Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Guan, Y. Articles by Wainberg, M. A. Search for Related Content PubMed PubMed Citation Articles by Guan, Y. Articles by Wainberg, M. A.

 Previous Article  |  Next Article 

Journal of Virology, December 2001, p. 11924-11929, Vol. 75, No. 23
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.23.11924-11929.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

An Intact U5-Leader Stem Is Important for Efficient Replication of Simian Immunodeficiency Virus

Yongjun Guan,^1, Karidia Diallo,^1,2 James B. Whitney,^1,2 Chen Liang,^1,2 and Mark A. Wainberg^1,2,*

McGill AIDS Center, Lady Davis Institute-Jewish General Hospital, Montreal, Quebec, Canada H3T 1E2,¹ and Department of Microbiology & Immunology, McGill University, Montreal, Quebec, Canada H3A 2B4²

Received 31 May 2001/Accepted 5 September 2001

	ABSTRACT

Top Abstract Text References

Previous work has shown that four deletions in simian immunodeficiency virus (SIV), termed SD1a, SD1b, SD1c, and SD6, which eliminated sequences at nucleotide positions 322 to 362, 322 to 370, 322 to 379, and 371 to 379, respectively, located downstream of the primer binding site, impaired viral replication capacity to different extents. Long-term culturing of viruses containing the SD1a, SD1b, and SD6 deletions led to revertants that possessed wild-type replication kinetics. We now show that these revertants retained the original deletions in each case but that novel additional mutations were also present. These included a large deletion termed D1 (nt +216 to +237) within the U5 region that was shown to be biologically relevant to reversion of both the SD1a and SD1b constructs. In the case of SD6, two compensatory point mutations, i.e., A+369G, termed M1, located immediately upstream of the SD6 deletion, and C+201T, termed M2, within U5, were identified and could act either singly or in combination to restore viral replication. Secondary structure suggests that an intact U5-leader stem is important in SIV for infectiousness and that the additional mutants described played important roles in restoration of this motif.

	TEXT

Top Abstract Text References

Simian immunodeficiency virus (SIV) and human immunodeficiency virus type 1 (HIV-1) both contain a long 5' untranslated leader sequence that includes the R and U5 regions and the primer binding site (PBS), as well as leader sequences downstream of the PBS(12). Although the 5' leader sequences of SIV are much longer than those of HIV-1 and share little homology, both possess similar, highly structured elements that are important for viral replication (6, 31). These include two critical stem-loop structures in the R region, i.e., the TAR and poly(A) hairpins, the U5-IR stem-loop and the U5-leader stem in the PBS region, and four distinct stem-loop structures in the region downstream of the PBS (2, 5, 9, 13, 22). The TAR hairpin is important for viral gene transcription, translation, reverse transcription, and viral RNA packaging (4, 13, 21, 23, 25). The poly(A) hairpin plays roles in regard to the regulatory polyadenylation signal and in viral RNA packaging (15, 17). Sequences that form complex RNA structures in the PBS region are also important for viral reverse transcription (1, 3, 14, 24). The four stem-loom structures downstream of the PBS form the packaging signal that contributes to encapsidation of viral RNA. They include a putative dimer initiation site , i.e., stem-loop 1 (SL1), which has been implicated in both RNA dimerization and packaging, SL2, which contains the major splice donor signal, and both SL3 and SL4 (7, 8, 26, 29, 33).

HIV-1 and SIV specifically encapsidate two copies of viral genomic RNA that form a dimer through noncovalent linkages at their 5' end (12). Studies with HIV-1 have shown that elements involved in the specific packaging of viral RNA are located in the 5' viral leader sequence (8). However, almost all regions in the leader sequence contribute to RNA packaging. The four stem-loop structures, i.e., SL1 to SL4, constitute the encapsidation signals that determine selective encapsidation of viral genomic RNA (10, 30). In HIV-1, the TAR and R-U5 stem-loop structures were shown to contribute to viral RNA packaging, as were sequences between the PBS and SL1 (11, 16, 23, 27). Interestingly, participation by the TAR and poly(A) structures in viral RNA packaging requires intact TAR and poly(A) stem structures rather than their precise sequences (11). This suggests that the encapsidation of viral RNA probably involves specific interactions between viral proteins and leader RNA sequences that exist within constraints of proper tertiary structure that are highly conserved in both HIV-1 and SIV.

Using the SIVmac239 clone, we had previously generated four deletion mutants, termed SD1a, SD1b, SD1c, and SD6, in which we had eliminated sequences downstream of the PBS at nucleotides 322 to 362, 322 to 370, 322 to 379, and 371 to 379, respectively (19, 20). Each of these mutants was impaired in viral replication, although the degree of impairment varied in each case. Interestingly, deletion of the lower part of the U5-leader stem (SD1c, SD6) compromised viral RNA packaging, while deletion of the upper part (SD1a, SD1b) did not. In the present study, we have used a "forced evolution" strategy to further pursue the role of the U5-leader stem structure in viral RNA packaging and replication and have investigated the potential reversion of deletions in this region over protracted periods in CEMx174 cells.

Long-term culturing of deletion viruses results in revertants that contain novel mutations. We infected CEMx174 cells as described previously (18, 28, 32) with our various deletion viruses that were recovered from transfected COS7 cells, and we passaged these viruses in fresh CEMx174 cells until wild-type replication kinetics were observed. As previously shown, forced replication of these viruses led to high levels of reverse transcriptase (RT) activity in culture fluids after four passages (19, 20). Accordingly, cellular DNA from infected cells was extracted at this time, and a long viral DNA fragment spanning the region from U3 to the end of Gag was amplified and cloned as described (19). Six clones for each viral construct were sequenced, and the results demonstrated that the reverted viruses in each of these cases, i.e., SD1a, SD1b, and SD6, maintained the original deletions. However, additional mutations were identified, which included a novel 22-nt additional deletion at positions +216 to +237 (termed D1) in the upstream U5 region of all six clones of the SD1a revertant and in two of six clones of the SD1b revertant. In the case of SD6, two novel point mutations were identified, i.e., a substitution from A to G at position +369 (termed M1) and a substitution from C to T at position +201 (termed M2) (Fig. 1). Four of the six clones related to the SD6 revertant contained the M1 mutation, and three of the six clones contained the M2 mutation (one clone contained both M1 and M2).

View larger version (28K): [in this window] [in a new window]   FIG. 1.   Illustration of the deletion constructs used in this study and the compensatory mutations identified. The secondary structure of the U5-leader stem of SIVmac239 leader RNA is shown. The positions of deletion and compensatory mutations are shown relative to the transcription initiation site and are indicated next to the RNA structure. These positions are also indicated in the diagram of RNA secondary structure. Compensatory mutations are in bold. The free energy of the structure was 62.1 kilocalories per mole, as calculated using the Zuker algorithm (35).

Biological relevance of the novel mutations. To pursue the biological relevance of these changes, we performed site-directed and PCR mutagenesis to introduce each of these mutations into the corresponding SIV deletion constructs as described previously (19). The D1 deletion was introduced into both SD1a and SD1b, using the primer (5'CCUAGCCGCCGCCUGGUAAGACCCUGGTCTGUUAGG3'), and the resultant constructs were termed SD1a-D1 and SD1b-D1, respectively. The M1 and M2 point mutations were introduced individually or together into SD6, using the primers pSD6-M1 (5' GGCUGAGTGAA GGCAGTAGGAACCAACCACGACGGAG3') and pSU5-M2 (5'GUGUGUGUUCCCAU CUCUCUUAGCCGCCGCCTGGU3') to yield SD6-M1, SD6-M2, and SD6M1M2, respectively. These DNA clones were transfected into COS-7 cells, and the viruses thereby recovered were assayed for viral replication capacity in CEMx174 cells.

As shown in Fig 2A, the SD1a-D1 construct was able to replicate as efficiently as wild-type virus; thus, the decreased infectiousness caused by the SD1a deletion, located downstream of the PBS, was restored by the additional D1 deletion within the U5 region upstream of the PBS. The SD1b-D1 construct also replicated more efficiently than did SD1b in CEMx174 cells (Fig. 2B), showing that the D1 deletion also partially contributed to reversion of the SD1b mutant. The SD6M1, SD6M2, and SD6M1M2 viruses were all improved in replication capacity over SD6, showing that the M1 and M2 point mutations also possessed biological relevance (Fig. 2C).

View larger version (44K): [in this window] [in a new window]   FIG. 2.   Infectiousness of revertant viruses in CEMx174 cells. Equivalent amounts of viruses recovered from transfected COS-7 cells, based on levels of p27 antigen (10 ng per 106 cells), were used to infect CEMx174 cells. Viral replication was monitored by RT assay of culture fluids. Mock infection (Mock) denotes exposure of cells to heat-inactivated wild-type virus (WT) as a negative control. (A) Growth curves of reverted viruses of SD1a. (B) Growth curves of reverted viruses of SD1b. (C) Growth curves of reverted viruses of SD6. All deletion viruses containing mutational inserts replicated as well as wild types (P > 0.1, paired t test), while the nonrepaired viruses were replication impaired in each case (P < 0.01, paired t test). (D) Infectiousness of wild-type and revertant viruses determined by 50% tissue culture infective dose (TCID50) assay in infection of CEMx174 cells as described previously (18).

The infectiousness of these various constructs was also determined by 50% tissue culture infective dose assay in CEMx174 cells as described previously (18). The results shown in Fig. 2D are consistent with those obtained in the replication assays described above. Therefore, each of the novel mutations, i.e., D1, M1, and M2, is biologically relevant to the increased replication of the deleted viruses.

Both the M1 and the M2 point mutations can correct defective viral RNA packaging. Previous studies showed that the SD1a and SD1b deletions did not impair viral RNA packaging but did affect the processing of the Gag precursor, while the SD6 deletion resulted in both decreased packaging of viral RNA and decreased Gag precursor processing (20). To shed light on the mechanisms of compensatory mutagenesis involved, we monitored levels of viral RNA packaging in certain of our constructs by RT-PCR (19). Figure 3 shows that the SD6 viruses containing either the M1, M2, or both the M1 and M2 point mutations all packaged viral RNA at levels similar to those for wild-type virus, while the SD6 deletion construct was impaired in this regard. Therefore, both the M1 and M2 mutations can correct the deficit in viral RNA packaging associated with the SD6 virus. We also studied Gag processing by radiolabeling viral proteins and by immunoprecipitation with monoclonal antibodies directed against SIV p27 capsid (CA) as described previously (20), but in spite of repeated efforts, we did not find major effects among our various constructs in this regard.

View larger version (16K): [in this window] [in a new window]   FIG. 3.   Viral RNA packaging in wild-type (WT) and mutated viruses. Equivalent amounts of virus derived from transfected COS-7 cells, based on levels of p27 antigen, were used to prepare viral RNA, which was then used as a template for quantitative RT-PCR to detect the full-length viral RNA genome in an 18-cycle PCR (19). Relative amounts of a 114-bp DNA product were quantified by molecular imaging, with wild-type values arbitrarily set at 1.0. Reactions run with RNA template, digested by DNase-free RNase, served as a negative control for each sample to exclude any potential DNA contamination. Relative amounts of viral RNA that were packaged were determined on the basis of four different experiments.

An intact U5-leader stem is important for SIV replication. As stated above, both an intact TAR hairpin and an intact poly(A) hairpin are important for RNA packaging in HIV-1 (11). Since both the parental deletions and all of the compensatory mutations described here are located within the U5-leader stem, we performed RNA secondary structure analysis to determine whether the structure of this region might play a role in the observed functions. RNA secondary structure was predicted by free-energy minimization as described previously (35). The results revealed that a previously studied deletion, i.e., SD2, retained an intact U5-leader stem, while the SD1a and SD1b deletions partially impaired the U5-leader while retaining the bottom part of the stem. In contrast, the SD1c deletion destroyed the U5-leader stem (19, 20). Interestingly, the D1 deletion is located opposite the SD1a and SD1b deletions in the U5-leader stem, and, when introduced into the parental constructs, it can restore a truncated but intact U5-leader stem (Fig. 4A and B). The resultant constructs, i.e., SD1a-D1 and SD1b-D1, possessed increased replication capacity.

View larger version (16K): [in this window] [in a new window]   FIG. 4.   Secondary structures of the U5-leader stems of reverted viruses. RNA secondary structure was predicted by free energy minimization. The free energy of each structure is displayed as kilocalories per mole, as calculated using the Zuker algorithm (35). The location of the D1 compensatory deletion is indicated by the arrow in the structures (A and B). The compensatory mutations M1 (AG) and M2 (CU) are highlighted within the structure of SD6 (C and D).

In contrast, the SD6 deletion destroyed the bottom part of the U5-leader stem, and the introduction of M1, M2, or both M1 and M2 restored the integrity of this region (Fig. 4C and D). Consistent with this, the SD6 virus was impaired in regard to both replication capacity and efficiency of viral RNA packaging, but both the M1 and M2 point mutations were able to rescue the latter deficit. Thus, the bottom portion of the U5-leader stem is important for both viral RNA packaging and infectiousness. It will be of interest to explore the mechanisms involved in generation of the D1 deletion under conditions of forced viral evolution. It is noteworthy that insertional and deletion mutagenesis can occur in the RT gene of HIV-1 in patients undergoing antiretroviral chemotherapy with nucleoside RT inhibitors, resulting in resistance to these drugs (34). The mechanisms responsible for these deletions and insertions have not yet been elucidated.

	ACKNOWLEDGMENTS

This research was supported by grant RO1 AI43878-01 to M.A.W. from the National Institute of Allergy and Infectious Diseases, National Institutes of Health.

The CEMx174 cell line was obtained from Peter Cresswell through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. We thank Maureen Oliveira for technical assistance.

	FOOTNOTES

^* Corresponding author. Mailing address: McGill AIDS Centre, Lady Davis Institute-Jewish General Hospital, 3755 Cote Ste-Catherine Road, Montreal, Quebec, Canada H3T 1E2. Phone: (514) 340-8260. Fax: (514) 340-7537. E-mail: mwainb1{at}po-box.mcgill.ca.

Present address: Division of Clinical Sciences, University of Toronto, Toronto, ON, Canada M5S 1A8

	REFERENCES

Top Abstract Text References

1.	Arts, E. J., and M. A. Wainberg. 1996. Human immunodeficiency virus type 1 reverse transcriptase and early events in reverse transcription. Adv. Virus Res. 46:97-163[Medline].
2.	Baudin, G., R. Marquet, C. Isel, J. L. Darlix, B. Ehresmann, and C. Ehresmann. 1993. Functional sites in the 5' region of human immunodeficiency virus type 1 RNA form defined structural domains. J. Mol. Biol. 229:382-397[CrossRef][Medline].
3.	Beerens, N., F. Groot, and B. Berkhout. 2000. Stabilization of the U5-leader stem in the HIV-1 RNA genome affects initiation and elongation of reverse transcription. Nucleic Acids Res. 28:4130-4137[Abstract/Free Full Text].
4.	Berkhout, B., R. H. Silverman, and K.-T. Jeang. 1989. Tat trans-activates the human immunodeficiency virus through a nascent RNA target. Cell 59:273-282[CrossRef][Medline].
5.	Berkhout, B., B. Klaver, and A. T. Das. 1995. A conserved hairpin structure predicted for the poly(A) signal of human and simian immunodeficiency viruses. Virology 207:276-281[CrossRef][Medline].
6.	Berkhout, B. 1996. Structure and function of the human immunodeficiency virus leader RNA. Prog. Nucleic Acid Res. Mol. Biol. 54:1-34[Medline].
7.	Berkhout, B., and J. L. B. van Wamel. 2000. The leader of the HIV-1 RNA genome forms a compactly folded tertiary structure. RNA 6:282-295[Abstract].
8.	Berkowitz, R., J. Fisher, and S. P. Goff. 1996. RNA packaging. Curr. Top. Microbiol. Immunol. 214:177-218[Medline].
9.	Clever, J., C. Sassetti, and T. G. Parslow. 1995. RNA secondary structure and binding sites for gag products in the 5' packaging signal of human immunodeficiency virus type 1. J. Virol. 69:2101-2109[Abstract].
10.	Clever, J. L., and T. G. Parslow. 1997. Mutant human immunodeficiency virus type 1 genomes with defects in RNA dimerization or encapsidation. J. Virol. 71:3407-3414[Abstract].
11.	Clever, J. L., D. A. Eckstein, and T. G. Parslow. 1999. Genetic dissociation of the encapsidation and reverse transcription functions in the 5' R region of the human immunodeficiency virus type 1. J. Virol. 73:101-109[Abstract/Free Full Text].
12.	Coffin, J. M., S. H. Hughes, and H. E. Varmus. 1997. Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
13.	Damgaard, C. K., H. Dyhr-Mikkelsen, and J. Kjems. 1998. Mapping the RNA binding sites for human immunodeficiency virus type 1 Gag and NC proteins within the complete HIV-1 and -2 untranslated leader regions. Nucleic Acids Res. 26:3667-3676[Abstract/Free Full Text].
14.	Das, A. T., B. Klaver, and B. Berkhout. 1995. Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural tRNA(3Lys). J. Virol. 69:3090-3097[Abstract].
15.	Das, A. T., B Klaver, B. I. Klasens, J. L. van Wamel, and B. Berkhout. 1997. A conserved hairpin motif in the R-U5 region of the human immunodeficiency virus type 1 RNA genome is essential for replication. J. Virol. 71:2346-2356[Abstract].
16.	Das, A. T., B. Klaver, and B. Berkhout. 1998. The 5' and 3' TAR elements of human immunodeficiency virus exert effects at several points in the virus life cycle. J. Virol. 72:9217-9223[Abstract/Free Full Text].
17.	Das, A. T., B. Klaver, and B. Berkhout. 1999. A hairpin structure in the R region of the human immunodeficiency virus type 1 RNA genome is instrumental in polyadenylation site selection. J. Virol. 73:81-91[Abstract/Free Full Text].
18.	Dulbecco, R. 1988. The nature of viruses, p. 22-25. In R. Dulbecco, and H. S. Ginsberg (ed.), Virology, 2nd ed. L. B. Lippincott, Philadephia, Pa.
19.	Guan, Y., J. B. Whitney, K. Diallo, and M. A. Wainberg. 2000. Leader sequences downstream of the primer binding site are important for efficient replication of simian immunodeficiency virus. J. Virol 74:8854-8860[Abstract/Free Full Text].
20.	Guan, Y., J. B. Whitney, C. Liang, and M. A. Wainberg. 2001. Novel live attenuated simian immunodeficiency virus constructs containing major deletions in leader RNA sequences. J. Virol. 75:2776-2785[Abstract/Free Full Text].
21.	Harrich, D., C. Ulich, and R. B. Gaynor. 1996. A critical role for the TAR element in promoting efficient human immunodeficiency virus type 1 reverse transcription. J. Virol. 70:4017-4027[Abstract].
22.	Harrison, G. P., and A. M. L. Lever. 1992. The human immunodeficiency virus type 1 packaging signal and major splice donor region have a conserved stable secondary structure. J. Virol. 66:4144-4153[Abstract/Free Full Text].
23.	Helga-Maria, C., M. L. Hammarskjold, and D. Rekosh. 1999. An intact TAR element and cytoplasmic localization are necessary for efficient packaging of human immunodeficiency virus type 1 genomic RNA. J. Virol. 73:4127-4135[Abstract/Free Full Text].
24.	Isel, C., C. Ehresmann, G. Keith, B. Ehresmann, and R. Marquet. 1995. Initiation of reverse transcription of HIV-1: secondary structure of the HIV-1 RNA/tRNA(3Lys) (template/primer). J. Mol. Biol. 247:236-250[CrossRef][Medline].
25.	Klaver, B., and B. Berkhout. 1994. Evolution of a disrupted TAR RNA hairpin structure in the HIV-1 virus. EMBO J. 13:336-340.
26.	Lever, A., H. Gottlinger, W. Haseltine, and J. Sodroski. 1989. Identification of a sequence required for efficient packaging of human immunodeficiency virus type 1 RNA into virions. J. Virol. 63:4085-4087[Abstract/Free Full Text].
27.	Liang, C., L. Rong, R. S. Russell, and M. A. Wainberg. 2000. Deletion mutagenesis downstream of the 5' long terminal repeat of human immunodeficiency virus type 1 is compensated for by point mutations in both the U5 region and gag gene. J. Virol. 74:6251-6261[Abstract/Free Full Text].
28.	Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
29.	McBride, M. S., and A. T. Panganiban. 1996. The human immunodeficiency virus type 1 encapsidation site is a multipartite RNA element composed of functional hairpin structures. J. Virol. 70:2963-2973[Abstract].
30.	McBride, M. S., M. D. Schwartz, and A. T. Panganiban. 1997. Efficient encapsidation of human immunodeficiency virus type 1: vectors and further characterization of cis elements required for encapsidation. J. Virol. 71:4544-4554[Abstract].
31.	Rizvi, T. A., and A. T. Panganiban. 1993. Simian immunodeficiency virus RNA is efficiently encapsidated by human immunodeficiency virus type 1 particles. J. Virol. 67:2681-2688[Abstract/Free Full Text].
32.	Salter, R. D., D. N. Howell, and P. Cresswell. 1985. Genes regulating HLA class-I antigen expression in T-B lymphoblast hybrids. Immunogenetics 21:235-246[CrossRef][Medline].
33.	Skripkin, E., J. C. Paillart, R. Marquet, B. Ehresmann, and C. Ehresmann. 1994. Identification of the primary site of human immunodeficiency virus type 1 RNA dimerization in vitro. Proc. Natl. Acad. Sci. USA 91:4945-4949[Abstract/Free Full Text].
34.	Winters, M. A., K. L. Coulley, Y. A. Girard, et al. 1998. A 6-basepair insert in the reverse transcriptase gene of human immunodeficiency virus type 1 confers resistance to multiple nucleoside inhibitors. J. Clin. Investig. 102:1769-1775[Medline].
35.	Zuker, M., D. H. Mathews, and D. H. Turner. 1999. Algorithms and thermodynamics for RNA secondary structure prediction: a practice guide in RNA biochemistry and biotechnology, p. 11-43. In J. Barciszewski, and B. F. C. Clark (ed.), NATO ASI series. Kluwer Academic Publishers, Dordrecht, The Netherlands.

---

Journal of Virology, December 2001, p. 11924-11929, Vol. 75, No. 23
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.23.11924-11929.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

This article has been cited by other articles:

• Strappe, P. M., Greatorex, J., Thomas, J., Biswas, P., McCann, E., Lever, A. M. L. (2003). The packaging signal of simian immunodeficiency virus is upstream of the major splice donor at a distance from the RNA cap site similar to that of human immunodeficiency virus types 1 and 2. J. Gen. Virol. 84: 2423-2430 [Abstract] [Full Text]  
• Patel, J., Wang, S.-W., Izmailova, E., Aldovini, A. (2003). The Simian Immunodeficiency Virus 5' Untranslated Leader Sequence Plays a Role in Intracellular Viral Protein Accumulation and in RNA Packaging. J. Virol. 77: 6284-6292 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Guan, Y. Articles by Wainberg, M. A. Search for Related Content PubMed PubMed Citation Articles by Guan, Y. Articles by Wainberg, M. A.