRNA, either as a direct effect of mGM-CSF or due to the
increased CD4+ T cell help and expression of
IFN-
. Interestingly, the magnitude of expression of pulmonary
IFN-
mRNA in response to rRSV/mGM-CSF was very similar to that
described previously for a comparable rRSV expressing mIFN-
(11) and thus represents a high level. Indeed, the level
of attenuation of rRSV/mGM-CSF was very similar to that observed
previously for rRSV/mIFN-
, suggesting that attenuation in each case
was mediated in large part by the antiviral effects of IFN-
.
We also examined the accumulation and activation of PMC, and in
particular of subpopulations representing CD4+ T
lymphocytes, lymphoid dendritic cells, myeloid dendritic cells, and
macrophages. Infection with rRSV/6120 resulted in a large, rapid
increase in total PMC compared to mock-infected controls, and this
increase occurred more rapidly during infection with rRSV/6120/mGM-CSF
(2.7-fold greater on day 5 than during infection with rRSV/6120).
Similarly, infection with rRSV/6120 resulted in a large, rapid increase
in the number of CD4+ T lymphocytes, and this
also occurred more rapidly during infection with rRSV/6120/mGM-CSF
(4.5-fold greater on day 5 than in infection with rRSV/6120). The
number of CD4+ T lymphocytes expressing IFN-
(Th1 cells) or IL-4 (Th2 cells) also was increased with
rRSV/6120/mGM-CSF compared to wt rRSV/6120, and this difference was
observed on both days 5 and 10 and thus involved both a more rapid and
a higher-magnitude response. Thus, infection with RSV resulted in a
substantial increase in pulmonary CD4+
lymphocytes that involved both the Th1 and Th2 subsets and was not
strongly biased towards either, and these effects were augmented by the
expression of mGM-CSF. In contrast, the CD4+
response to the wt RSV challenge was the same whether the initial infection involved rRSV/6120 or rRSV/6120/mGM-CSF. As indicated by this
finding, the cytokines that we have expressed from rRSV to date do not
appear to skew the immune response to subsequent exposure to RSV
antigens, which probably is a desirable property.
The most striking effect associated with expression of mGM-CSF was the large increase in pulmonary lymphoid and myeloid dendritic cells and pulmonary macrophages (up to fourfold, compared to rRSV/6120). This difference was greatest on day 5 but also was apparent on days 8 and 9 following infection. These cells also exhibited increased expression of MHCII molecules, a marker of activation, in response to rRSV/6120/mGM-CSF compared to that in response to rRSV/6120: on day 5 the level of MHCII expression was greater for the dendritic cells on the basis of both mean expression and number of positive cells, whereas for macrophages and myeloid dendritic cells on days 8 and 9, the mean expression was somewhat reduced, but the greater number of positive cells may compensate for that. These results indicate that mGM-CSF produced by the rRSV acted to increase the accumulation, proliferation, and activation of pulmonary dendritic cells and macrophages. This likely resulted in a higher level of antigen presentation in the context of MHCII molecules and increased stimulation of CD4+ T lymphocytes and B cells, accounting for the high level of RSV-specific antibodies despite the reduced level of virus replication.
It should be noted that the mouse is only semipermissive to RSV replication. As indicated in Fig. 3, the peak levels of virus replication are not high, and the duration of replication peaks at day 4 or 5 and rapidly declines (3). The greatest number of dendritic cells and macrophages, and the highest level of activation, was observed at that time. The slightly lower levels of activation observed on days 8 and 9 occurred at a time when virus shedding is not detected and infection has largely been resolved. This might explain the reduced level of MHCII expression for myeloid dendritic cells and macrophages on those days. If this is so, it might be that the short-lived nature of the infection in BALB/c mice under these conditions results in an incomplete evaluation of the effects of expression of mGM-CSF. For example, the rapid resolution of infection would result in a rapid cessation of mGM-CSF production, which might limit the recruitment, proliferation, and activation of the dendritic cells and macrophages. It will be important to evaluate the effect of expression of immune modulatory molecules such as GM-CSF in primates, where RSV infection is more long-lived and closely resembles infection in humans.
| |
ACKNOWLEDGMENTS |
|---|
We thank Myron Hill, Kim Tran, Ernie Williams, and Fatemah Dawoodi for technical assistance. We also thank David Stephany of the NIAID Flow Cytometry Section for skilled assistance, advice, and the use of equipment.
This work is part of a continuing program of research and development with Wyeth Lederle Vaccines through CRADA grants AI-000087 and AI-000099.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Building 7, Room 100, NIAID, NIH, 7 Center MSC 0720, Bethesda, MD 20892-0720. Phone: (301) 594-1590. Fax: (301) 496-8312. E-mail: AB176v{at}nih.gov.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ahlers, J. D., N. Dunlop, D. W. Alling, P. L. Nara, and J. A. Berzofsky. 1997. Cytokine-in-adjuvant steering of the immune response phenotype to HIV-1 vaccine constructs: granulocyte-macrophage colony-stimulating factor and TNF-alpha synergize with IL-12 to enhance induction of cytotoxic T lymphocytes. J. Immunol. 158:3947-3958[Abstract]. |
| 2. |
American Academy of Pediatrics Committee on Infectious Diseases and Committee on Fetus and Newborn.
1998.
Prevention of respiratory syncytial virus infections: indications for the use of palivizumab and update on the use of RSV-IGIV.
Pediatrics
102:1211-1216 |
| 3. |
Anderson, J. J.,
J. Norden,
D. Saunders,
G. L. Toms, and R. Scott.
1990.
Analysis of the local and systemic immune responses induced in BALB/c mice by experimental respiratory syncytial virus infection.
J. Gen Virol.
71:1561-1570 |
| 4. |
Anjuere, F.,
P. Martin,
I. Ferrero,
M. Fraga,
G. del Hoyo,
N. Wright, and C. Ardavin.
1999.
Definition of dendritic cell subpopulations present in the spleen, Peyer's patches, lymph nodes, and skin of the mouse.
Blood
93:590-598 |
| 5. |
Belyakov, I. M.,
J. D. Ahlers,
J. D. Clements,
W. Strober, and J. A. Berzofsky.
2000.
Interplay of cytokines and adjuvants in the regulation of mucosal and systemic HIV-specific CTL.
J. Immunol.
165:6454-6462 |
| 6. |
Belyakov, I. M.,
M. A. Derby,
J. D. Ahlers,
B. L. Kelsall,
P. Earl,
B. Moss,
W. Strober, and J. A. Berzofsky.
1998.
Mucosal immunization with HIV-1 peptide vaccine induces mucosal and systemic cytotoxic T lymphocytes and protective immunity in mice against intrarectal recombinant HIV-vaccinia challenge.
Proc. Natl. Acad. Sci. USA
95:1709-1714 |
| 7. | Belyakov, I. M., J. Wang, R. Koka, J. D. Ahlers, J. T. Snyder, R. Tse, J. Cox, J. S. Gibbs, D. Margulies, and J. A. Berzofsky. Activating CTL precursors to reveal the CTL repertoire without skewing caused by in vitro stimulation. Eur. J. Immunol, in press. |
| 8. |
Bermingham, A., and P. L. Collins.
1999.
The M2-2. protein of human respiratory syncytial virus is a regulatory factor involved in the balance between RNA replication and transcription.
Proc. Natl. Acad. Sci. USA
96:11259-11264 |
| 9. |
Bukreyev, A.,
E. Camargo, and P. L. Collins.
1996.
Recovery of infectious respiratory syncytial virus expressing an additional, foreign gene.
J. Virol.
70:6634-6641 |
| 10. | Bukreyev, A., B. R. Murphy, and P. L. Collins. 2000. Respiratory syncytial virus can tolerate an intergenic sequence of at least 160 nucleotides with little effect on transcription or replication in vitro and in vivo: J. Virol. 74:11017-11026. |
| 11. |
Bukreyev, A.,
S. S. Whitehead,
N. Bukreyeva,
B. R. Murphy, and P. L. Collins.
1999.
Interferon gamma expressed by a recombinant respiratory syncytial virus attenuates virus replication in mice without compromising immunogenicity.
Proc. Natl. Acad. Sci. USA
96:2367-2372 |
| 12. |
Bukreyev, A.,
S. S. Whitehead,
C. Prussin,
B. R. Murphy, and P. L. Collins.
2000.
Effect of coexpression of interleukin-2 by recombinant respiratory syncytial virus on virus replication, immunogenicity, and production of other cytokines.
J. Virol.
74:7151-7157 |
| 13. |
Coates, H. V.,
D. W. Alling, and R. M. Chanock.
1966.
An antigenic analysis of respiratory syncytial virus isolates by a plaque reduction neutralization test.
Am. J. Epidemiol.
83:299-313 |
| 14. |
Collins, P. L.,
M. G. Hill,
E. Camargo,
H. Grosfeld,
R. M. Chanock, and B. R. Murphy.
1995.
Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development.
Proc. Natl. Acad. Sci. USA
92:11563-11567 |
| 15. |
Collins, P. L.,
M. G. Hill,
J. Cristina, and H. Grosfeld.
1996.
Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus.
Proc. Natl. Acad. Sci. USA
93:81-85 |
| 16. | Collins, P. L., K. McIntosh, and R. M. Chanock. 1996. Respiratory syncytial virus, p. 1313-1352. In B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven, Philadelphia, Pa. |
| 17. |
Connors, M.,
P. L. Collins,
C. Y. Firestone, and B. R. Murphy.
1991.
Respiratory syncytial virus (RSV) F, G, M2 (22K), and N proteins each induce resistance to RSV challenge, but resistance induced by M2 and N proteins is relatively short-lived.
J. Virol.
65:1634-1637 |
| 18. |
Connors, M.,
N. A. Giese,
A. B. Kulkarni,
C. Y. Firestone,
H. C. R. Morse, and B. R. Murphy.
1994.
Enhanced pulmonary histopathology induced by respiratory syncytial virus (RSV) challenge of formalin-inactivated RSV-immunized BALB/c mice is abrogated by depletion of interleukin-4 (IL-4) and IL-10.
J. Virol.
68:5321-5325 |
| 19. | Crowe, J. E., Jr., P. T. Bui, A. R. Davis, R. M. Chanock, and B. R. Murphy. 1994. A further attenuated derivative of a cold-passaged temperature-sensitive mutant of human respiratory syncytial virus retains immunogenicity and protective efficacy against wild-type challenge in seronegative chimpanzees. Vaccine 12:783-790[CrossRef][Medline]. |
| 20. |
Disis, M. L.,
H. Bernhard,
F. M. Shiota,
S. L. Hand,
J. R. Gralow,
E. S. Huseby,
S. Gillis, and M. A. Cheever.
1996.
Granulocyte-macrophage colony-stimulating factor: an effective adjuvant for protein and peptide-based vaccines.
Blood
88:202-210 |
| 21. |
Dranoff, G.,
E. Jaffee,
A. Lazenby,
P. Golumbek,
H. Levitsky,
K. Brose,
V. Jackson,
H. Hamada,
D. Pardoll, and R. C. Mulligan.
1993.
Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity.
Proc. Natl. Acad. Sci. USA
90:3539-3543 |
| 22. | Hancock, G. E., D. J. Speelman, K. Heers, E. Bortell, J. Smith, and C. Cosco. 1996. Generation of atypical pulmonary inflammatory responses in BALB/c mice after immunization with the native attachment (G) glycoprotein of respiratory syncytial virus. J. Virol. 70:7783-7791[Abstract]. |
| 23. | Hussell, T., C. J. Baldwin, A. O'Garra, and P. J. Openshaw. 1997. CD8+ T cells control Th2-driven pathology during pulmonary respiratory syncytial virus infection. Eur. J. Immunol. 27:3341-3349[Medline]. |
| 24. |
Hussell, T.,
L. C. Spender,
A. Georgiou,
A. O'Garra, and P. J. Openshaw.
1996.
Th1 and Th2 cytokine induction in pulmonary T cells during infection with respiratory syncytial virus.
J. Gen Virol.
77:2447-2455 |
| 25. | Iwasaki, A., B. J. Stiernholm, A. K. Chan, N. L. Berinstein, and B. H. Barber. 1997. Enhanced CTL responses mediated by plasmid DNA immunogens encoding costimulatory molecules and cytokines. J. Immunol. 158:4591-4601[Abstract]. |
| 26. |
Kim, H. W.,
J. G. Canchola,
C. D. Brandt,
G. Pyles,
R. M. Chanock,
K. Jensen, and R. H. Parrott.
1969.
Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine.
Am. J. Epidemiol.
89:422-434 |
| 27. | Kulkarni, A. B., P. L. Collins, I. Bacik, J. W. Yewdell, J. R. Bennink, J. E. Crowe, Jr., and B. R. Murphy. 1995. Cytotoxic T cells specific for a single peptide on the M2 protein of respiratory syncytial virus are the sole mediators of resistance induced by immunization with M2 encoded by a recombinant vaccinia virus. J. Virol. 69:1261-1264[Abstract]. |
| 28. | Murphy, B. R., A. V. Sotnikov, L. A. Lawrence, S. M. Banks, and G. A. Prince. 1990. Enhanced pulmonary histopathology is observed in cotton rats immunized with formalin-inactivated respiratory syncytial virus (RSV) or purified F glycoprotein and challenged with RSV 3 to 6 months after immunization. Vaccine 8:497-502[CrossRef][Medline]. |
| 29. | Okada, E., S. Sasaki, N. Ishii, I. Aoki, T. Yasuda, K. Nishioka, J. Fukushima, J. Miyazaki, B. Wahren, and K. Okuda. 1997. Intranasal immunization of a DNA vaccine with IL-12- and granulocyte-macrophage colony-stimulating factor (GM-CSF)-expressing plasmids in liposomes induces strong mucosal and cell-mediated immune responses against HIV-1 antigens. J. Immunol. 159:3638-3647[Abstract]. |
| 30. |
Openshaw, P. J., and C. Hewitt.
2000.
Protective and harmful effects of viral infections in childhood on wheezing disorders and asthma.
Am. J. Respir. Crit. Care
162:S40-S43 |
| 31. |
Schlender, J.,
B. Bossert,
U. Buchholz, and K. K. Conzelmann.
2000.
Bovine respiratory syncytial virus nonstructural proteins NS1 and NS2 cooperatively antagonize alpha/beta interferon-induced antiviral response.
J. Virol.
74:8234-8242 |
| 32. |
Srikiatkhachorn, A., and T. J. Braciale.
1997.
Virus-specific CD8+ T lymphocytes downregulate T helper cell type 2 cytokine secretion and pulmonary eosinophilia during experimental murine respiratory syncytial virus infection.
J. Exp. Med.
186:421-432 |
| 33. | Vremec, D., G. Lieschke, A. Dunn, L. Robb, D. Metcalf, and K. Shortman. 1997. The influence of granulocyte/macrophage colony-stimulating factor on dendritic cell levels in mouse lymphoid organs. Eur. J. Immunol. 27:40-44[Medline]. |
| 34. |
Wang, J.,
D. Snider,
B. Hewlett,
N. Lukacs,
J. Gauldie,
H. Liang, and Z. Xing.
2000.
Transgenic expression of granulocyte-macrophage colony-stimulating factor induces the differentiation and activation of a novel dendritic cell population in the lung.
Blood
95:2337-2345 |
| 35. | Waris, M. E., C. Tsou, D. D. Erdman, D. B. Day, and L. J. Anderson. 1997. Priming with live respiratory syncytial virus (RSV) prevents the enhanced pulmonary inflammatory response seen after RSV challenge in BALB/c mice immunized with formalin-inactivated RSV. J. Virol. 71:6935-6939[Abstract]. |
| 36. | Wright, P., R. Karron, R. Belshe, J. Thompson, J. Crowe, Jr., T. Boyce, L. Halburnt, G. Reed, S. Whitehead, E. Anderson, A. Wittek, R. Casey, M. Eichelberger, B. Thumar, V. Randolph, S. Udem, R. Chanock, and B. Murphy. 2000. Evaluation of a live, cold-passaged, temperature-sensitive, respiratory syncytial virus vaccine candidate in infancy. J. Infect. Dis. 182:1331-1342[CrossRef][Medline]. |
| 37. | Xiang, Z., and H. C. Ertl. 1995. Manipulation of the immune response to a plasmid-encoded viral antigen by coinoculation with plasmids expressing cytokines. Immunity 2:129-135[CrossRef][Medline]. |
This article has been cited by other articles: