Previous Article | Next Article 
Journal of Virology, December 2001, p. 11874-11880, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11874-11880.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
RNase H Cleavage of the 5' End of the Human
Immunodeficiency Virus Type 1 Genome
Hong-Qiang
Gao,1,
Stefan G.
Sarafianos,2
Edward
Arnold,2 and
Stephen H.
Hughes1,3,*
ABL-Basic Research
Program1 and HIV Drug Resistance
Program,3 National Cancer
Institute
Frederick, Frederick, Maryland 21702-1201, and
Center for Advanced Biotechnology and Medicine and
Chemistry Department, Rutgers University, Piscataway, New Jersey
08854-56382
Received 21 June 2001/Accepted 22 August 2001
 |
ABSTRACT |
The synthesis of retroviral DNA is initiated near the 5' end of the
RNA. DNA synthesis is transferred from the 5' end to the 3' end of
viral RNA in an RNase H-dependent step. In the case of human
immunodeficiency virus type 1 (HIV-1) (and certain other retroviruses
that have complex secondary structures at the ends of the viral RNA),
there is the possibility that DNA synthesis can lead to a self-priming
event that would block viral replication. The extent of RNase H
cleavage must be sufficient to allow the strand transfer reaction to
occur, but not so extensive that self-priming occurs. We have used a
series of model RNA substrates, with and without a 5' cap, to
investigate the rules governing RNase H cleavage at the 5' end of the
HIV-1 genome. These in vitro RNase H cleavage reactions produce an RNA
fragment of the size needed to block self-priming but still allow
strand transfer. The cleavages seen in vitro can be understood in light
of the structure of HIV-1 reverse transcriptase in a complex with an
RNA/DNA substrate.
| |
TEXT |
The retroviral genome is
single-stranded RNA. When the virus infects a susceptible cell, the
core enters the cytoplasm and genomic RNA is converted into linear
double-stranded DNA by the viral enzyme reverse transcriptase (RT)
(reviewed in references 3, 11, and 19). RT
has two enzymatic activities: a DNA polymerase that can copy
either an RNA or a DNA template, and RNase H, which will cleave RNA if,
and only if, it is part of an RNA/DNA duplex. These two activities
collaborate in the conversion of the RNA genome into DNA. RT, like many
other DNA polymerases, requires both a template and a primer. Reverse
transcription is initiated from a host tRNA base-paired to the viral
genome at the primer binding site near the 5' end of the viral genome.
First-strand DNA synthesis creates an RNA/DNA duplex; this duplex is a
substrate for RNase H.
Because the primer binding site is near the 5' end of the RNA genome,
DNA synthesis rapidly reaches the end of the RNA. This DNA is called
minus-strand strong-stop DNA (
sssDNA). DNA synthesis is then
transferred to the 3' end of the RNA genome. This transfer reaction
requires that RNase H degrade the 5' end of the RNA genome. The 5' ends of the genomes of several complex retroviruses (human immunodeficiency virus type 1 [HIV-1], HIV-2, and human T-cell leukemia virus type 2) can form complex secondary structures; in the
absence of the complementary RNA, the newly synthesized sssDNAs of
these retroviruses can fold into complex structures. Some of these
complex DNA structures have the potential to self-prime. Self-priming
is prevented in vivo; the process appears to involve both the
nucleocapsid (NC) protein and a piece of viral RNA from the 5' end of
the genome (5, 7, 10). The available data, most of which
were obtained with in vitro reactions using model substrates, suggest
that a residual piece from the 5' end of the RNA genome prevents
self-priming. To block self-priming, the residual RNA must be long
enough so that when it is annealed to sssDNA, the RNA is able to
prevent self-priming; however, the residual RNA/DNA duplex must be
small enough that it does not block the strand transfer reaction
(5, 8).
In a previous study, HIV-1 RT was allowed to copy in vitro an RNA whose
sequence matched the 5' end of the HIV-1 genome (5). The
5' end of the RNA was relatively resistant to RNA degradation; RNase H
cleavage of the 5' end of the RNA produced a product approximately 14 bases long. This RNA has an important role in the strand transfer reaction; in the presence of NC, the RNA remains hybridized to viral
DNA and prevents self-priming. However, the residual 5' RNA is small
enough that it does not block the first-strand transfer reaction.
Because the strand transfer reaction is a critical step in reverse
transcription, we have used additional model substrates to investigate
the RNase H cleavages of RNA/DNA duplexes that mimic the substrates
created when reverse transcription reaches the 5' end of the genome. In
particular, we wanted to examine whether 5' or 3' extensions of the DNA
strand would affect RNA cleavage and whether capping of the viral RNA
would alter RNase H activity. A 5' DNA extension has a negative effect
on RNase H cleavage, and a 3' extension has a positive effect. In some cases, a 5' cap modestly affects the specificity of RNase H cleavage. The results can be explained in terms of the structure of HIV-1 RT in a
complex with an RNA/DNA duplex (17).
RNase H cleavage of short RNAs whose sequence matches the 5' end of
the HIV-1 genome.
To measure the ability of the RNase H of HIV-1
to cleave RNA sequences from the 5' end of the HIV-1 genome, a series
of short synthetic RNAs were chemically synthesized and gel purified by Oligos, Etc., Inc. (Wilsonville, Ore.). The lyophilized RNAs were dissolved in diethylpyrocarbonate-treated water and aliquoted in
Eppendorf tubes stored at 80°C. For each experiment, one tube was
taken out of the freezer, thawed at room temperature, and immediately
used in a labeling reaction. The RNA was 5' labeled in vitro using T4
polynucleotide kinase from Boehringer Mannheim and
r-32P from Amersham Pharmacia Biotech
(Piscataway, N.J.). The labeled RNA was purified using Quick Spin
Columns-G25 Sephadex (Boehringer Mannheim). All of the RNAs shared a
common 5' end; the RNAs differed in length (10, 12, or 16 bases long)
(Fig. 1). To create RNase H substrates,
the 5' ends of the RNAs were radioactively labeled using
[32P]ATP and T4 polynucleotide kinase. The
labeled RNAs were hybridized to cDNA oligonucleotides. DNA
oligonucleotides were synthesized by BioServe Biotechnologies (Laurel,
Md.). The lyophilized oligonucleotides were dissolved in
diethylpyrocarbonate-treated water and stored at 20°C.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
Sequences of the RNA and DNA oligonucleotides. The
sequence of the 5' end of the HIV-1 genome is shown at top. The
asterisk denotes a 5' cap structure. The RNA oligonucleotides are shown
beneath the HIV-1 RNA. The DNA oligonucleotides are shown at bottom.
The DNA oligonucleotides are shown from 3' to 5' to make the
comparisons with the RNA oligonucleotides easier.
|
|
When HIV-1 RT reaches the end of the HIV-1 genome, the 5' end of the
viral RNA is base-paired with newly synthesized DNA.
RNase H digestion
leaves approximately 14 bases from the 5' end
of the genome and a long
minus-strand DNA whose 5' end extends
well beyond the 3' end of the
residual piece of viral RNA. To
ask whether a 5' DNA extension affected
RNase H cleavage, DNA
oligonucleotides 20 and 30 bases long were
prepared (Fig.
1) and
hybridized to the 10-, 12-, and 16-base-long
RNAs. The resulting
RNA/DNA duplexes were used as substrates for in
vitro RNase H
digestion assays with purified HIV-1 RT. The open reading
frame
encoding wild-type HIV-1 RT was cloned into a plasmid similar
to
p6HRT-PROT (
1,
2,
13). The plasmid is based on the
expression vector pT5m, and it was introduced into the
Escherichia coli strain BL21(DE3)(pLysE) (
2,
13,
16,
18). After induction
with isopropyl
-D-thiogalactopyranoside,
the plasmid expresses
both the p66 form of HIV-1 RT and HIV-1 protease.
Approximately
50% of the overexpressed p66 RT is converted to the p51
form by
HIV-1 protease, and p66/p51 heterodimers accumulate in
E. coli.
The p66/p51 heterodimers were purified by metal chelate
chromatography
(
2,
13,
14).
If the RNA in the resulting duplexes was 10 bases long, there was no
measurable cleavage with either the DNA 20 or DNA 30
substrate (Fig.
2). The 12-base RNA was cleaved poorly
when hybridized
to either DNA 20 or DNA 30 (Fig.
2 and Fig.
3). Hybrids prepared
with the 16-base RNA
were much better RNase H substrates. Hybrids
prepared with the 12-base
RNA and DNA 20 or DNA 30 were preferentially
cleaved at a position
approximately 8 bases from their 5' ends;
the 16-base RNA was
preferentially cleaved either 13 or 14 bases
from its 5' end; there
were secondary cleavages approximately
8 and 10 bases from the 5' end
(Fig.
2 and Fig.
3). Making the
5' DNA extension 10 bases longer (using
DNA 30 instead of DNA
20 to make the duplex) reduced the efficiency of
the cleavage
of substrates prepared with either the 12-base-long RNAs
or the
16-base-long RNAs. RT can bind to the RNA/DNA duplex in either
of two orientations; from the enzyme's point of view, the RNA
strand
can be either the primer or the template strand. For RNase
H digestion
to occur, RT must bind the heteroduplex such that
the RNA strand is the
template. If there is a relatively long
5' DNA extension, this might
favor a binding mode for HIV-1 RT
in which the RNA strand is the
primer, not the template. We believe
this explains the observation that
substrates prepared with DNA
30 are cleaved less well than those
prepared with DNA 20.
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Cleavage of short RNA oligonucleotides hybridized to
various DNA oligonucleotides. The sequences of the RNA and DNA
oligonucleotides are given in Fig. 1. The RNA oligonucleotides were 5'
end labeled with T4 polynucleotide kinase. About 20,000 cpm of the
32P-labeled RNA or capped RNA templates were hybridized to
approximately 20 ng of the individual oligonucleotides as described
above in the presence of 50 mM Tris-HCl (pH 8.0)-50 mM NaCl-5 mM
MgCl2-2.0 mM dithiothreitol-100 µg of acetylated bovine
serum albumin/ml-10 mM
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate. The
mixtures of RNA and oligonucleotides were heated to 70°C for 10 min
and then slowly cooled to room temperature. The reactions were
initiated by adding 50 ng of purified wild-type HIV-1 RT and
MgCl2 to a final concentration of 5 mM, in a final volume
of 12 µl, and were then incubated at 37°C. Samples were removed at
0.25, 1, 4, and 16 min, and the reactions were terminated by adding 2×
RNA loading buffer. The products were heat denatured and separated on a
denaturing 15% polyacrylamide-7 M urea gel in Tris-borate-EDTA buffer
at 1,600 V for approximately 90 min (7). The gel was dried
and autoradiographed.
|
|
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 3.
Cleavage of RNA oligonucleotides hybridized to various
DNA oligonucleotides by the RNase H of HIV-1 RT. The assay is similar
to the assay shown in Fig. 2, except that RNA 1-16 was used. The
autoradiogram was exposed for a longer time in the experiment shown
here. To simplify the comparison of the data in Fig. 2 and 3, RNA 1-12 was used in the experiments presented in both figures.
|
|
Although a 5' DNA extension appeared to decrease the efficiency of
RNase H cleavage, a 3' DNA extension substantially enhanced
RNase H
cleavage, particularly for substrates prepared with the
shorter RNAs.
The 10-base-long RNA, which was not detectably cleaved
when hybridized
to DNA 20 or DNA 30, could be cleaved (slowly)
if hybridized to DNA 39. There was a considerable enhancement
of the cleavage of the RNA if the
duplexes were prepared with
either the 12-base-long or the 16-base long
RNA and DNA 39. The
effect seemed to be primarily on the rate of
cleavage rather than
on the specificity of cleavage. The observation
that the 9-base
3' extension on DNA 39 affects the efficiency of
cleavage without
having an obvious effect on the specificity of
cleavage suggests
that the 3' extension is more likely to affect the
strength of
the binding of the substrate to HIV-1 RT than to alter the
way
the substrate is bound. However, this argument does not rule out
the possibility that it is the mode of binding that is affected.
The
capped RNA templates were labeled and synthesized in vitro
using the
Capped RNA synthesis kit from Ambion, Inc. (Austin,
Tex.). The DNA
oligonucleotides 5'GAGAGACCTCCCTATAGTGAGTCGTTTTAAATT3',
5'AATTTAATACGACTCACTATAGGGAGGTCTCTC3',
5'GTCTAACCAGAGAGACCTCCCTATAGTGAGTCGTATTAAATT3',
and
5'AAT T TAATACGAC TCAC TATAGGGAGG TC TC TC TGGTTAGAC3'
were
synthesized and gel purified by Gibco BRL (Rockville, Md.).
Each
pair of the DNA oligonucleotides was first annealed by heating
in
10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl to 100°C and
then
slowly cooled to room temperature. The annealed oligonucleotides
were
used as templates for RNA synthesis and
[
-
32P]UTP labeling in vitro using the
capped RNA synthesis kit mMESSAGE
mMACHINE from Ambion, Inc. and
[
-
32P]UTP from Amersham Pharmacia Biotech.
The capped RNA synthesis
protocol from Ambion was used to synthesize
the RNA, except that
a pulse-chase labeling procedure was used instead
of direct pulse
labeling during the capped RNA synthesis. The
transcription reaction
was first mixed with RNA loading buffer and
heated to 100°C for
3 min, and RNAs of appropriate size were purified
on a 20% polyacrylamide
gel. The gel slice containing labeled
full-length RNA was cut
out from the gel, soaked in RNA extraction
buffer with a final
concentration of 100 µg of proteinase K/ml
overnight at 4°C, and
purified by phenol-chloroform extraction and
ethanol precipitation.
The RNA was resuspended in water and used in the
annealing
reaction.
The consensus T7 promoter sequence was added to the capped model RNA,
and the resulting RNA was not an exact match of the
5' end of HIV-1
genomic RNA (Fig.
1). Two capped RNAs were made,
capped RNA 12 and
capped RNA 21. The corresponding uncapped RNAs
were also synthesized
(uncapped RNA 12 and uncapped RNA 21). cDNA
oligonucleotides were
synthesized (DNA 12C and DNA 21C). In addition,
a DNA was prepared that
was complementary to capped RNA 12 but,
when hybridized, created a 3'
extension (DNA 20C) (Fig.
1). The
uncapped RNA 12 differs from RNA 12 in sequence (Fig.
1) and appears
to be a better RNase H substrate
when hybridized to DNA 12C or
DNA 20C. The susceptibilities of the
corresponding capped RNA
and uncapped RNAs to the RNase H of HIV-1 RT
were compared. If
the shorter capped RNA substrate (RNA 12C) was
hybridized to the
corresponding DNA (DNA 12C), the capped RNA was less
susceptible
to cleavage, particularly in the center of the RNA (near
position
6), than the corresponding uncapped RNA. This difference in
susceptibility
to cleavage was not absolute; when the capped RNA 12 and
uncapped
RNA 12 were hybridized to DNA 20C, creating a substrate with a
3' primer extension, both the capped and uncapped versions of
RNA 12C
could be cleaved near the middle of the RNA (Fig.
4).
If the RNA/DNA duplexes were longer,
capped and uncapped RNA 21
hybridized to DNA 21C, and there were
no obvious differences in
the patterns of RNase H cleavage
(Fig.
5).
View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of a 5' cap on cleavage of an RNA
oligonucleotide by the RNase H of HIV-1 RT. A 12-base-long RNA was
synthesized in vitro that either had, or did not have, a 5' cap. The
RNAs were labeled by including [32P]UTP in the
synthesis mix. The full-length RNAs were purified by gel
electrophoresis and hybridized to DNA oligonucleotides. The resulting
heteroduplexes were incubated with HIV-1 RT for various lengths of time
(0.25 to 16 min), and the reaction products were fractionated on a 15%
polyacrylamide-7 M urea gel.
|
|
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of a 5' cap on the cleavage of an RNA
oligonucleotide by the RNase H of HIV-1 RT. The experiment shown in
this figure is similar to the experiment shown in Fig. 4, except that
the RNA is 21 bases long instead of 12 bases long.
|
|
Although the RNase H of HIV-1 RT does not selectively bind to specific
nucleic acid sequences, it is able to cleave certain
substrates with
considerable precision. These precise cleavages
are important; RNase H
cleavages define the ends of the linear
viral DNA that are the
substrates for integration (see references
3,
11, and
19 for reviews). In addition, it appears that
the
first-strand transfer requires that the residual 5' RNA left
by RNase H
be a specific size. This 5' RNA must be large enough
so that in the
presence of NC, it can block self-priming of
sssDNA;
however, the RNA
must be small enough to allow the transfer of
sssDNA to the 3' end of
viral RNA (
5,
8).
We have tried to determine how the RNase H of HIV-1 RT cleaves model
substrates that are related to those generated when HIV-1
RT copies the
5' end of the viral genome and to understand why
HIV-1 RT makes the
cleavages it does. Fortunately, the structure
of the complex between
HIV-1 RT and an RNA/DNA heteroduplex (
17)
is quite helpful
in interpreting the cleavage data (Fig.
6).
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Contacts between HIV-1 RT and an RNase H substrate. The
DNA (primer) strand is shown above, and the RNA (template) strand is
below. Some of the interaction elements of HIV-1 RT are indicated
(RNase H primer grip, p66 thumb, p66 thumb I, p66 thumb H, p66
connection template grip, and primer grip). The RNase H active site and
the scissile phosphate are indicated. The contacts made by individual
amino acids are shown. A dotted line connecting the nucleic acid to an
amino acid indicates a hydrogen bond, and a solid line indicates
another type of interaction. The figure was prepared based on the
structure of an RNA/DNA duplex bound to HIV-1 RT (17).
|
|
Extending the 5' end of the primer (DNA) strand diminishes RNase H
cleavage. The structure of HIV-1 RT in a complex with an
RNA/DNA duplex
does not show any significant interactions between
RNase H and the
primer strand beyond the cleavage site in the
RNA. However, there might
be some interactions that are not revealed
in the structure; the
electron density for the nucleic acid is
weak past the RNase H active
site. For RNase H cleavage to occur,
the substrate must, in most cases,
be an RNA/DNA duplex in the
immediate vicinity of the RNase H active
site; however, in the
available structure, there are no obvious
interactions between
RNase H and the RNA (template strand) beyond two
bases 3' of the
scissile phosphate. This interpretation of the
structural data
is supported by the biochemical analyses: that portion
of the
RNA/DNA duplex more than a few base pairs beyond (3' on the RNA)
the RNase H active site is not important for RNase H cleavage.
It would
appear that the primary effect of increasing the length
of the 5'
primer (DNA) extension is to alter the binding mode
with RT. There is
no absolute requirement for RT to bind to a
nucleic acid such that the
RNA strand is the template and the
DNA strand is the primer. If the
substrate has a long 5' DNA extension,
RT can bind in the configuration
in which the DNA strand is the
template and the RNA strand is the
primer. The competition from
the second binding mode for RT would lead
to a reduction in the
RNase H cleavage of substrates that have long 5'
DNA
extensions.
The preferred mode of binding of HIV-1 RT with nucleic acid substrates
in which the double-stranded portion is at least 18
bp long places the
3' end of the primer strand at the polymerase
active site (
4,
6,
9,
12,
15,
17,
20). If the
template strand nucleic acid
substrate has a 5' extension, this
extension can interact with the
fingers subdomain of the p66 subunit.
If a nucleic acid substrate has
one end blunt and the other with
a 5' template extension, RT
preferentially binds so that the extended
template interacts with the
p66 fingers, whether that template
is RNA or
DNA.
The isolated RNase H domain of HIV-1 RT is properly folded, but it does
not cleave an RNA/DNA duplex. The problem is that
the isolated RNase H
domain does not bind to its substrate well
enough to cleave it
(reviewed in reference
11). Several elements
of the
polymerase domain are involved in binding an RNase H substrate.
A
network of amino acids in the RNase H domain and the connection
subdomain called the RNase H primer grip interacts with the nucleic
acid (
17). The nucleic acid also interacts with the
fingers,
thumb, and palm subdomains. The requirement for these elements
of the polymerase subdomain in the binding of an RNase H substrate
determines the minimal RNA/DNA duplex that can be cleaved by the
RNase
H of HIV-1 RT. The cleavage data we have obtained suggest
that if the
5' end of the RNA template exactly matches the 5'
end of the HIV-1
genome, the double-stranded region must be 12
bases long (or longer) in
order to see even minimal cleavage;
a 10-base duplex is not cleaved,
and a 16-base duplex is a much
better substrate. The structure suggests
that the binding site
composed of RNase H itself and the RNase H primer
grip contacts
11 base pairs (from the phosphate between positions
9
and
8
from the cleavage site or the primer strand to the ribose at +2
on the template strand). We did not explicitly test an 11-base
substrate; however, cleavage is quite inefficient with a 12-bp
blunt-ended duplex derived from the 5' end of the HIV-1 genome.
The
more efficient cleavage of the uncapped RNA 12 substrates
suggests that
nucleic acid sequence or structure is important
in determining
interactions with RNase H. For substrates that
exactly match the
5' end of the HIV-1 genome, efficient RNase
H cleavage requires
interactions in the polymerase domain beyond
the RNase H primer grip.
The 16-mer substrate is cleaved efficiently
13 or 14 bases from the 5'
end of the RNA. This would place the
end of the
I and
H helix of
the duplex in a position where it
can interact with the thumb of p66
and with the p66 connection
subdomain; apparently this is sufficient to
allow reasonably efficient
cleavage (Fig.
6).
Although extending the primer strand 5' (beyond RNase H) has no
positive effect on RNase H cleavage, extending the 3' end
of the primer
strand does enhance RNase H cleavage. This suggests
that a 3' primer
extension, like a 5' template extension, can
interact with the
polymerase domain. In some sense this should
not be surprising. In
addition to the interactions with an extended
template, which have
already been discussed, there are elements
in the fingers, thumb, and
palm of the p66 subunit that interact
with both the primer and the
template strand of a double-stranded
nucleic acid (Fig.
6). If the
duplex region of an RNA/DNA nucleic
acid substrate is relatively short
(between 12 and 16 bases long),
the nucleic acid can bind in a
configuration such that the double-stranded
portion contacts the RNase
H active site. This interaction is
enhanced by either a single-stranded
5' template extension or
a single-stranded 3' primer extension. Again,
this makes sense
in terms of the structure of HIV-1 RT. Presumably an
extended
single-stranded template is still able to interact with the
template
grip, and similarly, the extended primer can still interact
with
the primer
grip.
Since there can be interactions with a 5' template extension, we also
examined whether a 5' cap structure would affect the
site of cleavage.
In doing these experiments we focused primarily
on model substrates
designed to resemble the structure that arises
when RT copies the 5'
end of the viral genome. The most relevant
substrates were those in
which the 5' end of the RNA was fully
base-paired (except for the cap).
If the 5' end of the RNA is
fully base-paired and the duplex is short,
only modest differences
are seen in the pattern of RNase H digestion
whether the duplex
is 12 or 21 bp long. The differences seen with a
short duplex
(12 bases) suggest that the cap may interfere with RT
binding
rather than enhancing it. This inhibition can be relieved if
there
is an 8-base 3' extension on the primer (DNA) strand. These
observations
can be explained in terms of the structure. When the
duplex is
short, adding the cap does not enhance binding because there
are
no interactions between the template (RNA) and the protein between
positions
4 and
10 measured from the RNase H active site. There
are
interactions on the primer strand, through the RNase H primer
grip;
however, the cap could disrupt the end of the duplex and
reduce these
interactions. Extending the 3' end of the primer
strand beyond the
RNase H primer grip to the polymerase primer
grip could overcome this
problem. If the duplex region is sufficiently
large (here, 21 bases),
there are sufficient interactions between
RT and the nucleic acid that
the cap doesn't have a significant
effect on RNase H cleavage.
Alternatively, because the cap is
somewhat flexible, it could have
unique interactions with RT that
are difficult to predict from the
available structures. Whatever
model ultimately proves to be correct,
the effects of a 5' cap
on RNase H cleavage are relatively
modest.
| |
ACKNOWLEDGMENTS |
We are grateful to Pat Clark and Peter Frank for preparing purified
HIV-1 RT and to Hilda Marusiodis for preparing the manuscript.
S.G.S. was supported by an NIH-NIAID NRSA fellowship (A1 09578). The
research in E.A.'s laboratory was supported by an NIH Merit Award (A1
27690). Research in S.H.H.'s laboratory is supported by the National
Cancer Institute and the National Institute of General Medical Sciences.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: HIV Drug
Resistance Program, National Cancer Institute-FCRDC, P.O. Box B,
Building 539, Room 130A, Frederick, MD 21702-1201 Phone: (301)
846-1619. Fax: (301) 846-6966. E-mail: hughes{at}ncifcrf.gov.
Present address: E-Centive, Bethesda, MD 20817.
| |
REFERENCES |
| 1.
|
Boyer, P. L.,
A. L. Ferris, and S. H. Hughes.
1992.
Cassette mutagenesis of the reverse transcriptase of human immunodeficiency virus type 1.
J. Virol.
66:1031-1039[Abstract/Free Full Text].
|
| 2.
|
Boyer, P. L.,
J. Ding,
E. Arnold, and S. H. Hughes.
1994.
Subunit specificity of mutations that confer resistance to nonnucleoside inhibitors in human immunodeficiency virus type 1 reverse transcriptase.
Antimicrob. Agents Chemother.
38:1909-1914[Abstract/Free Full Text].
|
| 3.
|
Coffin, J. M.,
S. H. Hughes, and H. E. Varmus (ed.).
1997.
Retroviruses.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 4.
|
Ding, J.,
K. Das,
Y. Hsiou,
S. G. Sarafianos,
A. D. Clark, Jr.,
A. Jacobo-Molina,
C. Tantillo,
S. H. Hughes, and E. Arnold.
1998.
Structure and functional implications of the polymerase active site region in a complex of HIV-1 RT with a double-stranded DNA template-primer and an antibody Fab fragment at 2.8 D resolution.
J. Mol. Biol.
284:1095-1111[CrossRef][Medline].
|
| 5.
|
Driscoll, M. D.,
M.-P. Golinelli, and S. H. Hughes.
2001.
In vitro analysis of human immunodeficiency virus type 1 minus-strand strong-stop DNA synthesis and genomic RNA processing.
J. Virol
75:672-686[Abstract/Free Full Text].
|
| 6.
|
Furfine, E. S., and J. E. Reardon.
1991.
Reverse-transcriptase-RNase H from human immunodeficiency virus: relationship of the DNA polymerase and RNA hydrolysis activities.
J. Biol. Chem.
266:406-412[Abstract/Free Full Text].
|
| 7.
|
Gao, H.-Q.,
P. L. Boyer,
E. Arnold, and S. H. Hughes.
1998.
Effects of mutations in the polymerase domain on the polymerase, RNase H and strand transfer activities of human immunodeficiency virus type 1 reverse transcriptase.
J. Mol. Biol.
277:559-572[CrossRef][Medline].
|
| 8.
|
Golinelli, M.-P., and S. H. Hughes.
2001.
Self-priming of retroviral minus-strand strong-stop DNAs.
Virology
285:278-290[CrossRef][Medline].
|
| 9.
|
Gopalakrishnan, V.,
J. A. Peliska, and S. J. Benkovic.
1992.
Human immunodeficiency virus type 1 reverse transcriptase: spatial and temporal relationship between the polymerase and RNase H activities.
Proc. Natl. Acad. Sci. USA
89:10763-10767[Abstract/Free Full Text].
|
| 10.
|
Guo, J.,
L. E. Henderson,
J. Bess,
B. Kane, and J. G. Levin.
1997.
Human immunodeficiency virus type 1 nucleocapsid protein promotes efficient strand transfer and specific viral DNA synthesis by inhibiting TAR-dependent self-priming from minus-strand strong-stop DNA.
J. Virol.
71:5178-5188[Abstract].
|
| 11.
|
Hughes, S. H.,
E. Arnold, and Z. Hostomsky.
1998.
RNase H of retroviral reverse transcriptase, p. 195-224.
In
J. J. Toulmé, and R. J. Crouch (ed.), Ribonucleases H. INSERM Editions, Paris, France.
|
| 12.
|
Jacobo-Molina, A.,
J. Ding,
R. G. Nanni,
A. D. Clark, Jr.,
X. Lu,
C. Tantillo,
R. L. Williams,
G. Kamer,
A. L. Ferris,
P. Clark,
A. Hizi,
S. H. Hughes, and E. Arnold.
1993.
Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed with double-stranded DNA at 3.0 Å resolution shows bent DNA.
Proc. Natl. Acad. Sci. USA
90:6320-6324[Abstract/Free Full Text].
|
| 13.
|
Le Grice, S. F., and F. Grüninger-Leitch.
1990.
Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography.
Eur. J. Biochem.
187:307-314[Medline].
|
| 14.
|
Le Grice, S. F.,
T. Naas,
B. Wohlgensinger, and O. Schatz.
1991.
Subunit-selective mutagenesis indicates minimal polymerase activity in heterodimer-associated p51 HIV-1 reverse transcriptase.
EMBO J.
10:3905-3911[Medline].
|
| 15.
|
Post, K.,
J. Guo,
E. Kalman,
T. Uchida,
R. J. Crouch,
S. F. Le Grice,
P. J. Fay, and R. A. Bambara.
1993.
A large deletion in the connection subdomain of murine leukemia virus reverse transcriptase or replacement of the RNase H domain with Escherichia coli RNase H results in altered polymerase and RNase H activities.
Biochemistry
32:5508-5517[CrossRef][Medline].
|
| 16.
|
Rosenberg, A. H.,
B. N. Lade,
D. S. Chui,
S. W. Lin,
J. J. Dunn, and F. W. Studier.
1987.
Vectors for selective expression of cloned DNAs by T7 RNA polymerase.
Gene
56:125-135[CrossRef][Medline].
|
| 17.
|
Sarafianos, S. G.,
K. Das,
C. Tantillo,
A. D. Clark, Jr.,
J. Ding,
J. M. Whitcomb,
P. L. Boyer,
S. H. Hughes, and E. E. Arnold.
2001.
Crystal structure of HIV-1 reverse transcriptase in complex with a polypurine tract RNA:DNA.
EMBO J.
20:1449-1461[CrossRef][Medline].
|
| 18.
|
Studier, F. W., and B. A. Moffatt.
1986.
Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol.
189:113-130[CrossRef][Medline].
|
| 19.
|
Whitcomb, J. M., and S. H. Hughes.
1992.
Retroviral reverse transcription and integration: progress and problems.
Annu. Rev. Cell Biol.
7:275-306[CrossRef].
|
| 20.
|
Wöhrl, B. M., and K. Moelling.
1990.
Interactin of HIV-1 ribonuclease H with polypurine tract containing RNA-DNA hybrids.
Biochemistry
29:10141-10147[CrossRef][Medline].
|
Journal of Virology, December 2001, p. 11874-11880, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11874-11880.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Schultz, S. J., Zhang, M., Champoux, J. J.
(2006). Sequence, Distance, and Accessibility Are Determinants of 5'-End-directed Cleavages by Retroviral RNases H. J. Biol. Chem.
281: 1943-1955
[Abstract]
[Full Text]
-
Wisniewski, M., Chen, Y., Balakrishnan, M., Palaniappan, C., Roques, B. P., Fay, P. J., Bambara, R. A.
(2002). Substrate Requirements for Secondary Cleavage by HIV-1 Reverse Transcriptase RNase H. J. Biol. Chem.
277: 28400-28410
[Abstract]
[Full Text]
Top
Abstract
Text
